Gut Microbiota Abrogates Anti-α-Gal IgA Response in Lungs and Protects against Experimental Aspergillus Infection in Poultry
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Environmental Contamination Assessment
2.3. Animals and Housing Conditions
2.4. Aspergillus fumigatus Strain and Inoculum Preparation
2.5. Detection of α-Gal Glycan in Fungi
2.6. Bacteria Culture and Oral Administration of Bacteria
2.7. Immunization
2.8. Intratracheal Challenge with A. fumigatus
2.9. Euthanasia, Lung Lesions Score and Sample Collection
2.10. Indirect ELISA for Anti-α-Gal IgY and IgA Levels Determination
2.11. Enzymatic Removal of α-Gal to Test the Specificity of Turkey Anti-α-Gal Abs
2.12. Histopathology and Histopathological Scores
2.13. Quantification of A. fumigatus by CFU and qPCR Assays
2.14. RNA Extraction and Quantification of Cytokines mRNA Levels by qPCR
3. Results
3.1. A. fumigatus Contains the Carbohydrate α-Gal
3.2. Oral Administration of E. coli O86:B7 Reduces Clinical Signs of Aspergillosis and Development of Lung Granulomas in A. fumigatus-Infected Turkeys
3.3. Oral Administration of E. coli O86:B7 Decreases Anti-α-Gal IgA Production in the Lungs of A. fumigatus-Infected Turkeys
3.4. Immunization against Galα1-3Gal Increases Fungal Development in the Lungs
3.5. Immunization against Galα1-3Gal Is Associated with Upregulation of Pro-Inflammatory Cytokine Genes in A. fumigatus-Infected Turkeys and Chickens
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Galili, U.; Shohet, S.B.; Kobrin, E.; Stults, C.L.; Macher, B.A. Man, apes, and Old World monkeys differ from other mammals in the expression of α-galactosyl epitopes on nucleated cells. J. Biol. Chem. 1988, 263, 17755–17762. [Google Scholar] [PubMed]
- Galili, U.; Clark, M.R.; Shohet, S.B.; Buehler, J.; Macher, B.A. Evolutionary relationship between the natural anti-Gal antibody and the Gal α 1–3Gal epitope in primates. Proc. Natl. Acad. Sci. USA 1987, 84, 1369–1373. [Google Scholar] [CrossRef] [Green Version]
- Macher, B.A.; Galili, U. The Galα1, 3Galβ1, 4GlcNAc-R (α-Gal) epitope: A carbohydrate of unique evolution and clinical relevance. Biochim. Biophys. Acta 2008, 1780, 75–88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Galili, U.; Rachmilewitz, E.A.; Peleg, A.; Flechner, I. A unique natural human IgG antibody with anti-α-galactosyl specificity. J. Exp. Med. 1984, 160, 1519–1531. [Google Scholar] [CrossRef] [PubMed]
- Galili, U.; Mandrell, R.E.; Hamadeh, R.M.; Shohet, S.B.; Griffiss, J.M. Interaction between human natural anti-α-galactosyl immunoglobulin G and bacteria of the human flora. Infect. Immun. 1988, 56, 1730–1737. [Google Scholar] [CrossRef] [Green Version]
- Pal, S.C.; Rao, C.K.; Kereselidze, T.; Krishnaswami, A.K.; Murty, D.K.; Pandit, C.G.; Shrivastav, J.B. An extensive community outbreak of enteropathogenic Escherichia coli O86: B7 gastroenteritis. Bull. World Health Organ. 1969, 41, 851–858. [Google Scholar] [PubMed]
