Next Article in Journal
Correction: Murphy et al. Understanding Immune Responses to Lassa Virus Infection and to Its Candidate Vaccines. Vaccines 2022, 10, 1668
Previous Article in Journal
COVID-19 Vaccine Effectiveness Studies against Symptomatic and Severe Outcomes during the Omicron Period in Four Countries in the Eastern Mediterranean Region
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Vaccines
Volume 12
Issue 8
10.3390/vaccines12080908
vaccines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens

by
Mostafa Naguib
1,2,
Shreeya Sharma
1,
Abigail Schneider
1,
Sarah Wehmueller
1 and
Khaled Abdelaziz
1,3,*
1
Department of Animal and Veterinary Science, Clemson University, Clemson, SC 29634, USA
2
Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, Cairo 12211, Egypt
3
Clemson University School of Health Research (CUSHR), Clemson, SC 29634, USA
*
Author to whom correspondence should be addressed.
Vaccines 2024, 12(8), 908; https://doi.org/10.3390/vaccines12080908
Submission received: 1 June 2024 / Revised: 6 August 2024 / Accepted: 7 August 2024 / Published: 10 August 2024
(This article belongs to the Special Issue Vaccines against Enteric Bacterial Pathogens in Poultry)
Browse Figures
Review Reports Versions Notes

Abstract

:
This study was undertaken to evaluate and compare the efficacy of different multi-antigen vaccines, including heat-inactivated, whole lysate, and subunit (outer membrane proteins [OMPs]) C. jejuni vaccines along with the immunostimulant CpG ODN in controlling Campylobacter colonization in chickens. In the first trial, 125 μg of C. jejuni OMPs and 50 μg of CpG ODN were administered individually or in combination, either in ovo to chick embryos or subcutaneously (SC) to one-day-old chicks. In the second trial, different concentrations of C. jejuni antigens (heat-killed, whole lysate, and OMPs) were administered SC to one-day-old chicks. The results of the first trial revealed that SC immunization with the combination of CpG ODN and C. jejuni OMPs elevated interferon (IFN)-γ, interleukin (IL)-1β, and IL-13 gene expression in the spleen, significantly increased serum IgM and IgY antibody levels, and reduced cecal C. jejuni counts by approximately 1.2 log10. In contrast, in ovo immunization did not elicit immune responses or confer protection against Campylobacter. The results of the second trial showed that SC immunization with C. jejuni whole lysate or 200 μg OMPs reduced C. jejuni counts by approximately 1.4 and 1.1 log10, respectively. In conclusion, C. jejuni lysate and OMPs are promising vaccine antigens for reducing Campylobacter colonization in chickens.

1. Introduction

Campylobacter is the leading cause of diarrheal disease in the US, accounting for approximately 1.5 million cases of human campylobacteriosis annually [1]. Thermophilic Campylobacter, mainly C. jejuni and C. coli, commonly colonize wild birds’ guts and domestic fowl (e.g., chickens, turkeys, ducks, and geese) [2,3]. C. jejuni colonizes the intestines of chickens during the second or third week of age, with up to 108 colony-forming units (CFUs)/g found in each gram of intestinal content in infected chickens [4,5,6]. Transmission of this organism to humans usually occurs through contact with farm animals or by consuming their contaminated products, with poultry products being the primary source of infection in most cases [4]. Therefore, it is imperative to implement pre- and post-harvest control measures to decrease the Campylobacter load on poultry carcasses, thereby mitigating the risk of Campylobacter transmission to humans.
Several pre-harvest approaches have been applied to control Campylobacter colonization rates in broiler chickens, including biosecurity practices [5], the use of feed additives, such as prebiotics, probiotics, synbiotics, bacteriophages, organic acids, short-chain fatty acids, and essential oils [6,7,8], and drinking water sanitation [9]. While these interventions have shown potential in reducing C. jejuni loads in chicken intestines, none have completely eliminated its colonization, necessitating exploring more efficacious strategies for on-farm control of Campylobacter. Indeed, vaccination is considered one of the potential measures to control Campylobacter infection in chickens. Yet, none of the vaccines developed by various research groups offer “complete” protection against this bacterium in chickens [10,11,12,13,14].
The challenges in the development of effective vaccination against Campylobacter lie in the unsuccessful identification of a novel, highly conserved immunogenic protein that can induce cross-protective immunity against different strains of C. jejuni, along with the lack of targeted delivery methods for these antigens to mucosal immune inductive sites [15]. In this context, various multi-antigens vaccines, including killed, live attenuated, subunit, and recombinant vaccines, have been explored with differing levels of success [6,16]. Despite their multi-antigen composition, the ineffectiveness of these vaccines in providing adequate protection against Campylobacter was attributed to their lack of effective immunogenic proteins and the unsuccessful experimental setup, such as the use of suboptimal dosages and inefficient vaccination routes.
Among these vaccines, the outer membrane proteins (OMPs) subunit vaccine has shown promise for controlling bacterial foodborne pathogens in chickens, including Salmonella and Campylobacter [11,12,17]. For instance, Annamalai and colleagues have demonstrated that subcutaneous (SC) administration of a crude mixture of C. jejuni OMPs induced systemic protective antibody responses associated with a reduction in C. jejuni colonization in broiler chickens [11]. However, the SC route is impractical for mass administration in poultry production, necessitating further investigation into more suitable methods. While mucosal routes are appropriate for mass vaccination, oral delivery of vaccines remains challenging due to the potential degradation of vaccine antigens and adjuvants by gastric juice and digestive enzymes [13,14]. On the other hand, the in ovo route offers a reliable, cost-effective, and efficient approach for mass immunization, making it an attractive option for vaccinating thousands of birds at hatcheries, in contrast to laborious post-hatching vaccination procedures [18]. Additionally, vaccine antigens delivered to chick embryos before hatching are not diluted by ingested food and have limited exposure to digestive enzymes, thereby prolonging their contact with mucosal tissues.
In contrast to live attenuated vaccines, it is widely agreed that inactivated and subunit vaccines require the incorporation of natural or synthetic adjuvants to enhance their immunogenicity [19]. Among these adjuvants, CpG ODN, a synthetic single-stranded oligodeoxynucleotide containing unmethylated CpG motifs, has demonstrated potential both as a standalone antimicrobial agent and as a vaccine adjuvant [20,21]. CpG ODN is recognized by avian Toll-Like Receptor 21 (TLR21), which is analogous to TLR9 in mammals [22]. When CpG ODN binds to TLR21, it triggers intracellular signaling pathways that stimulate the secretion of immunomodulatory substances like cytokines, chemokines, and antimicrobial peptides, which in turn enhance protection against bacterial pathogens [22,23]. Recent studies have shown that in ovo administration of CpG ODN enhances chicks’ resistance to Escherichia coli and Salmonella Typhimurium infections [24]. However, the potential of in ovo-administered CpG ODN and C. jejuni OMPs to confer protection against C. jejuni has yet to be investigated. Therefore, this study was carried out to assess the efficacy of the in ovo administration of C. jejuni OMPs and CpG ODN, either individually or in combination, against Campylobacter in broiler chickens. A dose optimization trial was also conducted to evaluate and compare the protective effects of different dosages of various multi-antigen Campylobacter vaccines, including whole-cell (heat-killed bacteria and whole lysate) and subunit OMPs vaccines.

2. Materials and Methods

2.1. Preparation of Campylobacter Culture for Experimental Challenge

C. jejuni strain 81–176 was cultured as described previously [13], with minor modifications. Briefly, a loop of frozen C. jejuni glycerol stock was streaked onto Brain Heart Infusion (BHI) agar containing Preston Campylobacter Selective Supplement (Thermo Fisher Scientific, Rockford, IL, USA) and incubated for 24 h at 37 °C under microaerobic conditions of 10% CO2, 5% O2, and 85% N2. Subsequently, a few colonies were inoculated into 5 mL fresh BHI broth and incubated at 37 °C under microaerobic conditions. Following incubation for 24 h, 1 mL of the bacterial suspension was transferred to 100 mL of BHI broth and re-incubated at 37 °C for 40 h. Afterward, the bacterial suspension was centrifuged at 3500× g for 10 min, re-suspended in phosphate buffer saline (PBS; pH 7.4), and the concentration was estimated based on the optical density (OD) measured at 600 nm.

2.2. Vaccine Preparation

2.2.1. CpG ODN

A phosphorothioate-based synthetic class B 2007 CpG ODN, purchased from Invivogen (San Diego, CA, USA), was reconstituted in endotoxin-free water and diluted to working quantities in PBS. For in ovo immunization, 0.1 mL containing 50 µg was injected into the amniotic fluid of the fertilized egg, whereas for SC immunization, 0.2 mL containing 50 µg CpG ODN was injected SC.

2.2.2. Preparation of Campylobacter OMPs

The OMPs of C. jejuni 81–176 were extracted as described previously [25]. Briefly, C. jejuni was grown in 5–10 L of BHI broth following the abovementioned procedure. Following centrifugation for 10 min at 3000× g, the bacterial suspension was washed twice with distilled water. Four grams of packed cells were thoroughly mixed in 100 mL of 0.2 M glycine-hydrochloride buffer (pH 2.2) and stirred for 15 min at room temperature. The suspension was then centrifuged for 15 min at 11,000× g. Afterward, the supernatant was collected and neutralized with 1 N NaOH, and extensive dialysis was performed overnight at 4 °C against deionized water. The protein concentration of the OMPs was quantified using the BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL, USA) and stored at −80 °C until use. Protein separation was confirmed by using SDS-PAGE and Coomassie Blue staining.

2.2.3. Preparation of the Killed Campylobacter Vaccine

C. jejuni was grown in BHI broth, as described above. After washing twice with PBS, the bacterial pellet was resuspended in PBS, and OD was measured. Subsequently, bacterial concentration was adjusted to 5 × 107 and 5 × 108 colony forming units (CFUs) per mL of PBS. Subsequently, bacterial suspension was heat-inactivated at 65 °C for 30 min. An aliquot (100 µL) of the bacterial suspension was streaked onto BHI agar and incubated under microaerobic conditions at 37 °C for 48 h to ensure the complete killing of bacterial cells. No bacterial growth was detected on the agar plate.

2.2.4. Preparation of the Campylobacter Lysate

C. jejuni was grown and resuspended in PBS as described above. The bacterial suspension was subsequently sonicated on ice (twelve 15-second pulses interrupted with 30-second pulses). To ensure complete sonication of the live bacteria, 100 µL of the bacterial suspension was streaked onto BHI agar and incubated under microaerobic conditions at 37 °C for 48 h. No bacterial growth was detected on the agar plate. The protein concentration of the lysate was quantified using the BCA Protein Assay Kit (Thermo Fisher Scientific, Rockford, IL, USA) and served as a biomarker for dosage determination.

2.3. Egg Incubation and Chicken Housing

Commercial fertilized Ross 308 broiler eggs were obtained from a commercial hatchery (Fieldale Farms Corporation, Baldwin, GA, USA) and incubated in a sanitized egg incubator (GQF Manufacturing Company Inc., Savannah, GA, USA) at the Morgan Poultry Center of Clemson University until hatching. Hatched chicks were transferred to the Godley-Snell Facility of Clemson University, where they were fed antibiotic- and additives-free diets ad libitum. All procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at Clemson University (AUP 2022-0411)

2.4. Experimental Design

2.4.1. First Trial

Following incubation and egg candling, 272 embryonated eggs were randomly divided into eight groups, as depicted in Table 1. On the embryonic day (ED)18, 136 eggs were disinfected with 70% ethanol and allocated into four groups (G1–G4), each containing 34 eggs. Afterward, the eggshell was pierced using a 23-gauge needle, and 50 µg CpG ODN in 100 µL PBS or 125 µg C. jejuni OMPs in 100 µL PBS or their combination (50 µL of PBS containing 50 µg CpG ODN mixed thoroughly with 50 µL PBS containing 125 µg OMPs) were injected into the amniotic fluid of the fertilized eggs. The eggs in G4 were injected with PBS and served as a negative control group. The concentrations of CpG ODN and C. jejuni OMPs used in this study were chosen for their established immunostimulatory capabilities and demonstrated effectiveness in reducing Campylobacter counts in previous research [11,24].
Following inoculation, the eggs were transferred to the hatchery. On ED 19, 20, and 21 (days one, two, and three post-immunization [PI]), eight birds per group were euthanized, and the spleen and bursa of Fabricius were collected for gene expression analysis. The remaining eggs continued their incubation until hatching. The hatchability percentage was 94% in the in ovo immunized groups and 85% in the non-immunized groups, indicating that the injected vaccines did not impact the hatchability rate. Hatched chicks in G1-8 were housed in separate pens.
On the first day post-hatch, the non-immunized chicks (n = 136) were randomly divided into four groups (G5–G8), each containing 34 birds. As depicted in Table 1, one-day-old chicks were injected SC with 50 µg CpG ODN in 200 µL PBS or 125 µg C. jejuni OMPs in 200 µL PBS or their combination (100 µL of PBS containing 50 µg mixed thoroughly with 100 µL PBS containing 125 µg OMPs) or PBS. On the second, third, and fourth day of age (days one, two, and three PI), eight birds per group were euthanized, and the spleen and bursa of Fabricius were collected for gene expression analysis.
At one week of age, chicks in groups 1–8 received the booster dose of the respective vaccines, administered orally for groups 1–4 and SC for groups 5–8. At two weeks of age, all groups were challenged orally with 107 CFUs of C. jejuni strain 81–176 in 1 mL PBS. Blood samples were collected weekly from all groups (G1-8), starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the antibody (Ab) levels. On day 35 of age, all chickens were euthanized, and cecal contents were collected to enumerate the C. jejuni colony count (Figure 1).

2.4.2. Second Trial

Eighty one-day-old chicks were randomly divided into eight groups (G1–G8), each containing ten chicks. As depicted in Table 2, chicks were immunized SC with different C. jejuni antigens (the heat-killed or whole lysate or OMPs) or PBS at day one of age. On day 14 of age, chicks received a booster dose of the respective vaccine SC. On day 15 of age, all groups were orally challenged with 107 CFUs of C. jejuni strain 81-176 in 1 mL PBS. Blood samples were collected weekly from all groups (G1-8), starting the first week of age through the fifth week of age, with the sera subsequently separated for measuring the antibody levels. All chickens were euthanized on day 35 of age, and cecal contents were collected for enumeration of C. jejuni colony count (Figure 2).

2.5. RNA Extraction and Complementary DNA (cDNA) Synthesis

The bursa of Fabricius and spleen tissues were homogenized using Bead Ruptor Elite (Omni International, GA, USA) and the RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol. Total RNA was treated with DNase (DNA-free kit, Invitrogen, Carlsbad, CA, USA) to eliminate the genomic DNA. The quality and concentration of RNA were measured by a Nanodrop One spectrophotometer (Thermo Scientific, Greenville County, SC, USA). Reverse transcription to cDNA was carried out using the SuperscriptII First-Strand Synthesis kit (Invitrogen, Carlsbad, CA, USA) and oligo-dT primers (Thermofisher Scientific, Greenville County, SC, USA), following the manufacturer’s protocol. The cDNA was diluted 1:10 in nuclease-free water.

2.6. Quantitative Real-Time PCR (RT-qPCR)

RT-qPCR was performed using the LightCycler480 system (Roche Diagnostics), as previously described [26]. In summary, the PCR master mix contained 3 µL of nuclease-free water, 1 µL of forward and 1 µL of reverse primers (10 µM), and 10 µL of PowerTrack SYBR Green Master Mix (ThermoFisher Scientific, Baltics UAB, Vilnius, Lithuania). The total volume of each reaction was 20 µL consisting of 5 µL of cDNA and 15 µL of the master mix. The RT-qPCR cycling parameters comprised a 95 °C denaturation step, 45 cycles of amplification (95 °C for 10 s), annealing (optimal temperature for each primer is provided in Table 3), and extension (72 °C for 10 s). To make the melting curve, heating to 95 °C for 10 s, cooling to 65 °C for 1 min, and heating again to 97 °C was performed. In this investigation, all primers used were synthesized by MilliporeSigma (Burlington, MA, USA). Roche LightCycler 480 software was used to calculate the expression of the target genes relative to the reference gene (β-actin), employing the 2−ΔΔCT method as described earlier [27], with qPCR efficiency ranging from 95% to 100%.

2.7. Enzyme-Linked Immunosorbent Assay (ELISA) for Measuring Serum IgY and IgM Antibody Levels

Serum IgY and IgM Ab levels were measured as previously described [35]. Briefly, Maxisorp 96 well plates (Thermo Fisher Scientific, Rochester, NY, USA) were coated with OMPs of C. jejuni (0.39 µg/100 µL) in PBS (pH 7.4) and incubated at 37 °C for two hours. The plates were washed four times with the washing buffer (PBS containing 0.05% Tween 20), then blocked with blocking buffer containing 0.5% pig gelatin (Sigma, St. Louis, MO, USA) and 0.05% Tween 20 in PBS and incubated at 37 °C for one hour. Following blocking, 100 µL of sera diluted 1/10 in PBS containing 1.5% Tween-20 and 0.29 M NaCl were added to wells in duplicate, followed by a one-hour incubation at 37 °C. After the plates were washed four times with the washing buffer, 100 µL of goat-anti-chicken HRP-conjugated IgM (Invitrogen, USA) or IgY (Sigma, USA) antibodies were added at a dilution of 1/10,000 or 1/4000, respectively, and then incubated at 37 °C for 30 min. After washing the plates twice with the washing buffer, 100 µL of ABTS (2, 2′-azino-di (3-ethyl-benzthiazoline-6-sulfonate)) substrate (Life Technologies, Frederick, MD, USA) was added to wells. After incubation at room temperature for 30 min, the reaction was stopped by adding 1% sodium dodecyl sulfate (Bio-Rad, Hercules, CA, USA) to wells and the optical densities were evaluated at 405 nm.