- Cabezas-Cruz, A.; Mateos-Hernández, L.; Alberdi, P.; Villar, M.; Riveau, G.; Hermann, E.; Schacht, A.M.; Khalife, J.; Correia-Neves, M.; Gortazar, C.; et al. Effect of blood type on anti-α-Gal immunity and the incidence of infectious diseases. Exp. Mol. Med. 2017, 49, e301. [Google Scholar] [CrossRef]
- Yilmaz, B.; Portugal, S.; Tran, T.M.; Gozzelino, R.; Ramos, S.; Gomes, J.; Regalado, A.; Cowan, P.J.; d’Apice, A.J.; Chong, A.S.; et al. Gut microbiota elicits a protective immune response against malaria transmission. Cell 2014, 159, 1277–1289. [Google Scholar] [CrossRef] [Green Version]
- Posekany, K.J.; Pittman, H.K.; Bradfield, J.F.; Haisch, C.E.; Verbanac, K.M. Induction of cytolytic anti-Gal antibodies in α-1,3-galactosyltransferase gene knockout mice by oral inoculation with Escherichia coli O86:B7 bacteria. Infect. Immun. 2002, 70, 6215–6222. [Google Scholar] [CrossRef] [Green Version]
- Mañez, R.; Blanco, F.J.; Díaz, I.; Centeno, A.; Lopez-Pelaez, E.; Hermida, M.; Davies, H.F.; Katopodis, A. Removal of bowel aerobic gram-negative bacteria is more effective than immunosuppression with cyclophosphamide and steroids to decrease natural α-galactosyl IgG antibodie. Xenotransplantation 2001, 8, 15–23. [Google Scholar] [CrossRef]
- Springer, G.F.; Horton, R.E.; Forbes, M. Origin of anti-human blood group B agglutinins in white Leghorn chicken. J. Exp. Med. 1959, 110, 221–244. [Google Scholar] [CrossRef] [PubMed]
- Springer, G.F.; Horton, R.E. Blood group isoantibody stimulation in man by feeding blood group-active bacteria. J. Clin. Investig. 1969, 48, 1280–1291. [Google Scholar] [CrossRef] [PubMed]
- Cabezas-Cruz, A.; Hodžić, A.; Román-Carrasco, P.; Mateos-Hernández, L.; Duscher, G.G.; Sinha, D.K.; Hemmer, W.; Swoboda, I.; Estrada-Peña, A.; de la Fuente, J. Environmental and Molecular Drivers of the α-Gal Syndrome. Front. Immunol. 2019, 10, 1210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Commins, S.P.; James, H.R.; Kelly, L.A.; Pochan, S.L.; Workman, L.J.; Perzanowski, M.S.; Kocan, K.M.; Fahy, J.V.; Nganga, L.W.; Ronmark, E.; et al. The relevance of tick bites to the production of IgE antibodies to the mammalian oligosaccharide galactose-α-1,3-galactose. J. Allergy Clin. Immunol. 2011, 127, 1286–1293. [Google Scholar] [CrossRef] [Green Version]
- Cabezas-Cruz, A.; Valdés, J.; de la Fuente, J. Cancer research meets tick vectors for infectious diseases. Lancet Infect. Dis. 2014, 14, 916–917. [Google Scholar] [CrossRef] [Green Version]
- Steinke, J.W.; Platts-Mills, T.A.; Commins, S.P. The α-gal story: Lessons learned from connecting the dots. J. Allergy Clin. Immunol. 2015, 135, 589–596. [Google Scholar] [CrossRef] [Green Version]
- Mateos-Hernández, L.; Villar, M.; Moral, A.; Rodríguez, C.G.; Arias, T.A.; de la Osa, V.; Brito, F.F.; Fernández de Mera, I.G.; Alberdi, P.; Ruiz-Fons, F.; et al. Tick-host conflict: Immunoglobulin E antibodies to tick proteins in patients with anaphylaxis to tick bite. Oncotarget 2017, 8, 20630–20644. [Google Scholar] [CrossRef]