2.8. Enumeration of C. jejuni Colony Count

At 35 days of age, chickens in all groups were necropsied, cecal contents were collected, and ten-fold serial dilutions were performed for up to six dilutions in PBS. Each dilution was plated on BHI agar containing Preston Campylobacter Selective Supplement. Plates were incubated for 48 h at 37 °C under microaerobic conditions (85% N2, 10% CO2, and 5% O2). The cecal C. jejuni CFUs were quantified and presented as log10 C. jejuni/gram of cecal content.

2.9. Statistical Analysis

Data were analyzed using JMP® Pro 17.1.0 (JMP, SAS Institute Inc., Cary, NC, USA), and graphs were created using GraphPad Prism V5.0 (GraphPad Software, San Diego, CA, USA). The Shapiro–Wilk test was used to assess the normality of data distribution. The impact of treatments on colony count, relative expression of immune genes, and Ab levels were assessed using both parametric and non-parametric tests. For normally distributed data, one-way ANOVA was used, followed by Tukey’s post hoc test to determine differences among the means of treatment groups. For non-normally distributed data, the Kruskal–Wallis test was used, followed by Dunn’s test. Data are presented as the mean of colony count, relative gene expression and Ab level ± standard error of the mean (SEM). p < 0.05 was considered significant for all statistical tests. The correlation between serum Ab levels at the fifth week of age and CFUs of Campylobacter was assessed using Pearson’s r correlation coefficient.

3. Results

3.1. First Trial

3.1.1. The Effects of in Ovo and SC Administration of C. jejuni OMPs and CpG ODN on Cecal Colonization with C. jejuni

The number of C. jejuni CFUs per gram of cecal content varied significantly among the immunized and non-immunized groups (p < 0.05) (Figure 3). No significant reduction in Campylobacter counts was observed in the groups immunized in ovo with CpG ODN or C. jejuni OMPs or their combination compared to the PBS control group. On the other hand, SC immunization of chickens with the combination of 50 μg CpG ODN and 125 μg C. jejuni OMPs significantly reduced cecal colonization with C. jejuni by 1.2 log10 (p < 0.05). While SC immunization with 50 μg CpG ODN reduced C. jejuni colonization by 1 log10, immunization with 125 μg C. jejuni OMPs had no significant effect on the Campylobacter count. A subsequent study was conducted to determine if using different concentrations of C. jejuni OMPs and adjusting the timing of the secondary/booster vaccination would result in a greater reduction in Campylobacter count.

3.1.2. The Effects of in Ovo and SC Administration of C. jejuni OMPs and CpG ODN on the Serum Ab Levels

Serum IgY Ab Levels

No significant differences in IgY Ab levels were observed among the immunized and control groups at the first and second weeks of age. However, by the third week of age, IgY Ab levels were significantly elevated only in the group immunized with the combination of CpG ODN and C. jejuni OMPs (p < 0.0001) and consistently increased until the fifth week of age, compared to the PBS control group (Figure 4). The level of IgY Ab levels was significantly higher in the group immunized SC with both CpG ODN and C. jejuni OMPs compared to the other immunized groups except at week four of age, where it was not significantly different from the group immunized in ovo with CpG ODN. No correlation (r = 0.3962, p = 0.145) was observed between the cecal C. jejuni CFUs and serum IgY antibody levels in the group immunized with a combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age (Figure 5).

Serum IgM Ab Levels

Similar to the pattern observed with IgY antibody levels, chickens immunized SC with both 50 μg CpG ODN and 125 μg C. jejuni OMPs exhibited significantly higher IgM levels than the PBS control group, starting from the third week (p < 0.0001) through the fifth week of age (Figure 6). However, the groups immunized SC and in ovo with either 125 μg C. jejuni OMPs or CpG ODN alone did not show significant increases in IgM antibody levels at any time point.
A significant increase in IgM antibody levels was observed in the group immunized in ovo with both CpG ODN and C. jejuni OMPs only at the fourth week of age. Similar to the observation made for serum IgY, no correlation was observed between the groups with the low colony count and high IgM Ab titers at the fifth week of age (r = 0.4457, p = 0.1146) (Figure 7).

3.1.3. The Effects of in Ovo and SC Administration of C. jejuni OMPs and CpG ODN on Cytokine Gene Expression in the Spleen and Bursa of Fabricius

The expression levels of IFN-γ, interleukin (IL)-1β, IL-4, IL-10, IL-13, transforming growth factor (TGF)-β), and B cell activating factor (BAFF) were measured in the spleen and bursa of Fabricius during three consecutive days PI. Spleens of chicks immunized SC with 50 μg CpG ODN showed a significant increase in IFN-γ expression at 24 h PI (p < 0.05) (Figure 8). However, no significant differences in IFN-γ gene expression were observed at 48 and 72 h PI compared to the PBS control group. Spleens of chicks in the groups immunized SC with 50 μg CpG ODN and the combination of 50 μg CpG ODN and 125 μg C. jejuni OMPs exhibited significantly increased expression levels of IL-13 at 24 h compared to the PBS control group. A significant upregulation of IL-1β expression was observed in the group immunized SC with both CpG ODN and C. jejuni OMPs at 24 and 48 h PI (p < 0.05) (Figure 8). However, SC immunization with C. jejuni OMPs did not significantly alter the expression of IFN-γ, IL-13, and IL-1β at any time point when compared against the PBS control group. SC and in ovo immunization with C. jejuni OMPs alone did not significantly modulate the gene expression of IFN-γ, IL-13, and IL-1β at all time points compared to the PBS control group (Figure 8 and Figure 9). No significant alterations were observed in the expression levels of IL-4, IL-10, TGF-β, and BAFF in the spleen of all immunized groups at any time point.
No significant changes were observed in the expression levels of all the genes measured in this study in the bursa of Fabricius of all immunized groups.

3.2. Second Trial

3.2.1. The Effects of SC Administration of Various Concentrations of C. jejuni OMPs, Heat-Killed and Whole Lysate Vaccines on Cecal Colonization with C. jejuni

Immunizing chickens SC on the first day and second week of age with a low dose of C. jejuni lysate (21.5 µg) or low (50 μg) and high (200 μg) doses of C. jejuni OMPs significantly reduced cecal colonization with C. jejuni by 1.4 (p = 0.0004), 1 (p = 0.038), and 1.1 (p = 0.005) log10 per gram of content, respectively, compared to the PBS control group (Figure 10). However, a lower but not statistically significant reduction of cecal colonization by 0.8 log10 was observed in the group immunized with 125 μg OMPs. No significant reductions in C. jejuni colony counts were observed in the groups immunized with a high dose (43 μg) of lysate and both low (106 CFUs) and high (107 CFUs) doses of heat-killed C. jejuni.

3.2.2. The Effects of SC Administration of Various Concentrations of C. jejuni OMPs, Heat-Killed and Whole Lysate Vaccines on the Serum Ab Levels

Serum IgY Ab Levels

No significant changes in the levels of IgY Ab levels were observed among the immunized and the PBS control groups during the first three weeks of age (Figure 11). However, by the fourth week of age, IgY Ab levels were significantly elevated only in the group immunized with the low dose (50 µg) of OMPs and continued to rise until the fifth week of age, compared to the PBS control group (p < 0.0001). Significantly higher IgY Ab levels were observed in the group immunized with the high dose of C. jejuni lysate only at the fourth week of age (p < 0.0001) compared to the PBS control group. However, no significant changes in the levels of IgY Ab levels were observed in the other immunized groups compared to the PBS control group (Figure 11).

Serum IgM Ab Levels

No significant differences in the levels of IgM Ab levels were observed among the immunized and PBS control groups at all time points (Figure 12).

4. Discussion

Reducing the Campylobacter load on chicken meat is crucial for preventing human infection with this pathogen [36]. A recent modeling study estimated that reducing cecal colonization with Campylobacter by 3 log10 units could lower the incidence of disease in humans by 58% [37]. Since no commercial vaccines are currently available, further research is needed to explore effective vaccination strategies to reduce Campylobacter burden in chickens.
Campylobacter establishes early colonization by the second or third week of age due to the limited capacity of maternally derived antibodies (MDA) to provide prolonged protection beyond the second week of age [12,38]. Thus, early vaccination is necessary to boost the chick’s resistance to Campylobacter infection.
Despite the incomplete development of the immune system in the chicken embryo, accumulating evidence indicates that in ovo administration of vaccines and immunostimulants induces immune responses in lymphoid organs, including the spleen and bursa of Fabricius [39,40] and confer protection against viral and bacterial diseases [41,42,43,44,45]. Indeed, in ovo vaccination is currently being used worldwide for protection against viral diseases, including Marek’s disease [42] and infectious bursal disease [46]. In the context of foodborne pathogens, in ovo administration of TLR21 ligand (CpG ODN) has been shown to elicit a robust immune response and enhance chickens’ resistance against infection with E. coli and Salmonella species [21,47]. Along similar lines, in ovo delivery of Salmonella OMPs-loaded nanoparticles has been shown to induce antigen-specific immune response associated with a reduction in Salmonella colonization [48].
The effectiveness of in ovo vaccination can be attributed to the rapid and concurrent activation of immune responses in mucosal surfaces and lymphoid organs since these antigens can be readily uptaken from the amniotic fluid by multiple routes, including oral, respiratory and cloacal routes [19,20]. Despite the effectiveness of in ovo delivered CpG ODN and bacterial OMPs in modulating the immune system of chick embryos [20,49] and providing protection against E. coli and Salmonella [21], no studies have assessed their protective effects against Campylobacter infection in chickens when administered in ovo. Therefore, the first goal of this study was to evaluate and compare the protective efficacy of C. jejuni OMPs and CpG ODN, either individually or in combination, against Campylobacter infection in broiler chickens when administered either in ovo to chick embryos or SC to hatched chicks.
While Annamalai and colleagues demonstrated a significant reduction in Campylobacter count in chickens immunized SC with 125 µg of C. jejuni OMPs [11], this concentration of OMPs did not exert the same efficacy in the current study. The variations observed in these outcomes could be attributed to differences in experimental design since in our study, chicks were immunized SC on days one and seven of age and challenged with Campylobacter at day 14 of age, whereas Annamalai’s study involved immunization at one week and third week of age and Campylobacter challenge at day 35 of age. Another potential factor could be variations in the preparation methods of the OMPs. Nonetheless, co-administration of CpG ODN with C. jejuni OMPs significantly reduced C. jejuni counts by approximately 1.2 log10. When administered alone, CpG ODN reduced Campylobacter counts by approximately 1 log10, which aligns with our earlier observations [13].
While the reduction of Campylobacter counts was comparable between the group receiving CpG ODN alone and the group receiving both CpG ODN and C. jejuni OMPs, consistently higher levels of IgY and IgM antibody levels were observed solely in the latter group. However, consistent with our earlier observations [13], no correlation was noted in the groups with low C. jejuni CFUs and higher IgY and IgM Ab levels at the fifth week of age. It is worth noting that no differences in Ab levels were observed during the first two weeks of age, but increased levels were noted in the immunized groups starting from the third week of age and in the challenged group starting from the fourth week of age. This might be due to the absence of interfering effects of MDA on seroconversion following vaccination, as their levels significantly decreased by the second week of age and/or due to age-related changes in the immune system. These findings suggest that delaying the booster vaccination may be necessary to prevent potential interference from MDA with the antibody response and to achieve more efficient immune responses to the injected vaccine. Thus, in the subsequent study, we sought to investigate whether giving the booster doses of the vaccines at the second week of age would result in better outcomes.
To investigate the immunological mechanisms of protection further, the relative expression of key immune genes crucial in shaping the adaptive immune response was measured in the spleen and bursa of Fabricius of the immunized chickens. This included the T helper (Th)1-type cytokine (IFN)-γ, Th2-type cytokines (IL-4 and IL-13), proinflammatory cytokines (IL-1β), T regulatory cytokines (IL-10 and TGF-β), and B cell activating factor (BAFF) [50,51,52,53]. Varied expression levels of IFN-γ, IL-1β, and IL-13 cytokines were noted among the groups with lower Campylobacter colony counts. Specifically, the group immunized with CpG ODN showed elevated expression of IFN-γ, while the group immunized with the combination of CpG ODN and C. jejuni OMPs exhibited increased expression of IL-1β and IL-13.
In addition to their proinflammatory role, induction of IFN-γ and IL-1β trigger the differentiating of naïve CD4+ T cells to Th1 and Th2 cells, respectively [26,54]. The increased expression of IFN-γ and IL-1β observed in this study aligns with our previous findings, where elevated expression of these genes was noted in the cecal tonsils and ileum following oral administration of CpG ODN, which correlated with a significant reduction in Campylobacter in broiler chicken [29]. In another study, an association was observed between the resolution of S. Typhimurium infection in experimentally infected hens and the increased expression of IFN-γ and IL-1β in the spleen and cecal tonsils [55]. Moreover, our previous in vitro study demonstrated the capacity of C. jejuni OMPs to induce robust immune responses in chicken macrophages and cecal tonsil mononuclear cells, including high expression levels of IFN-γ, IL-1β, and IL-13 [56].
Considering the role of IL-13 in the activation and differentiation of B cells and modulation of antibody-mediated immune responses against invading pathogens [52], the notable increase in the expression of IL-13 in the group receiving CpG ODN and C. jejuni OMPs may explain the enhanced IgM and IgY in this group and the associated reduction in Campylobacter counts.
While CpG ODN and C. jejuni OMPs have shown the ability to induce immune responses and lower Campylobacter colonization when delivered SC, no such effects were observed when delivered in ovo and orally. The lack of consistent activity in these delivery methods could be ascribed to their chemical or mechanical degradation within the gastrointestinal tract [12]. These findings align with our previous research showing that administering soluble CpG ODN orally did not provide significant protection against Campylobacter [29]. However, encapsulating CpG ODN with PLGA nanoparticles was shown to enhance its immunostimulatory properties and protective effectiveness against Campylobacter colonization [13,57]. Hence, further investigations are needed to determine whether incorporating CpG ODN and C. jejuni OMPs into nanoparticles and administering them in ovo could improve their bioavailability at intestinal immune inductive sites, enhance mucosal and systemic immune responses, and provide protection against Campylobacter infection.
A second goal of this study was to optimize and evaluate the protective effects of various concentrations of C. jejuni OMPs and investigate whether altering the timing of the booster dose from the first week of age to the second week would lead to higher Ab production and better protection against Campylobacter colonization. We also deemed it worthwhile to examine the protective efficacy of multi-antigen vaccines, including heat-killed Campylobacter and whole-lysate vaccines, to identify the optimal antigens and dosages for future in ovo application. A significant reduction in Campylobacter counts was noted in the groups administered 50 or 200 µg of C. jejuni OMPs or a low dose of C. jejuni lysate. However, in line with the outcomes of the first study, no significant reduction in colony counts was observed in the group given 125 µg of C. jejuni OMPs. A significant increase in IgY antibody production was observed in the groups administered 50 µg of C. jejuni OMPs only at the third and fourth week of age. These results underscore the necessity of optimizing the dosage and timing of OMPs administration to enhance its effectiveness.
Inactivated vaccines are known for their poor immunogenicity due to their limited ability to stimulate an adaptive immune response, making the inclusion of adjuvants necessary to enhance their effectiveness. In the context of their efficacy against Campylobacter, Glünder and colleagues observed a slight reduction in Campylobacter colonization in chickens vaccinated subcutaneously with formalin-inactivated C. jejuni and complete Freund’s adjuvant. Consistent with these observations, our results showed that SC immunization with heat-inactivated Campylobacter reduced the Campylobacter count by approximately 0.6 log10 [58]. In contrast, SC immunization with the whole lysate of Campylobacter resulted in a significant reduction in C. jejuni counts by approximately 1.4. These findings confirm and expand upon our earlier observations that orally administered Campylobacter lysate can reduce Campylobacter colonization [13].
Taken together, while C. jejuni lysate and OMPs have shown potential in reducing Campylobacter counts, the specific immunogenic protein responsible for these effects remains unclear. Additionally, it should be noted that their efficacy was evaluated in a homologous challenge model, and whether they demonstrate similar efficacy in a heterologous challenge model requires further investigation.

5. Conclusions

The findings of the present study suggest that vaccine formulations containing C. jejuni lysate or a combination of OMPs and CpG ODN show promise for reducing C. jejuni in broiler chickens. However, since the SC route is impractical for mass administration, further research is needed to determine whether using nanoparticles as a vaccine carrier could enhance their effectiveness in reducing Campylobacter colonization through more feasible routes, such as oral and in ovo administration.

Author Contributions

Conceptualization, K.A.; methodology and data collection, M.N., S.S., A.S., S.W., and K.A.; data processing and analysis, M.N. and K.A.; writing—original draft preparation, M.N. and K.A.; writing—review and editing, M.N., S.S., A.S., S.W., and K.A.; supervision, K.A. All authors have read and agreed to the published version of the manuscript.

Funding

This work is supported by the USDA National Institute of Food and Agriculture, Hatch Project number SC-1700628 [Accession Number 7004405 & Technical Contribution No. 7308]. This project was also funded in part by Clemson University’s R-Initiatives.