- Hodžić, A.; Mateos-Hernández, L.; de la Fuente, J.; Cabezas-Cruz, A. Delayed hypersensitivity reaction to mammalian galactose-α-1,3-galactose (α-Gal) after repeated tick bites in a patient from France. Ticks Tick Borne Dis. 2019, 10, 1057–1059. [Google Scholar] [CrossRef]
- Kiewiet, M.B.G.; Apostolovic, D.; Starkhammar, M.; Grundström, J.; Hamsten, C.; van Hage, M. Clinical and Serological Characterization of the α-Gal Syndrome-Importance of Atopy for Symptom Severity in a European Cohort. J. Allergy Clin. Immunol. Pract. 2020, 10, 2027–2034.e2. [Google Scholar] [CrossRef]
- Cabezas-Cruz, A.; Espinosa, P.J.; Alberdi, P.; Šimo, L.; Valdés, J.J.; Mateos-Hernández, L.; Contreras, M.; Rayo, M.V.; de la Fuente, J. Tick galactosyltransferases are involved in α-Gal synthesis and play a role during Anaplasma phagocytophilum infection and Ixodes scapularis tick vector development. Sci. Rep. 2018, 8, 14224. [Google Scholar] [CrossRef]
- Crispell, G.; Commins, S.P.; Archer-Hartman, S.A.; Choudhary, S.; Dharmarajan, G.; Azadi, P.; Karim, S. Discovery of α -Gal-Containing Antigens in North American Tick Species Believed to Induce Red Meat Allergy. Front. Immunol. 2019, 10, 1056. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Villar, M.; Pacheco, I.; Merino, O.; Contreras, M.; Mateos-Hernández, L.; Prado, E.; Barros-Picanço, D.K.; Lima-Barbero, J.F.; Artigas-Jerónimo, S.; Alberdi, P.; et al. Tick and Host Derived Compounds Detected in the Cement Complex Substance. Biomolecules 2020, 10, 555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, Y.; Kim, D.; Boorgula, G.D.; De Schutter, K.; Smagghe, G.; Šimo, L.; Archer-Hartmann, S.A.; Azadi, P. α -Gal and Cross-Reactive Carbohydrate Determinants in the N-Glycans of Salivary Glands in the Lone Star Tick, Amblyomma americanum. Vaccines 2020, 8, 18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hodžić, A.; Mateos-Hernández, L.; Fréalle, E.; Román-Carrasco, P.; Alberdi, P.; Pichavant, M.; Risco-Castillo, V.; Le Roux, D.; Vicogne, J.; Hemmer, W.; et al. Infection with Toxocara canis Inhibits the Production of IgE Antibodies to α-Gal in Humans: Towards a Conceptual Framework of the Hygiene Hypothesis? Vaccines 2020, 8, 167. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Latgé, J.P. Aspergillus fumigatus and aspergillosis. Clin. Microbiol. Rev. 1999, 12, 310–350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arné, P.; Thierry, S.; Wang, D.; Deville, M.; Le Loc’h, G.; Desoutter, A.; Féménia, F.; Nieguitsila, A.; Huang, W.; Chermette, R.; et al. Aspergillus fumigatus in Poultry. Int. J. Microbiol. 2011, 746356. [Google Scholar]
- Latgé, J.P.; Chamilos, G. Aspergillus fumigatus and Aspergillosis in 2019. Clin. Microbiol. Rev. 2019, 33, e00140-18. [Google Scholar] [CrossRef]
- Beernaert, L.A.; Pasmans, F.; Van Waeyenberghe, L.; Haesebrouck, F.; Martel, A. Aspergillus infections in birds: A review. Avian Pathol. 2010, 39, 325–331. [Google Scholar] [CrossRef] [Green Version]