Institutional Review Board Statement

All procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at Clemson University.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

We thank the Fieldale Farms Corporation for their generous assistance in supplying fertilized broiler eggs, which greatly facilitated our research. The assistance of the Godley-Snell Research Center (GSRC) and the Morgan Poultry Center (MPC) staff is gratefully acknowledged.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Campylobacter (Campylobacteriosis). Available online: https://www.cdc.gov/campylobacter/index.html (accessed on 14 April 2024).
  2. Gölz, G.; Rosner, B.; Hofreuter, D.; Josenhans, C.; Kreienbrock, L.; Löwenstein, A.; Schielke, A.; Stark, K.; Suerbaum, S.; Wieler, L.H. Relevance of Campylobacter to public health—The need for a One Health approach. Int. J. Med. Microbiol. 2014, 304, 817–823. [Google Scholar] [CrossRef] [PubMed]
  3. Sahin, O.; Morishita, T.Y.; Zhang, Q. Campylobacter colonization in poultry: Sources of infection and modes of transmission. Anim. Health Res. Rev. 2002, 3, 95–105. [Google Scholar] [CrossRef] [PubMed]
  4. Newell, D.G.; Fearnley, C. Sources of Campylobacter colonization in broiler chickens. Appl. Environ. Microbiol. 2003, 69, 4343–4351. [Google Scholar] [CrossRef] [PubMed]
  5. Smith, S.; Messam, L.L.M.; Meade, J.; Gibbons, J.; McGill, K.; Bolton, D.; Whyte, P. The impact of biosecurity and partial depopulation on Campylobacter prevalence in Irish broiler flocks with differing levels of hygiene and economic performance. Infect. Ecol. Epidemiol. 2016, 6, 31454. [Google Scholar] [PubMed]
  6. Taha-Abdelaziz, K.; Singh, M.; Sharif, S.; Sharma, S.; Kulkarni, R.R.; Alizadeh, M.; Yitbarek, A.; Helmy, Y.A. Intervention strategies to control Campylobacter at different stages of the food chain. Microorganisms 2023, 11, 113. [Google Scholar] [CrossRef] [PubMed]
  7. Ty, M.; Taha-Abdelaziz, K.; Demey, V.; Castex, M.; Sharif, S.; Parkinson, J. Performance of distinct microbial based solutions in a Campylobacter infection challenge model in poultry. Anim. Microbiome 2022, 4, 2. [Google Scholar] [CrossRef] [PubMed]
  8. Hermans, D.; Van Deun, K.; Martel, A.; Van Immerseel, F.; Messens, W.; Heyndrickx, M.; Haesebrouck, F.; Pasmans, F. Colonization factors of Campylobacter jejuni in the chicken gut. Vet. Res. 2011, 42, 82. [Google Scholar] [CrossRef] [PubMed]
  9. Metcalf, J.H.; Donoghue, A.M.; Venkitanarayanan, K.; Reyes-Herrera, I.; Aguiar, V.F.; Blore, P.J.; Donoghue, D.J. Water administration of the medium-chain fatty acid caprylic acid produced variable efficacy against enteric Campylobacter colonization in broilers. Poult. Sci. 2011, 90, 494–497. [Google Scholar] [CrossRef] [PubMed]
  10. Meunier, M.; Guyard-Nicodème, M.; Vigouroux, E.; Poezevara, T.; Béven, V.; Quesne, S.; Amelot, M.; Parra, A.; Chemaly, M.; Dory, D. A DNA prime/protein boost vaccine protocol developed against Campylobacter jejuni for poultry. Vaccine 2018, 36, 2119–2125. [Google Scholar] [CrossRef] [PubMed]
  11. Annamalai, T.; Pina-Mimbela, R.; Kumar, A.; Binjawadagi, B.; Liu, Z.; Renukaradhya, G.J.; Rajashekara, G. Evaluation of nanoparticle-encapsulated outer membrane proteins for the control of Campylobacter jejuni colonization in chickens. Poult. Sci. 2013, 92, 2201–2211. [Google Scholar] [CrossRef]
  12. Pumtang-On, P.; Mahony, T.J.; Hill, R.A.; Vanniasinkam, T. A systematic review of Campylobacter jejuni vaccine candidates for chickens. Microorganisms 2021, 9, 397. [Google Scholar] [CrossRef] [PubMed]
  13. Taha-Abdelaziz, K.; Hodgins, D.C.; Alkie, T.N.; Quinteiro-Filho, W.; Yitbarek, A.; Astill, J.; Sharif, S. Oral administration of PLGA-encapsulated CpG ODN and Campylobacter jejuni lysate reduces cecal colonization by Campylobacter jejuni in chickens. Vaccine 2018, 36, 388–394. [Google Scholar] [CrossRef] [PubMed]
  14. Vandeputte, J.; Martel, A.; Van Rysselberghe, N.; Antonissen, G.; Verlinden, M.; De Zutter, L.; Heyndrickx, M.; Haesebrouck, F.; Pasmans, F.; Garmyn, A. In ovo vaccination of broilers against Campylobacter jejuni using a bacterin and subunit vaccine. Poult. Sci. 2019, 98, 5999–6004. [Google Scholar] [CrossRef] [PubMed]
  15. Lin, J. Novel approaches for Campylobacter control in poultry. Foodborne Pathog. Dis. 2009, 6, 755–765. [Google Scholar] [CrossRef] [PubMed]
  16. Helmy, Y.A.; Taha-Abdelaziz, K.; Hawwas, H.A.E.; Ghosh, S.; AlKafaas, S.S.; Moawad, M.M.; Saied, E.M.; Kassem, I.I.; Mawad, A.M. Antimicrobial resistance and recent alternatives to antibiotics for the control of bacterial pathogens with an emphasis on foodborne pathogens. Antibiotics 2023, 12, 274. [Google Scholar] [CrossRef] [PubMed]
  17. Han, Y.; Renu, S.; Patil, V.; Schrock, J.; Feliciano-Ruiz, N.; Selvaraj, R.; Renukaradhya, G.J. Immune response to Salmonella enteritidis infection in broilers immunized orally with chitosan-based Salmonella subunit nanoparticle vaccine. Front. Immunol. 2020, 11, 935. [Google Scholar] [CrossRef] [PubMed]
  18. Ricks, C.A.; Avakian, A.; Bryan, T.; Gildersleeve, R.; Haddad, E.; Ilich, R.; King, S.; Murray, L.; Phelps, P.; Poston, R. In ovo vaccination technology. Adv. Vet. Med. 1999, 41, 495–515. [Google Scholar] [PubMed]
  19. Abdelaziz, K.; Helmy, Y.A.; Yitbarek, A.; Hodgins, D.C.; Sharafeldin, T.A.; Selim, M.S. Advances in Poultry Vaccines: Leveraging Biotechnology for Improving Vaccine Development, Stability, and Delivery. Vaccines 2024, 12, 134. [Google Scholar] [CrossRef] [PubMed]
  20. Gunawardana, T.; Foldvari, M.; Zachar, T.; Popowich, S.; Chow-Lockerbie, B.; Ivanova, M.V.; Tikoo, S.; Kurukulasuriya, S.; Willson, P.; Gomis, S. Protection of neonatal broiler chickens following in ovo delivery of oligodeoxynucleotides containing CpG motifs (CpG-ODN) formulated with carbon nanotubes or liposomes. Avian Dis. 2015, 59, 31–37. [Google Scholar] [CrossRef] [PubMed]
  21. Gomis, S.; Babiuk, L.; Godson, D.L.; Allan, B.; Thrush, T.; Townsend, H.; Willson, P.; Waters, E.; Hecker, R.; Potter, A. Protection of chickens against Escherichia coli infections by DNA containing CpG motifs. Infect. Immun. 2003, 71, 857–863. [Google Scholar] [CrossRef] [PubMed]
  22. Keestra, A.M.; de Zoete, M.R.; Bouwman, L.I.; van Putten, J.P. Chicken TLR21 is an innate CpG DNA receptor distinct from mammalian TLR. J. Immunol. 2010, 185, 460–467. [Google Scholar] [CrossRef] [PubMed]
  23. de Zoete, M.R.; Keestra, A.M.; Roszczenko, P.; van Putten, J.P. Activation of human and chicken toll-like receptors by Campylobacter spp. Infect. Immun. 2010, 78, 1229–1238. [Google Scholar] [CrossRef] [PubMed]
  24. Gunawardana, T.; Ahmed, K.A.; Goonewardene, K.; Popowich, S.; Kurukulasuriya, S.; Karunarathna, R.; Gupta, A.; Lockerbie, B.; Foldvari, M.; Tikoo, S.K. Synthetic CpG-ODN rapidly enriches immune compartments in neonatal chicks to induce protective immunity against bacterial infections. Sci. Rep. 2019, 9, 341. [Google Scholar] [CrossRef] [PubMed]
  25. McCoy, E.C.; Doyle, D.; Burda, K.; Corbeil, L.B.; Winter, A.J. Superficial antigens of Campylobacter (Vibrio) fetus: Characterization of antiphagocytic component. Infect. Immun. 1975, 11, 517–525. [Google Scholar] [CrossRef] [PubMed]
  26. Taha-Abdelaziz, K.; Alkie, T.N.; Hodgins, D.C.; Shojadoost, B.; Sharif, S. Characterization of host responses induced by Toll-like receptor ligands in chicken cecal tonsil cells. Vet. Immunol. Immunopathol. 2016, 174, 19–25. [Google Scholar] [CrossRef] [PubMed]
  27. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  28. Taha-Abdelaziz, K.; Astill, J.; Kulkarni, R.R.; Read, L.R.; Najarian, A.; Farber, J.M.; Sharif, S. In vitro assessment of immunomodulatory and anti-Campylobacter activities of probiotic lactobacilli. Sci. Rep. 2019, 9, 17903. [Google Scholar] [CrossRef] [PubMed]
  29. Taha-Abdelaziz, K.; Alkie, T.N.; Hodgins, D.C.; Yitbarek, A.; Shojadoost, B.; Sharif, S. Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni. Vet. Microbiol. 2017, 212, 67–74. [Google Scholar] [CrossRef] [PubMed]
  30. Abdelaziz, K.; Nixon, T.; Joye, A.; Hassan, H.; Alizadeh, M.; Sharif, S.; Kulkarni, R.R. Modulation of functional activity of heat-stressed chicken macrophages by poultry-derived probiotic lactobacilli. Can. J. Anim. Sci. 2022. [Google Scholar] [CrossRef]
  31. Paul, M.S.; Mallick, A.I.; Haq, K.; Orouji, S.; Abdul-Careem, M.F.; Sharif, S. In vivo administration of ligands for chicken toll-like receptors 4 and 21 induces the expression of immune system genes in the spleen. Vet. Immunol. Immunopathol. 2011, 144, 228–237. [Google Scholar] [CrossRef] [PubMed]
  32. Sławinska, A.; Siwek, M.Z.; Bednarczyk, M.F. Effects of synbiotics injected in ovo on regulation of immune-related gene expression in adult chickens. Am. J. Vet. Res. 2014, 75, 997–1003. [Google Scholar] [CrossRef] [PubMed]
  33. Ko, K.H.; Lee, I.K.; Kim, G.; Gu, M.J.; Kim, H.Y.; Park, B.; Park, T.S.; Han, S.H.; Yun, C. Changes in bursal B cells in chicken during embryonic development and early life after hatching. Sci. Rep. 2018, 8, 16905. [Google Scholar] [CrossRef] [PubMed]
  34. Brisbin, J.T.; Gong, J.; Parvizi, P.; Sharif, S. Effects of lactobacilli on cytokine expression by chicken spleen and cecal tonsil cells. Clin. Vaccine Immunol. 2010, 17, 1337–1343. [Google Scholar] [CrossRef] [PubMed]
  35. Hodgins, D.C.; Barjesteh, N.; St. Paul, M.; Ma, Z.; Monteiro, M.A.; Sharif, S. Evaluation of a polysaccharide conjugate vaccine to reduce colonization by Campylobacter jejuni in broiler chickens. BMC Res. Notes 2015, 8, 204. [Google Scholar] [CrossRef] [PubMed]
  36. Nauta, M.J.; Johannessen, G.; Adame, L.L.; Williams, N.; Rosenquist, H. The effect of reducing numbers of Campylobacter in broiler intestines on human health risk. Microb. Risk Anal. 2016, 2, 68–77. [Google Scholar] [CrossRef]
  37. EFSA Panel on Biological Hazards (BIOHAZ); Koutsoumanis, K.; Allende, A.; Alvarez-Ordóñez, A.; Bolton, D.; Bover-Cid, S.; Davies, R.; De Cesare, A.; Herman, L.; Hilbert, F. Update and review of control options for Campylobacter in broilers at primary production. EFSA J. 2020, 18, e06090. [Google Scholar] [PubMed]
  38. El-Shibiny, A.; Connerton, P.L.; Connerton, I.F. Enumeration and diversity of campylobacters and bacteriophages isolated during the rearing cycles of free-range and organic chickens. Appl. Environ. Microbiol. 2005, 71, 1259–1266. [Google Scholar] [CrossRef] [PubMed]
  39. Sharma, S.; Kulkarni, R.R.; Sharif, S.; Hassan, H.; Alizadeh, M.; Pratt, S.; Abdelaziz, K. In ovo feeding of probiotic lactobacilli differentially alters expression of genes involved in the development and immunological maturation of bursa of Fabricius in pre-hatched chicks. Poult. Sci. 2024, 103, 103237. [Google Scholar] [CrossRef] [PubMed]
  40. Szczypka, M.; Suszko-Pawłowska, A.; Kuczkowski, M.; Gorczykowski, M.; Lis, M.; Kowalczyk, A.; Łukaszewicz, E.; Poradowski, D.; Zbyryt, I.; Bednarczyk, M. Effects of selected prebiotics or synbiotics administered in ovo on lymphocyte subsets in bursa of the fabricius, thymus, and spleen in non-immunized and immunized chicken broilers. Animals 2021, 11, 476. [Google Scholar] [CrossRef] [PubMed]
  41. McGruder, E.D.; Ramirez, G.A.; Kogut, M.H.; Moore, R.W.; Corrier, D.E.; DeLoach, J.R.; Hargis, B.M. In ovo administration of Salmonella enteritidis-immune lymphokines confers protection to neonatal chicks against Salmonella enteritidis organ infectivity. Poult. Sci. 1995, 74, 18–25. [Google Scholar] [CrossRef]
  42. Gimeno, I.M.; Faiz, N.M.; Cortes, A.L.; Barbosa, T.; Villalobos, T.; Pandiri, A.R. In ovo vaccination with turkey herpesvirus hastens maturation of chicken embryo immune responses in specific-pathogen-free chickens. Avian Dis. 2015, 59, 375–383. [Google Scholar] [CrossRef] [PubMed]
  43. McCarty, J.E.; Brown, T.P.; Giambrone, J.J. Delay of infectious bursal disease virus infection by in ovo vaccination of antibody-positive chicken eggs. J. Appl. Poult. Res. 2005, 14, 136–140. [Google Scholar] [CrossRef]
  44. Alizadeh, M.; Shojadoost, B.; Astill, J.; Taha-Abdelaziz, K.; Karimi, S.H.; Bavananthasivam, J.; Kulkarni, R.R.; Sharif, S. Effects of in ovo inoculation of multi-Strain Lactobacilli on cytokine gene expression and antibody-mediated Immune responses in chickens. Front. Vet. Sci. 2020, 7, 105. [Google Scholar] [CrossRef] [PubMed]
  45. Alizadeh, M.; Astill, J.; Alqazlan, N.; Shojadoost, B.; Taha-Abdelaziz, K.; Bavananthasivam, J.; Doost, J.S.; Sedeghiisfahani, N.; Sharif, S. In ovo co-administration of vitamins (A and D) and probiotic lactobacilli modulates immune responses in broiler chickens. Poult. Sci. 2022, 101, 101717. [Google Scholar] [CrossRef] [PubMed]
  46. Moura, L.; Vakharia, V.; Liu, M.; Song, H. In ovo vaccine against infectious bursal disease. Md. Int. J. Poult. Sci. 2007, 6, 770–775. [Google Scholar] [CrossRef]
  47. Taghavi, A.; Allan, B.; Mutwiri, G.; Van Kessel, A.; Willson, P.; Babiuk, L.; Potter, A.; Gomis, S. Protection of neonatal broiler chicks against Salmonella Typhimurium septicemia by DNA containing CpG motifs. Avian Dis. 2008, 52, 398–406. [Google Scholar] [CrossRef] [PubMed]
  48. Acevedo-Villanueva, K.; Renu, S.; Gourapura, R.; Selvaraj, R. Efficacy of a nanoparticle vaccine administered in-ovo against Salmonella in broilers. PLoS ONE 2021, 16, e0247938. [Google Scholar] [CrossRef] [PubMed]
  49. Ruvalcaba-Gómez, J.M.; Villagrán, Z.; Valdez-Alarcón, J.J.; Martínez-Núñez, M.; Gomez-Godínez, L.J.; Ruesga-Gutiérrez, E.; Anaya-Esparza, L.M.; Arteaga-Garibay, R.I.; Villarruel-López, A. Non-antibiotics strategies to control Salmonella infection in poultry. Animals 2022, 12, 102. [Google Scholar] [CrossRef] [PubMed]
  50. Abdul-Careem, M.F.; Hunter, D.B.; Lambourne, M.D.; Barta, J.; Sharif, S. Ontogeny of cytokine gene expression in the chicken spleen. Poult. Sci. 2007, 86, 1351–1355. [Google Scholar] [CrossRef] [PubMed]
  51. Coffman, R.L.; Lebman, D.A.; Shrader, B. Transforming growth factor beta specifically enhances IgA production by lipopolysaccharide-stimulated murine B lymphocytes. J. Exp. Med. 1989, 170, 1039–1044. [Google Scholar] [CrossRef] [PubMed]
  52. Junttila, I.S. Tuning the cytokine responses: An update on interleukin (IL)-4 and IL-13 receptor complexes. Front. Immunol. 2018, 9, 338745. [Google Scholar] [CrossRef] [PubMed]
  53. Ng, L.G.; Sutherland, A.P.; Newton, R.; Qian, F.; Cachero, T.G.; Scott, M.L.; Thompson, J.S.; Wheway, J.; Chtanova, T.; Groom, J. B cell-activating factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor facilitating BAFF costimulation of circulating T and B cells. J. Immunol. 2004, 173, 807–817. [Google Scholar] [CrossRef] [PubMed]
  54. Yang, W.; Chen, X.; Hu, H. CD4 T-cell differentiation in vitro. In T-Cell Receptor Signaling: Methods and Protocols; Springer: Berlin/Heidelberg, Germany, 2020; pp. 91–99. [Google Scholar]
  55. Beal, R.K.; Powers, C.; Wigley, P.; Barrow, P.A.; Smith, A.L. Temporal dynamics of the cellular, humoral and cytokine responses in chickens during primary and secondary infection with Salmonella enterica serovar Typhimurium. Avian Pathol. 2004, 33, 25–33. [Google Scholar] [CrossRef] [PubMed]
  56. Taha-Abdelaziz, K.; Astill, J.; Shojadoost, B.; Borrelli, S.; Monteiro, M.A.; Sharif, S. Campylobacter-derived ligands induce cytokine and chemokine expression in chicken macrophages and cecal tonsil mononuclear cells. Vet. Microbiol. 2020, 246, 108732. [Google Scholar] [CrossRef] [PubMed]
  57. Taha-Abdelaziz, K.; Yitbarek, A.; Alkie, T.N.; Hodgins, D.C.; Read, L.R.; Weese, J.S.; Sharif, S. PLGA-encapsulated CpG ODN and Campylobacter jejuni lysate modulate cecal microbiota composition in broiler chickens experimentally challenged with C. Jejuni. Sci. Rep. 2018, 8, 12076. [Google Scholar] [CrossRef] [PubMed]
  58. Glünder, G.; Spiering, N.; Hinz, K. Investigations on parenteral immunization of chickens with a Campylobacter mineral oil vaccine. In Proceedings of the International Congress of the World Veterinary Poultry Association, Budapest, Hungary, 20–22 August 1997; Nagy, B., Mulder, R., Eds.; European Commission: Budapest, Hungary, 1997; pp. 247–253. [Google Scholar]
Vaccines 12 00908 g001