- Discher, D.; Van Waeyenberghe, L.; Failing, K.; Martel, A.; Lierz, M. Single tracheal inoculation of Aspergillus fumigatus conidia induced aspergillosis in juvenile falcons (Falco spp.). Avian Pathol. 2018, 47, 33–46. [Google Scholar]
- Melloul, E.; Thierry, S.; Durand, B.; Cordonnier, N.; Desoubeaux, G.; Chandenier, J.; Bostvironnois, C.; Botterel, F.; Chermette, R.; Guillot, J.; et al. Assessment of Aspergillus fumigatus burden in lungs of intratracheally-challenged turkeys (Meleagris gallopavo) by quantitative PCR, galactomannan enzyme immunoassay, and quantitative culture. Comp. Immunol. Microbiol. Infect. Dis. 2014, 37, 271–279. [Google Scholar] [CrossRef]
- Zhang, R.R.; Wang, S.F.; Lu, H.W.; Wang, Z.H.; Xu, X.L. Clinical in vestigation of misdiagnosis of invasive pulmonary aspergillosis in 26 immunocompetent patients. Int. J. Clin. Exp. Med. 2014, 7, 4139–4146. [Google Scholar] [PubMed]
- Gonçalves, S.M.; Lagrou, K.; Duarte-Oliveira, C.; Maertens, J.A.; Cunha, C.; Carvalho, A. The microbiome-metabolome crosstalk in the pathogenesis of respiratory fungal diseases. Virulence 2017, 8, 673–684. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghori, H.M.; Edgar, S.A. Comparative susceptibility of chickens, turkeys and Coturnix quail to aspergillosis. Poult Sci. 1973, 52, 2311–2315. [Google Scholar] [CrossRef] [PubMed]
- Kunkle, R.A. Aspergillosis. In Diseases of Poultry, 11th ed.; Saif, Y.M., Barnes, H.J., Glisson, J.R., Eds.; Iowa State University Press: Ames, IA, USA, 2003; pp. 883–895. [Google Scholar]
- Kowalski, C.H.; Beattie, S.R.; Fuller, K.K.; McGurk, E.A.; Tang, Y.W.; Hohl, T.M.; Obar, J.J.; Cramer, R.A. Heterogeneity Among Isolates Reveals That Fitness in Low Oxygen Correlates with Aspergillus fumigatus virulence. mBio 2016, 7, e01515–e01516. [Google Scholar] [CrossRef] [Green Version]
- Iniguez, E.; Schocker, N.S.; Subramaniam, K.; Portillo, S.; Montoya, A.L.; Al-Salem, W.S.; Torres, C.L.; Rodriguez, F.; Moreira, O.C.; Acosta-Serrano, A.; et al. An α-Gal-containing neoglycoprotein-based vaccine partially protects against murine cutaneous leishmaniasis caused by Leishmania major. PLoS Negl. Trop. Dis. 2017, 11, e0006039. [Google Scholar] [CrossRef]
- Pfaffl, M. A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Green Version]
- Galili, U.; LaTemple, D.C.; Radic, M.Z. A sensitive assay for measuring α-Gal epitope expression on cells by a monoclonal anti-Gal antibody. Transplantation 1998, 65, 1129–1132. [Google Scholar] [CrossRef]
- Pabst, O.; Mowat, A.M. Oral Tolerance to Food Protein. Mucosal Immunol. 2012, 5, 232–239. [Google Scholar] [CrossRef]
- Commins, S.P. Mechanisms of Oral Tolerance. Pediatr. Clin. N. Am. 2015, 62, 1523–1529. [Google Scholar] [CrossRef] [Green Version]
- Wambre, E.; Jeong, D. Oral Tolerance Development and Maintenance. Immunol. Allergy Clin. N. Am. 2018, 38, 27–37. [Google Scholar] [CrossRef] [PubMed]
- Huibregtse, I.L.; Snoeck, V.; de Creus, A.; Braat, H.; De Jong, E.C.; Van Deventer, S.J.; Rottiers, P. Induction of Ovalbumin-Specific Tolerance by Oral Administration of Lactococcus Lactis Secreting Ovalbumin. Gastroenterology 2007, 133, 517–528. [Google Scholar] [CrossRef] [PubMed]
- Huibregtse, I.L.; Marietta, E.V.; Rashtak, S.; Koning, F.; Rottiers, P.; David, C.S.; van Deventer, S.J.; Murray, J.A. Induction of Antigen-Specific Tolerance by Oral Administration of Lactococcus Lactis Delivered Immunodominant DQ8-restricted Gliadin Peptide in Sensitized Nonobese Diabetic Abo Dq8 Transgenic Mice. J. Immunol. 2009, 183, 2390–2396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bennek, E.; Mandić, A.D.; Verdier, J.; Roubrocks, S.; Pabst, O.; Van Best, N.; Benz, I.; Kufer, T.; Trautwein, C.; Sellge, G. Subcellular Antigen Localization in Commensal E. Coli Is Critical for T Cell Activation and Induction of Specific Tolerance. Mucosal Immunol. 2019, 12, 97–107. [Google Scholar] [CrossRef] [PubMed]
- Shanmugasundaram, R.; Selvaraj, R.K. Regulatory T Cell Properties of Chicken CD4+ CD25+ Cells. J. Immunol. 2011, 186, 1997–2002. [Google Scholar] [CrossRef] [Green Version]
- Shanmugasundaram, R.; Selvaraj, R.K. Regulatory T Cell Properties of Thymic CD4+ CD25+ Cells in Ducks. Vet. Immunol. Immunopathol. 2012, 149, 20–27. [Google Scholar] [CrossRef]
- Shanmugasundaram, R.; Selvaraj, R.K. Regulatory T Cell Properties of Thymic CD4+CD25 + Cells in Turkeys. Poult Sci. 2012, 91, 1833–1837. [Google Scholar] [CrossRef]
- Zhang, A.H.; Yoon, J.; Kim, Y.C.; Scott, D.W. Targeting Antigen-Specific B Cells Using Antigen-Expressing Transduced Regulatory T Cells. J. Immunol. 2018, 201, 1434–1441. [Google Scholar] [CrossRef] [Green Version]
- Hamadeh, R.M.; Jarvis, G.A.; Galili, U.; Mandrell, R.E.; Zhou, P.; Griffiss, J.M. Human natural anti-Gal IgG regulates alternative complement pathway activation on bacterial surfaces. J Clin Investig. 1992, 89, 1223–1235. [Google Scholar] [CrossRef]
- Katopodis, A.G.; Warner, R.G.; Duthaler, R.O.; Streiff, M.B.; Bruelisauer, A.; Kretz, O.; Dorobek, B.; Persohn, E.; Andres, H.; Schweitzer, A.; et al. Removal of anti-Galα1,3Gal xenoantibodies with an injectable polymer. J. Clin. Investig. 2002, 110, 1869–1877. [Google Scholar] [CrossRef]
- Pérez-Cruz, M.; Bello-Gil, D.; Costa, C.; Mañez, R. Cytokine profile associated with selective removal of natural anti-α-Gal antibodies in a sepsis model in Gal-KO mice. Biochemistry 2017, 82, 205–212. [Google Scholar]