Figure 1. Illustration of first experimental design. On embryonic day 18, 136 eggs were randomly divided into four groups (G1–G4), each containing 34 eggs. Embryos of each group were injected intra-amniotic with the assigned immunization: 50 µg CpG ODN or 125 µg C. jejuni OMPs or their combination or PBS (negative control group). On the first day post-hatch, chicks (136) of non-immunized eggs were randomly allocated into four groups (G5–G8) and immunized SC with 50 µg CpG ODN or 125 µg C. jejuni OMPs or their combination or PBS. All chicks received the booster vaccination on day seven, and all groups were challenged with 107 CFUs of C. jejuni on day 14. Bursa of Fabricius and spleens were collected for three successive days (n = 8) post-initial vaccination of either SC or in ovo immunized groups. Blood samples were collected weekly, and the cecal contents were collected on day 35 of age (the end of the experiment).
Figure 1. Illustration of first experimental design. On embryonic day 18, 136 eggs were randomly divided into four groups (G1–G4), each containing 34 eggs. Embryos of each group were injected intra-amniotic with the assigned immunization: 50 µg CpG ODN or 125 µg C. jejuni OMPs or their combination or PBS (negative control group). On the first day post-hatch, chicks (136) of non-immunized eggs were randomly allocated into four groups (G5–G8) and immunized SC with 50 µg CpG ODN or 125 µg C. jejuni OMPs or their combination or PBS. All chicks received the booster vaccination on day seven, and all groups were challenged with 107 CFUs of C. jejuni on day 14. Bursa of Fabricius and spleens were collected for three successive days (n = 8) post-initial vaccination of either SC or in ovo immunized groups. Blood samples were collected weekly, and the cecal contents were collected on day 35 of age (the end of the experiment).
Vaccines 12 00908 g001
Vaccines 12 00908 g002
Figure 2. Illustration of the second experimental design. On the first day post-hatch, chicks were immunized SC with C. jejuni OMPs (50, 125 or 200 μg) or C. jejuni lysate; low (21.5 μg) or high (43 μg) protein, or heat-killed (106 or 107 CFUs of C. jejuni). All chicks received the booster vaccination on day 14 of age. The control group was injected at the same age with PBS only. All groups were challenged with 107 CFUs of C. jejuni on day 15 of age. Blood samples were collected weekly, and the cecal contents were collected at the fifth week at the end of the experiment.
Figure 2. Illustration of the second experimental design. On the first day post-hatch, chicks were immunized SC with C. jejuni OMPs (50, 125 or 200 μg) or C. jejuni lysate; low (21.5 μg) or high (43 μg) protein, or heat-killed (106 or 107 CFUs of C. jejuni). All chicks received the booster vaccination on day 14 of age. The control group was injected at the same age with PBS only. All groups were challenged with 107 CFUs of C. jejuni on day 15 of age. Blood samples were collected weekly, and the cecal contents were collected at the fifth week at the end of the experiment.
Vaccines 12 00908 g002
Vaccines 12 00908 g003
Figure 3. C. jejuni CFUs per gram of the cecal content. After primary immunization in ovo or SC on day one of age and booster immunization on day seven of age, chicks in all groups were orally challenged with 107 CFUs of C. jejuni on day 14 of age. At 35 days of age (21 days post-challenge), cecal contents were collected for Campylobacter enumeration. Bars marked with different letters (a–c) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Figure 3. C. jejuni CFUs per gram of the cecal content. After primary immunization in ovo or SC on day one of age and booster immunization on day seven of age, chicks in all groups were orally challenged with 107 CFUs of C. jejuni on day 14 of age. At 35 days of age (21 days post-challenge), cecal contents were collected for Campylobacter enumeration. Bars marked with different letters (a–c) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Vaccines 12 00908 g003
Vaccines 12 00908 g004
Figure 4. Serum IgY antibody levels. Chicks were immunized in ovo or SC with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. A booster dose was delivered orally (for those primed in ovo) or SC (for those primed SC) on day seven of age. All the chicks were then orally challenged with 107 CFUs of C. jejuni on day 14 of age. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgY antibody (Ab) levels using ELISA. Bars marked with different letters (a–b) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Figure 4. Serum IgY antibody levels. Chicks were immunized in ovo or SC with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. A booster dose was delivered orally (for those primed in ovo) or SC (for those primed SC) on day seven of age. All the chicks were then orally challenged with 107 CFUs of C. jejuni on day 14 of age. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgY antibody (Ab) levels using ELISA. Bars marked with different letters (a–b) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Vaccines 12 00908 g004
Vaccines 12 00908 g005
Figure 5. The correlation between C. jejuni CFUs and serum antibody (Ab) levels using Pearson’s r correlation coefficient. No correlation was observed between the serum IgY Ab levels and cecal counts of C. jejuni in the group immunized SC with the combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age.
Figure 5. The correlation between C. jejuni CFUs and serum antibody (Ab) levels using Pearson’s r correlation coefficient. No correlation was observed between the serum IgY Ab levels and cecal counts of C. jejuni in the group immunized SC with the combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age.
Vaccines 12 00908 g005
Vaccines 12 00908 g006
Figure 6. Serum IgM antibody levels. Chicks were immunized in ovo or SC with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. A booster dose was delivered orally (for those primed in ovo) or SC (for those primed SC) on day seven of age. All the chicks were then orally challenged with 107 CFUs of C. jejuni on day 14 of age. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgM antibody (Ab) levels using ELISA. Bars marked with different letters (a–c) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Figure 6. Serum IgM antibody levels. Chicks were immunized in ovo or SC with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. A booster dose was delivered orally (for those primed in ovo) or SC (for those primed SC) on day seven of age. All the chicks were then orally challenged with 107 CFUs of C. jejuni on day 14 of age. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgM antibody (Ab) levels using ELISA. Bars marked with different letters (a–c) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Vaccines 12 00908 g006
Vaccines 12 00908 g007
Figure 7. The correlation between C. jejuni CFUs and serum antibody (Ab) levels using Pearson’s r correlation coefficient. No correlation was observed between the serum IgM Ab levels and cecal counts of C. jejuni in the group immunized with the combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age.
Figure 7. The correlation between C. jejuni CFUs and serum antibody (Ab) levels using Pearson’s r correlation coefficient. No correlation was observed between the serum IgM Ab levels and cecal counts of C. jejuni in the group immunized with the combination of 50 µg CpG ODN and 125 µg OMPs at the fifth week of age.
Vaccines 12 00908 g007
Vaccines 12 00908 g008
Figure 8. Relative gene expression of interferon (IFN)-γ (a), interleukin (IL)-13 (b), and IL-1β (c) in the spleen at 24, 48, and 72 h following SC immunization with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. Data are presented as mean expression (delta CT values) of cytokine mRNA relative to β-actin (housekeeping gene) ± standard error of the mean (SEM). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey’s comparison test. Bars marked with different letters (a,b) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneously. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Figure 8. Relative gene expression of interferon (IFN)-γ (a), interleukin (IL)-13 (b), and IL-1β (c) in the spleen at 24, 48, and 72 h following SC immunization with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. Data are presented as mean expression (delta CT values) of cytokine mRNA relative to β-actin (housekeeping gene) ± standard error of the mean (SEM). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey’s comparison test. Bars marked with different letters (a,b) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneously. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Vaccines 12 00908 g008