- Parente, R.; Doni, A.; Bottazzi, B.; Garlanda, C.; Inforzato, A. The complement system in Aspergillus fumigatus infections and its crosstalk with pentraxins. FEBS Lett. 2020, 28, 1873–3468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, F.; Liu, Z.; Cao, J.; Li, N.; Liu, Z.; Zuo, J.; Chen, Y.; Wang, X.; Sun, J. B cell response is required for granuloma formation in the early infection of Schistosoma japonicum. PLoS ONE 2008, 3, e1724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Phuah, J.Y.; Mattila, J.T.; Lin, P.L.; Flynn, J.L. Activated B Cells in the Granulomas of Nonhuman Primates Infected with Mycobacterium tuberculosis. Am. J. Pathol. 2012, 181, 508–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Phuah, J.; Wong, E.A.; Gideon, H.P.; Maiello, P.; Coleman, M.T.; Hendricks, M.R.; Ruden, R.; Cirrincione, L.R.; Chan, J.; Lin, P.L.; et al. Effects of B Cell Depletion on Early Mycobacterium tuberculosis Infection in Cynomolgus Macaques. Infect. Immun. 2016, 84, 1301–1311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Loxton, A.G. B cells and their regulatory functions during Tuberculosis: Latency and active disease. Mol. Immunol. 2019, 111, 145–151. [Google Scholar] [CrossRef] [PubMed]
- Silva Miranda, M.; Breiman, A.; Allain, S.; Deknuydt, F.; Altare, F. The tuberculous granuloma: An unsuccessful host defence mechanism providing a safety shelter for the bacteria? Clin. Dev. Immunol. 2012, 2012, 139127. [Google Scholar] [CrossRef] [Green Version]
- Bold, T.D.; Ernst, J.D. Who Benefits from Granulomas, Mycobacteria or Host? Cell 2009, 136, 17–19. [Google Scholar] [CrossRef] [Green Version]
- Medzhitov, R.; Schneider, D.S.; Soares, M.P. Disease Tolerance as a Defense Strategy. Science 2012, 335, 936–941. [Google Scholar] [CrossRef] [Green Version]
- Ayres, J.S.; Schneider, D.S. Tolerance of Infections. Annu. Rev. Immunol. 2012, 30, 271–294. [Google Scholar] [CrossRef]
- Cooper, D.K.; Koren, E.; Oriol, R. Oligosaccharides and Discordant Xenotransplantation. Immunol. Rev. 1994, 141, 31–58. [Google Scholar] [CrossRef] [PubMed]
- Palmetshofer, A.; Galili, U.; Dalmasso, A.P.; Robson, S.C.; Bach, F.H. α-galactosyl Epitope-Mediated Activation of Porcine Aortic Endothelial Cells: Type II Activation. Transplantation 1998, 65, 971–978. [Google Scholar] [CrossRef] [PubMed]
- Almeida, I.C.; Milani, S.R.; Gorin, P.A.; Travassos, L.R. Complement-mediated lysis of Trypanosoma cruzi trypomastigotes by human anti-α-galactosyl antibodies. J. Immunol. 1991, 146, 2394–2400. [Google Scholar] [PubMed]
- Portillo, S.; Zepeda, B.G.; Iniguez, E.; Olivas, J.J.; Karimi, N.H.; Moreira, O.C.; Marques, A.F.; Michael, K.; Maldonado, R.A.; Almeida, I.C. A Prophylactic α-Gal-based Glycovaccine Effectively Protects against Murine Acute Chagas Disease. NPJ Vaccines 2019, 4, 13. [Google Scholar] [CrossRef]
- Moura, A.P.V.; Santos, L.C.; Brito, C.R.N.; Valencia, E.; Junqueira, C.; Filho, A.A.; Sant’Anna, M.R.; Gontijo, N.F.; Bartholomeu, D.C.; Fujiwara, R.T.; et al. Virus-like particle display of the α-Gal carbohydrate for vaccination against Leishmania Infection. ACS Cent. Sci. 2017, 3, 1026–1031. [Google Scholar] [CrossRef] [Green Version]
- Pacheco, I.; Contreras, M.; Villar, M.; Risalde, M.A.; Alberdi, P.; Cabezas-Cruz, A.; Gortázar, C.; de la Fuente, J. Vaccination with α-Gal protects against mycobacterial infection in the zebrafish model of tuberculosis. Vaccines 2020, 8, 195. [Google Scholar] [CrossRef]
- Cabezas-Cruz, A.; de la Fuente, J. Immunity to α-Gal: Toward a Single-Antigen Pan-Vaccine to Control Major Infectious Diseases. ACS Cent. Sci. 2017, 3, 1140–1142. [Google Scholar] [CrossRef]
- Cabezas-Cruz, A.; de la Fuente, J. Immunity to α-Gal: The Opportunity for Malaria and Tuberculosis Control. Front. Immunol. 2017, 8, 1733. [Google Scholar] [CrossRef] [Green Version]
- Cabezas-Cruz, A.; Valdés, J.J.; de la Fuente, J. Control of vector-borne infectious diseases by human immunity against α-Gal. Expert Rev. Vaccines 2016, 15, 953–955. [Google Scholar] [CrossRef] [Green Version]
Gene | Target Species | NCBI Target Gene(s) | Forward Primer | Reverse Primer | Target Length |
---|---|---|---|---|---|
gapdh | Chicken Turkey | NM_204305 NM_001303179 | CCACATGGCATCCAAGGAGT | CTCCAACAAAGGGTCCTGCT | 74 bp |
β-actin | Chicken Turkey | L08165.1 AY942620.1 | GAGAAATTGTGCGTGACATCA | CCTGAACCTCTCATTGCCA | 114 bp |
IL2 | Chicken | AF017645 | TTGGCTGTATTTCGGTAGCA | TCCTGGGTCTCAGTTGGTGT | 160 bp |
Turkey | AJ007463 | GAGCATCGCTATCACCAGAA | GCAGAGTTTGCTGACTGCAC | 141 bp | |
IL6 | Chicken Turkey | AJ309540 XM_003207130 | AGGGCCGTTCGCTATTTGAA | ACGGAACAACACTGCCATCT | 112 bp |
IL10 | Turkey | NM_001303189 | GCTGCGCTTCTACACAGATG | TCCCGTTCTCATCCATCTTC | 203 bp |
IL4 | Turkey | NM_001303181.1 | AGAGCTCATTGCCTCCACAC | ATTGCAAGGGACCTGCTCTC | 72 bp |
MyD88 | Turkey | XM_019616228.1 | TTACGAAGGAAGCAGCAGGAG | TGGCAAGACATCCCGATCAA | 208 bp |
IFN-γ | Turkey | XM_003202048 | CTGAAGAACTGGACAGAGAG | CACCAGCTTCTGTAAGATGC | 264 bp |
28S | A. fumigatus | NG_055745.1 | CTCGGAATGTATCACCTCTCGG | TCCTCGGTCCAGGCAGG | 29 bp |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mateos-Hernández, L.; Risco-Castillo, V.; Torres-Maravilla, E.; Bermúdez-Humarán, L.G.; Alberdi, P.; Hodžić, A.; Hernández-Jarguin, A.; Rakotobe, S.; Galon, C.; Devillers, E.; et al. Gut Microbiota Abrogates Anti-α-Gal IgA Response in Lungs and Protects against Experimental Aspergillus Infection in Poultry. Vaccines 2020, 8, 285. https://doi.org/10.3390/vaccines8020285
Mateos-Hernández L, Risco-Castillo V, Torres-Maravilla E, Bermúdez-Humarán LG, Alberdi P, Hodžić A, Hernández-Jarguin A, Rakotobe S, Galon C, Devillers E, et al. Gut Microbiota Abrogates Anti-α-Gal IgA Response in Lungs and Protects against Experimental Aspergillus Infection in Poultry. Vaccines. 2020; 8(2):285. https://doi.org/10.3390/vaccines8020285
Chicago/Turabian StyleMateos-Hernández, Lourdes, Veronica Risco-Castillo, Edgar Torres-Maravilla, Luis G. Bermúdez-Humarán, Pilar Alberdi, Adnan Hodžić, Angelica Hernández-Jarguin, Sabine Rakotobe, Clemence Galon, Elodie Devillers, and et al. 2020. "Gut Microbiota Abrogates Anti-α-Gal IgA Response in Lungs and Protects against Experimental Aspergillus Infection in Poultry" Vaccines 8, no. 2: 285. https://doi.org/10.3390/vaccines8020285