Vaccines 12 00908 g009
Figure 9. Relative gene expression of interferon (IFN)-γ (a), interleukin (IL)-13 (b), and IL-1β (c) in the spleen at 24, 48, and 72 h following in ovo immunization with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. Data are presented as mean expression (delta CT values) of cytokine mRNA relative to β-actin (housekeeping gene) ± standard error of the mean (SEM). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey’s comparison test. Bars marked with different letters (a,b) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneously. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Figure 9. Relative gene expression of interferon (IFN)-γ (a), interleukin (IL)-13 (b), and IL-1β (c) in the spleen at 24, 48, and 72 h following in ovo immunization with 125 µg C. jejuni OMPs or 50 µg CpG ODN or their combination or PBS. Data are presented as mean expression (delta CT values) of cytokine mRNA relative to β-actin (housekeeping gene) ± standard error of the mean (SEM). Statistical significance among treatment groups was calculated using 1-way ANOVA followed by Tukey’s comparison test. Bars marked with different letters (a,b) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneously. ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Vaccines 12 00908 g009
Vaccines 12 00908 g010
Figure 10. C. jejuni CFUs per gram of the cecal content. Day-old chicks were immunized SC with different doses of heat-killed or whole lysate or OMPs of C. jejuni and boosted SC with the corresponding vaccine on day 14 of age. On day 15 of age, chicks in all groups were orally challenged with 107 CFUs of C. jejuni. On day 35 of age (20-day post-challenge), cecal contents were collected for Campylobacter enumeration. Bars marked with different letters (a–c) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous.
Figure 10. C. jejuni CFUs per gram of the cecal content. Day-old chicks were immunized SC with different doses of heat-killed or whole lysate or OMPs of C. jejuni and boosted SC with the corresponding vaccine on day 14 of age. On day 15 of age, chicks in all groups were orally challenged with 107 CFUs of C. jejuni. On day 35 of age (20-day post-challenge), cecal contents were collected for Campylobacter enumeration. Bars marked with different letters (a–c) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous.
Vaccines 12 00908 g010
Vaccines 12 00908 g011
Figure 11. Serum IgY antibody levels. On days one and fourteen of age, chicks were immunized SC with different doses of C. jejuni OMPs (50, 125 or 200 μg) or C. jejuni lysate (21.5 μg or 43 μg) or heat-killed C. jejuni (106 or 107 CFUs). The control group was injected at the same age with PBS only. On day 15 of age, chickens were challenged orally with 107 CFUs of C. jejuni. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgY antibody (Ab) levels using ELISA. Bars that are marked with different letters (a–c) indicate significant differences (p < 0.05). OMPs = outer membrane proteins. SC = subcutaneous.
Figure 11. Serum IgY antibody levels. On days one and fourteen of age, chicks were immunized SC with different doses of C. jejuni OMPs (50, 125 or 200 μg) or C. jejuni lysate (21.5 μg or 43 μg) or heat-killed C. jejuni (106 or 107 CFUs). The control group was injected at the same age with PBS only. On day 15 of age, chickens were challenged orally with 107 CFUs of C. jejuni. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgY antibody (Ab) levels using ELISA. Bars that are marked with different letters (a–c) indicate significant differences (p < 0.05). OMPs = outer membrane proteins. SC = subcutaneous.
Vaccines 12 00908 g011
Vaccines 12 00908 g012
Figure 12. Serum IgM antibody levels. On days one and fourteen of age, chicks were immunized SC with different doses of C. jejuni OMPs (50, 125 or 200 μg), C. jejuni lysate (21.5 μg or 43 μg) and heat-killed C. jejuni (106 or 107 CFUs). The control group was injected at the same age with PBS only. On day 15 of age, chickens were challenged orally with 107 CFUs of C. jejuni. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgM antibody (Ab) levels using ELISA. Bars marked with different letters (a–b) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous.
Figure 12. Serum IgM antibody levels. On days one and fourteen of age, chicks were immunized SC with different doses of C. jejuni OMPs (50, 125 or 200 μg), C. jejuni lysate (21.5 μg or 43 μg) and heat-killed C. jejuni (106 or 107 CFUs). The control group was injected at the same age with PBS only. On day 15 of age, chickens were challenged orally with 107 CFUs of C. jejuni. Blood samples were collected weekly from all groups, starting from the first week of age through the fifth week of age, with the sera subsequently separated for measuring the IgM antibody (Ab) levels using ELISA. Bars marked with different letters (a–b) indicate significant differences (p < 0.05) between the groups, while bars marked with the same letter denote no significant differences between the groups. OMPs = outer membrane proteins. SC = subcutaneous.
Vaccines 12 00908 g012
Table 1. Experimental design for the first trial.
Table 1. Experimental design for the first trial.
TreatmentBirds (n)/
Group		Primary ImmunizationBooster ImmunizationChallenge Age (d)
DayRouteVolume (mL)Route/Volume (mL)/Age (d)
1C. jejuni OMPs (125 µg) 3418th EDAmniotic0.1Oral/1/714
2CpG ODN (50 µg) 3418th EDAmniotic0.1Oral/1/714
3C. jejuni OMPs (125 µg) + CpG ODN (50 µg)3418th EDAmniotic0.1Oral/1/714
4PBS3418th EDAmniotic0.1Oral/1/714
5C. jejuni OMPs (125 µg) 341-day oldSC0.2SC/0.2/714
6CpG ODN (50 µg)341-day oldSC0.2SC/0.2/714
7C. jejuni OMPs (125 µg) + CpG ODN (50 µg)341-day oldSC0.2SC/0.2/714
8PBS341-day oldSC0.2SC/0.2/714
ED = embryonic day, OMPs = outer membrane proteins of C. jejuni, SC = subcutaneous, n = sample size, CpG ODN = synthetic single-stranded oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs.
Table 2. Experimental design of the second trial.
Table 2. Experimental design of the second trial.
GroupTreatmentBirds (n)/
Group		Primary ImmunizationBooster ImmunizationChallenge Age (d)
DayRouteVolume (mL)Route/Volume (mL)/Age (d)
1C. jejuni OMPs (50 µg)101-day oldSC0.2SC/0.2/1415
2C. jejuni OMPs (125 µg)101-day oldSC0.2SC/0.2/1415
3C. jejuni OMPs (200 µg) 101-day oldSC0.2SC/0.2/1415
4C. jejuni heat-killed (106 CFUs/bird)101-day oldSC0.2SC/0.2/1415
5C. jejuni heat-killed (107 CFUs/bird)101-day oldSC0.2SC/0.2/1415
6C. jejuni lysate (21.5 µg)101-day oldSC0.2SC/0.2/1415
7C. jejuni lysate (43 µg)101-day oldSC0.2SC/0.2/1415
8PBS101-day oldSC0.2SC/0.2/1415
OMPs = outer membrane proteins of C. jejuni, n = sample size, SC = subcutaneous.
Table 3. Sequences of primers used for RT-qPCR.
Table 3. Sequences of primers used for RT-qPCR.
GenePrimer Sequence (5′-3″)Annealing Temp. (°C)Reference
IFN-γF: ACACTGACAAGTCAAAGCCGC
R: AGTCGTTCATCGGGAGCTTG		60[28]
IL-10F: TTTGGCTGCCAGTCTGTGTC
R: CTCATCCATCTTCTCGAACGTC		64[29]
IL-1βF: GTGAGGCTCAACATTGCGCTGTA
R: TGTCCAGGCGGTAGAAGATGAAG		64[30]
IL-13F: ACTTGTCCAAGCTGAAGCTGTC
R: TCTTGCAGTCGGTCATGTTGTC		60[31]
IL-4F: GCTCTCAGTGCCGCTGATG
R: GGAAACCTCTCCCTGGATGTC		58[32]
BAFFF: CACGTCATCCAGCAGAAGGAT
R: ACAAGAGGACAGGAGCATTGC		55[33]
TGF-βF: CGGCCGACGATGAGTGGCTC
R: CGGGGCCCATCTCACAGGGA		60[34]
β-actinF: CAACACAGTGCTGTCTGGTGGTA
R: ATCGTACTCCTGCTTGCTGATCC		60[28]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Naguib, M.; Sharma, S.; Schneider, A.; Wehmueller, S.; Abdelaziz, K. Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens. Vaccines 2024, 12, 908. https://doi.org/10.3390/vaccines12080908

AMA Style

Naguib M, Sharma S, Schneider A, Wehmueller S, Abdelaziz K. Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens. Vaccines. 2024; 12(8):908. https://doi.org/10.3390/vaccines12080908

Chicago/Turabian Style

Naguib, Mostafa, Shreeya Sharma, Abigail Schneider, Sarah Wehmueller, and Khaled Abdelaziz. 2024. "Comparative Effectiveness of Various Multi-Antigen Vaccines in Controlling Campylobacter jejuni in Broiler Chickens" Vaccines 12, no. 8: 908. https://doi.org/10.3390/vaccines12080908

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop