High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients and H. pylori Isolates
2.2. Antibiotic Susceptibility Testing
2.3. Genomic DNA Extraction
2.4. Mutation Analysis of the Resistance Genes
2.5. Detection of Virulence Markers
2.6. Nucleotide Sequence Accession Numbers
2.7. Statistical Analysis
3. Results
3.1. Characteristics of Patients
3.2. Prevalence of Antibiotic Resistance
3.3. Rate of MDR Phenotype
3.4. Genetic Variations of frxA and rdxA Genes
3.5. Amino Acid Variations at the QRDR Region of gyrA and gyrB Genes
3.6. Genetic Variations of the 23S rRNA Gene
3.7. Association between Virulence Genotypes and Resistance Patterns
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Backert, S.; Neddermann, M.; Maubach, G.; Naumann, M. Pathogenesis of Helicobacter pylori infection. Helicobacter 2016, 21 (Suppl. 1), 19–25. [Google Scholar] [CrossRef] [PubMed]
- Rowland, M.; Daly, L.; Vaughan, M.; Higgins, A.; Bourke, B.; Drumm, B. Age-specific incidence of helicobacter pylori. Gastroenterology 2006, 130, 65–72. [Google Scholar] [CrossRef] [PubMed]
- Malfertheiner, P.; Megraud, F.; O’Morain, C.A.; Gisbert, J.P.; Kuipers, E.J.; Axon, A.T.; Bazzoli, F.; Gasbarrini, A.; Atherton, J.; Graham, D.Y.; et al. Management of Helicobacter pylori infection-the Maastricht V/Florence Consensus Report. Gut 2017, 66, 6–30. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.Y.; Kuo, K.N.; Wu, M.S.; Chen, Y.J.; Wang, C.B.; Lin, J.T. Early Helicobacter pylori eradication decreases risk of gastric cancer in patients with peptic ulcer disease. Gastroenterology 2009, 137, 1641–1648 e1–2. [Google Scholar] [CrossRef]
- Miftahussurur, M.; Syam, A.F.; Nusi, I.A.; Makmun, D.; Waskito, L.A.; Zein, L.H.; Akil, F.; Uwan, W.B.; Simanjuntak, D.; Wibawa, I.D.N. Surveillance of Helicobacter pylori Antibiotic Susceptibility in Indonesia: Different Resistance Types among Regions and with Novel Genetic Mutations. PLoS ONE 2016, 11, e0166199. [Google Scholar] [CrossRef]
- Ngoyi, O.; Nina, E.; Atipo Ibara, B.I.; Moyen, R.; Apendi, A.; Clausina, P.; Ibara, J.R.; Obengui, O.; Ibara, O.; Bienvenu, R. Molecular detection of Helicobacter pylori and its antimicrobial resistance in Brazzaville, Congo. Helicobacter 2015, 20, 316–320. [Google Scholar] [CrossRef]
- Lee, J.W.; Kim, N.; Kim, J.M.; Nam, R.H.; Chang, H.; Kim, J.Y.; Shin, C.M.; Park, Y.S.; Lee, D.H.; Jung, H.C. Prevalence of primary and secondary antimicrobial resistance of Helicobacter pylori in Korea from 2003 through 2012. Helicobacter 2013, 18, 206–214. [Google Scholar] [CrossRef]
- Zerbetto De Palma, G.; Mendiondo, N.; Wonaga, A.; Viola, L.; Ibarra, D.; Campitelli, E.; Salim, N.; Corti, R.; Goldman, C.; Catalano, M. Occurrence of Mutations in the Antimicrobial Target Genes Related to Levofloxacin, Clarithromycin, and Amoxicillin Resistance in Helicobacter pylori Isolates from Buenos Aires City. Microb. Drug Resist. 2017, 23, 351–358. [Google Scholar] [CrossRef]
- Mahachai, V.; Vilaichone, R.K.; Pittayanon, R.; Rojborwonwitaya, J.; Leelakusolvong, S.; Maneerattanaporn, M.; Chotivitayatarakorn, P.; Treeprasertsuk, S.; Kositchaiwat, C.; Pisespongsa, P.; et al. Helicobacter pylori management in ASEAN: The Bangkok consensus report. J. Gastroenterol. Hepatol. 2018, 33, 37–56. [Google Scholar] [CrossRef]
- Mégraud, F. The challenge of Helicobacter pylori resistance to antibiotics: The comeback of bismuth-based quadruple therapy. Ther. Adv. Gastroenterol. 2012, 5, 103–109. [Google Scholar] [CrossRef]
- Kuo, C.H.; Hsu, P.I.; Kuo, F.C.; Wang, S.S.; Hu, H.M.; Liu, C.J.; Chuah, S.K.; Chen, Y.H.; Hsieh, M.C.; Wu, D.C.; et al. Comparison of 10 day bismuth quadruple therapy with high-dose metronidazole or levofloxacin for second-line Helicobacter pylori therapy: A randomized controlled trial. J. Antimicrob. Chemother. 2013, 68, 222–228. [Google Scholar] [CrossRef] [PubMed]
- Gisbert, J.P.; Romano, M.; Gravina, A.G.; Solis-Munoz, P.; Bermejo, F.; Molina-Infante, J.; Castro-Fernandez, M.; Ortuno, J.; Lucendo, A.J.; Herranz, M.; et al. Helicobacter Pylori second-line rescue therapy with levofloxacin- and bismuth-containing quadruple therapy, after failure of standard triple or non-bismuth quadruple treatments. Aliment. Pharm. 2015, 41, 768–775. [Google Scholar] [CrossRef] [PubMed]
- Cianci, R.; Montalto, M.; Pandolfi, F.; Gasbarrini, G.B.; Cammarota, G. Third-line rescue therapy for Helicobacter pylori infection. World J. Gastroenterol. WJG 2006, 12, 2313–2319. [Google Scholar] [CrossRef]
- Delchier, J.C.; Malfertheiner, P.; Thieroff-Ekerdt, R. Use of a combination formulation of bismuth, metronidazole and tetracycline with omeprazole as a rescue therapy for eradication of Helicobacter pylori. Aliment. Pharm. 2014, 40, 171–177. [Google Scholar] [CrossRef]
- Chen, Q.; Zhang, W.; Fu, Q.; Liang, X.; Liu, W.; Xiao, S.; Lu, H. Rescue Therapy for Helicobacter pylori Eradication: A Randomized Non-Inferiority Trial of Amoxicillin or Tetracycline in Bismuth Quadruple Therapy. Am. J. Gastroenterol. 2016, 111, 1736–1742. [Google Scholar] [CrossRef] [PubMed]
- Miftahussurur, M.; Shrestha, P.K.; Subsomwong, P.; Sharma, R.P.; Yamaoka, Y. Emerging Helicobacter pylori levofloxacin resistance and novel genetic mutation in Nepal. BMC Microbiol. 2016, 16, 256. [Google Scholar] [CrossRef]
- Alfizah, H.; Norazah, A.; Hamizah, R.; Ramelah, M. Resistotype of Helicobacter pylori isolates: The impact on eradication outcome. J. Med. Microbiol. 2014, 63, 703–709. [Google Scholar] [CrossRef]
- Secka, O.; Berg, D.E.; Antonio, M.; Corrah, T.; Tapgun, M.; Walton, R.; Thomas, V.; Galano, J.J.; Sancho, J.; Adegbola, R.A. Antimicrobial susceptibility and resistance patterns among Helicobacter pylori strains from The Gambia, West Africa. Antimicrob. Agents Chemother. 2013, 57, 1231–1237. [Google Scholar] [CrossRef]
- Nishizawa, T.; Suzuki, H. Mechanisms of Helicobacter pylori antibiotic resistance and molecular testing. Front. Mol. Biosci. 2014, 1, 19. [Google Scholar] [CrossRef]
- De Francesco, V.; Zullo, A.; Giorgio, F.; Saracino, I.; Zaccaro, C.; Hassan, C.; Ierardi, E.; Di Leo, A.; Fiorini, G.; Castelli, V.; et al. Change of point mutations in Helicobacter pylori rRNA associated with clarithromycin resistance in Italy. J. Med. Microbiol. 2014, 63, 453–457. [Google Scholar] [CrossRef]
- Rimbara, E.; Noguchi, N.; Kawai, T.; Sasatsu, M. Novel mutation in 23S rRNA that confers low-level resistance to clarithromycin in Helicobacter pylori. Antimicrob. Agents Chemother. 2008, 52, 3465–3466. [Google Scholar] [CrossRef] [PubMed]
- Matteo, M.J.; Perez, C.V.; Domingo, M.R.; Olmos, M.; Sanchez, C.; Catalano, M. DNA sequence analysis of rdxA and frxA from paired metronidazole-sensitive and -resistant Helicobacter pylori isolates obtained from patients with heteroresistance. Int. J. Antimicrob. Agents 2006, 27, 152–158. [Google Scholar] [CrossRef] [PubMed]
- Masaoka, T.; Suzuki, H.; Kurabayashi, K.; Nomoto, Y.; Nishizawa, T.; Mori, M.; Hibi, T. Could frameshift mutations in the frxA and rdxA genes of Helicobacter pylori be a marker for metronidazole resistance? Aliment. Pharmacol. Ther. Symp. Ser. 2006, 2, 81–87. [Google Scholar] [CrossRef]
- Rimbara, E.; Noguchi, N.; Kawai, T.; Sasatsu, M. Fluoroquinolone resistance in Helicobacter pylori: Role of mutations at position 87 and 91 of GyrA on the level of resistance and identification of a resistance conferring mutation in GyrB. Helicobacter 2012, 17, 36–42. [Google Scholar] [CrossRef]
- Taneike, I.; Nami, A.; O’Connor, A.; Fitzgerald, N.; Murphy, P.; Qasim, A.; O’Connor, H.; O’Morain, C. Analysis of drug resistance and virulence-factor genotype of Irish Helicobacter pylori strains: Is there any relationship between resistance to metronidazole and cagA status? Aliment. Pharm. 2009, 30, 784–790. [Google Scholar] [CrossRef]
- Suzuki, T.; Matsuo, K.; Sawaki, A.; Ito, H.; Hirose, K.; Wakai, K.; Sato, S.; Nakamura, T.; Yamao, K.; Ueda, R.; et al. Systematic review and meta-analysis: Importance of CagA status for successful eradication of Helicobacter pylori infection. Aliment. Pharm. 2006, 24, 273–280. [Google Scholar] [CrossRef]
- Agudo, S.; Perez-Perez, G.; Alarcon, T.; Lopez-Brea, M. High prevalence of clarithromycin-resistant Helicobacter pylori strains and risk factors associated with resistance in Madrid, Spain. J. Clin. Microbiol. 2010, 48, 3703–3707. [Google Scholar] [CrossRef]
- Fasciana, T.; Cala, C.; Bonura, C.; Di Carlo, E.; Matranga, D.; Scarpulla, G.; Manganaro, M.; Camilleri, S.; Giammanco, A. Resistance to clarithromycin and genotypes in Helicobacter pylori strains isolated in Sicily. J. Med. Microbiol. 2015, 64, 1408–1414. [Google Scholar] [CrossRef]
- Brennan, D.E.; Dowd, C.; O’Morain, C.; McNamara, D.; Smith, S.M. Can bacterial virulence factors predict antibiotic resistant Helicobacter pylori infection? World J. Gastroenterol. 2018, 24, 971–981. [Google Scholar] [CrossRef]
- Farzi, N.; Yadegar, A.; Aghdaei, H.A.; Yamaoka, Y.; Zali, M.R. Genetic diversity and functional analysis of oipA gene in association with other virulence factors among Helicobacter pylori isolates from Iranian patients with different gastric diseases. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2018, 60, 26–34. [Google Scholar] [CrossRef]
- Ahmadzadeh, A.; Ghalehnoei, H.; Farzi, N.; Yadegar, A.; Alebouyeh, M.; Aghdaei, H.A.; Molaei, M.; Zali, M.R.; Pour Hossein Gholi, M.A. Association of CagPAI integrity with severeness of Helicobacter pylori infection in patients with gastritis. Pathol. Biol. (Paris) 2015, 63, 252–257. [Google Scholar] [CrossRef] [PubMed]
- Yadegar, A.; Mohabati Mobarez, A.; Zali, M.R. Genetic diversity and amino acid sequence polymorphism in Helicobacter pylori CagL hypervariable motif and its association with virulence markers and gastroduodenal diseases. Cancer Med. 2019, 8, 1619–1632. [Google Scholar] [CrossRef] [PubMed]
- CLSI. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria, 3rd ed.; Document M45; CLSI: Wayne, PA, USA, 2015. [Google Scholar]
- Torres, J.; Camorlinga-Ponce, M.; Perez-Perez, G.; Madrazo-De la Garza, A.; Dehesa, M.; Gonzalez-Valencia, G.; Munoz, O. Increasing multidrug resistance in Helicobacter pylori strains isolated from children and adults in Mexico. J. Clin. Microbiol. 2001, 39, 2677–2680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shokrzadeh, L.; Alebouyeh, M.; Mirzaei, T.; Farzi, N.; Zali, M.R. Prevalence of multiple drug-resistant Helicobacter pylori strains among patients with different gastric disorders in Iran. Microb. Drug Resist. (Larchmt. NY) 2015, 21, 105–110. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Yadegar, A.; Mobarez, A.M.; Alebouyeh, M.; Mirzaei, T.; Kwok, T.; Zali, M.R. Clinical relevance of cagL gene and virulence genotypes with disease outcomes in a Helicobacter pylori infected population from Iran. World J. Microbiol. Biotechnol. 2014, 30, 2481–2490. [Google Scholar] [CrossRef]
- Jung, S.W.; Sugimoto, M.; Shiota, S.; Graham, D.Y.; Yamaoka, Y. The intact dupA cluster is a more reliable Helicobacter pylori virulence marker than dupA alone. Infect. Immun. 2012, 80, 381–387. [Google Scholar] [CrossRef] [Green Version]
- Yadegar, A.; Alebouyeh, M.; Zali, M.R. Analysis of the intactness of Helicobacter pylori cag pathogenicity island in Iranian strains by a new PCR-based strategy and its relationship with virulence genotypes and EPIYA motifs. Infect. Genet. Evol. 2015, 35, 19–26. [Google Scholar] [CrossRef]
- Yamaoka, Y.; Kwon, D.H.; Graham, D.Y. A M(r) 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc. Natl. Acad. Sci. USA 2000, 97, 7533–7538. [Google Scholar] [CrossRef] [Green Version]
- Han, F.; Liu, S.; Ho, B.; Yan, Z.; Yan, X. Alterations in rdxA and frxA genes and their upstream regions in metronidazole-resistant Helicobacter pylori isolates. Res. Microbiol. 2007, 158, 38–44. [Google Scholar] [CrossRef]
- Wang, L.-H.; Cheng, H.; Hu, F.-L.; Li, J. Distribution of gyrA mutations in fluoroquinolone-resistant Helicobacter pylori strains. World J. Gastroenterol. WJG 2010, 16, 2272. [Google Scholar] [CrossRef] [PubMed]
- Ho, S.L.; Tan, E.L.; Sam, C.K.; Goh, K.L. Clarithromycin resistance and point mutations in the 23S rRNA gene in Helicobacter pylori isolates from Malaysia. J. Dig. Dis. 2010, 11, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.C.; Chiang, T.H.; Chou, C.K.; Tu, Y.K.; Liao, W.C.; Wu, M.S.; Graham, D.Y. Association between Helicobacter pylori eradication and gastric cancer incidence: A systematic review and meta-analysis. Gastroenterology 2016, 150, 1113–1124. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teh, X.; Khosravi, Y.; Lee, W.C.; Leow, A.H.R.; Loke, M.F.; Vadivelu, J.; Goh, K.L. Functional and molecular surveillance of Helicobacter pylori antibiotic resistance in Kuala Lumpur. PLoS ONE 2014, 9, e101481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goh, K.L.; Navaratnam, P. High Helicobacter pylori resistance to metronidazole but zero or low resistance to clarithromycin, levofloxacin, and other antibiotics in Malaysia. Helicobacter 2011, 16, 241–245. [Google Scholar] [CrossRef]
- Binh, T.T.; Shiota, S.; Nguyen, L.T.; Ho, D.D.; Hoang, H.H.; Ta, L.; Trinh, D.T.; Fujioka, T.; Yamaoka, Y. The incidence of primary antibiotic resistance of Helicobacter pylori in Vietnam. J. Clin. Gastroenterol. 2013, 47, 233. [Google Scholar] [CrossRef] [Green Version]
- Hosseini, E.; Poursina, F.; de Wiele, T.V.; Safaei, H.G.; Adibi, P. Helicobacter pylori in Iran: A systematic review on the association of genotypes and gastroduodenal diseases. J. Res. Med Sci. Off. J. Isfahan Univ. Med. Sci. 2012, 17, 280–292. [Google Scholar]
- Talebi Bezmin Abadi, A.; Ghasemzadeh, A.; Taghvaei, T.; Mobarez, A.M. Primary resistance of Helicobacter pylori to levofloxacin and moxifloxacine in Iran. Intern. Emerg. Med. 2012, 7, 447–452. [Google Scholar] [CrossRef]
- Kohanteb, J.; Bazargani, A.; Saberi-Firoozi, M.; Mobasser, A. Antimicrobial susceptibility testing of Helicobacter pylori to selected agents by agar dilution method in Shiraz-Iran. Indian J. Med. Microbiol. 2007, 25, 374–377. [Google Scholar]
- Shokrzadeh, L.; Jafari, F.; Dabiri, H.; Baghaei, K.; Zojaji, H.; Alizadeh, A.H.; Aslani, M.M.; Zali, M.R. Antibiotic susceptibility profile of Helicobacter pylori isolated from the dyspepsia patients in Tehran, Iran. Saudi J. Gastroenterol. Off. J. Saudi Gastroenterol. Assoc. 2011, 17, 261–264. [Google Scholar]
- Ghotaslou, R.; Leylabadlo, H.E.; Asl, Y.M. Prevalence of antibiotic resistance in Helicobacter pylori: A recent literature review. World J. Methodol. 2015, 5, 164–174. [Google Scholar] [CrossRef] [PubMed]
- Nahar, S.; Mukhopadhyay, A.K.; Khan, R.; Ahmad, M.M.; Datta, S.; Chattopadhyay, S.; Dhar, S.C.; Sarker, S.A.; Engstrand, L.; Berg, D.E. Antimicrobial susceptibility of Helicobacter pylori strains isolated in Bangladesh. J. Clin. Microbiol. 2004, 42, 4856–4858. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pandya, H.B.; Agravat, H.H.; Patel, J.S.; Sodagar, N.R. Emerging antimicrobial resistance pattern of Helicobacter pylori in central Gujarat. Indian J. Med. Microbiol. 2014, 32, 408–413. [Google Scholar] [CrossRef] [PubMed]
- John Albert, M.; Al-Mekhaizeem, K.; Neil, L.; Dhar, R.; Dhar, P.M.; Al-Ali, M.; Al-Abkal, H.M.; Haridas, S. High prevalence and level of resistance to metronidazole, but lack of resistance to other antimicrobials in Helicobacter pylori, isolated from a multiracial population in Kuwait. Aliment. Pharm. 2006, 24, 1359–1366. [Google Scholar] [CrossRef]
- Khan, A.; Farooqui, A.; Manzoor, H.; Akhtar, S.S.; Quraishy, M.S.; Kazmi, S.U. Antibiotic resistance and cagA gene correlation: A looming crisis of Helicobacter pylori. World J. Gastroenterol. 2012, 18, 2245–2252. [Google Scholar] [CrossRef]
- Su, P.; Li, Y.; Li, H.; Zhang, J.; Lin, L.; Wang, Q.; Guo, F.; Ji, Z.; Mao, J.; Tang, W.; et al. Antibiotic resistance of Helicobacter pylori isolated in the Southeast Coastal Region of China. Helicobacter 2013, 18, 274–279. [Google Scholar] [CrossRef]
- Ahmad, N.; Zakaria, W.R.; Mohamed, R. Analysis of antibiotic susceptibility patterns of Helicobacter pylori isolates from Malaysia. Helicobacter 2011, 16, 47–51. [Google Scholar] [CrossRef]
- Gerrits, M.M.; Van der Wouden, E.-J.; Bax, D.A.; Van Zwet, A.A.; Van Vliet, A.H.; de Jong, A.; Kusters, J.G.; Thijs, J.C.; Kuipers, E.J. Role of the rdxA and frxA genes in oxygen-dependent metronidazole resistance of helicobacter pylori. J. Med. Microbiol. 2004, 53, 1123–1128. [Google Scholar] [CrossRef] [Green Version]
- Marais, A.; Bilardi, C.; Cantet, F.; Mendz, G.L.; Mégraud, F. Characterization of the genes rdxA and frxA involved in metronidazole resistance in Helicobacter pylori. Res. Microbiol. 2003, 154, 137–144. [Google Scholar] [CrossRef]
- Yang, Y.J.; Wu, J.J.; Sheu, B.S.; Kao, A.W.; Huang, A.H. The rdxA gene plays a more major role than frxA gene mutation in high-level metronidazole resistance of Helicobacter pylori in Taiwan. Helicobacter 2004, 9, 400–407. [Google Scholar] [CrossRef]
- Chisholm, S.A.; Owen, R.J. Mutations in Helicobacter pylori rdxA gene sequences may not contribute to metronidazole resistance. J. Antimicrob. Chemother. 2003, 51, 995–999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goh, K.L.; Manikam, J.; Qua, C.S. High-dose rabeprazole-amoxicillin dual therapy and rabeprazole triple therapy with amoxicillin and levofloxacin for 2 weeks as first and second line rescue therapies for Helicobacter pylori treatment failures. Aliment. Pharm. 2012, 35, 1097–1102. [Google Scholar] [CrossRef] [PubMed]
- Chang, W.L.; Kao, C.Y.; Wu, C.T.; Huang, A.H.; Wu, J.J.; Yang, H.B.; Cheng, H.C.; Sheu, B.S. Gemifloxacin can partially overcome quinolone resistance of H. pylori with gyrA mutation in Taiwan. Helicobacter 2012, 17, 210–215. [Google Scholar] [CrossRef] [PubMed]
- Trespalacios-Rangel, A.A.; Otero, W.; Arevalo-Galvis, A.; Poutou-Pinales, R.A.; Rimbara, E.; Graham, D.Y. Surveillance of levofloxacin resistance in Helicobacter pylori isolates in Bogota-Colombia (2009-2014). PLoS ONE 2016, 11, e0160007. [Google Scholar] [CrossRef] [Green Version]
- Cattoir, V.; Nectoux, J.; Lascols, C.; Deforges, L.; Delchier, J.C.; Megraud, F.; Soussy, C.J.; Cambau, E. Update on fluoroquinolone resistance in Helicobacter pylori: New mutations leading to resistance and first description of a gyrA polymorphism associated with hypersusceptibility. Int. J. Antimicrob. Agents 2007, 29, 389–396. [Google Scholar] [CrossRef]
- Garcia, M.; Raymond, J.; Garnier, M.; Cremniter, J.; Burucoa, C. Distribution of spontaneous gyrA mutations in 97 fluoroquinolone-resistant Helicobacter pylori isolates collected in France. Antimicrob. Agents Chemother. 2012, 56, 550–551. [Google Scholar] [CrossRef] [Green Version]
- Miyachi, H.; Miki, I.; Aoyama, N.; Shirasaka, D.; Matsumoto, Y.; Toyoda, M.; Mitani, T.; Morita, Y.; Tamura, T.; Kinoshita, S.; et al. Primary levofloxacin resistance and gyrA/B mutations among Helicobacter pylori in Japan. Helicobacter 2006, 11, 243–249. [Google Scholar] [CrossRef]
- Mégraud, F. Current recommendations for Helicobacter pylori therapies in a world of evolving resistance. Gut Microbes 2013, 4, 541–548. [Google Scholar] [CrossRef] [Green Version]
- Cuadrado-Lavín, A.; Salcines-Caviedes, J.R.; Carrascosa, M.F.; Mellado, P.; Monteagudo, I.; Llorca, J.; Cobo, M.; Campos, M.R.; Ayestarán, B.; Fernández-Pousa, A. Antimicrobial susceptibility of Helicobacter pylori to six antibiotics currently used in Spain. J. Antimicrob. Chemother. 2011, 67, 170–173. [Google Scholar] [CrossRef]
- Wueppenhorst, N.; Stueger, H.P.; Kist, M.; Glocker, E. Identification and molecular characterization of triple- and quadruple-resistant Helicobacter pylori clinical isolates in Germany. J. Antimicrob. Chemother. 2009, 63, 648–653. [Google Scholar] [CrossRef] [Green Version]
- De Francesco, V.; Margiotta, M.; Zullo, A.; Hassan, C.; Giorgio, F.; Burattini, O.; Stoppino, G.; Cea, U.; Pace, A.; Zotti, M.; et al. Prevalence of primary clarithromycin resistance in Helicobacter pylori strains over a 15 year period in Italy. J. Antimicrob. Chemother. 2007, 59, 783–785. [Google Scholar] [CrossRef] [PubMed]
- Thung, I.; Aramin, H.; Vavinskaya, V.; Gupta, S.; Park, J.Y.; Crowe, S.E.; Valasek, M.A. Review article: The global emergence of Helicobacter pylori antibiotic resistance. Aliment. Pharm. 2016, 43, 514–533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khashei, R.; Dara, M.; Bazargani, A.; Bagheri Lankarani, K.; Taghavi, A.; Moeini, M.; Dehghani, B.; Sohrabi, M. High rate of A2142G point mutation associated with clarithromycin resistance among Iranian Helicobacter pylori clinical isolates. Apmis Acta Pathol. Microbiol. Immunol. Scand. 2016, 124, 787–793. [Google Scholar] [CrossRef] [PubMed]
- Ierardi, E.; Giorgio, F.; Losurdo, G.; Di Leo, A.; Principi, M. How antibiotic resistances could change Helicobacter pylori treatment: A matter of geography? World J. Gastroenterol. WJG 2013, 19, 8168–8180. [Google Scholar] [CrossRef]
- Hirata, K.; Suzuki, H.; Nishizawa, T.; Tsugawa, H.; Muraoka, H.; Saito, Y.; Matsuzaki, J.; Hibi, T. Contribution of efflux pumps to clarithromycin resistance in Helicobacter pylori. J. Gastroenterol. Hepatol. 2010, 25 (Suppl. 1), S75–S79. [Google Scholar] [CrossRef]
- Jaka, H.; Rhee, J.A.; Östlundh, L.; Smart, L.; Peck, R.; Mueller, A.; Kasang, C.; Mshana, S.E. The magnitude of antibiotic resistance to Helicobacter pylori in Africa and identified mutations which confer resistance to antibiotics: Systematic review and meta-analysis. BMC Infect. Dis. 2018, 18, 193. [Google Scholar] [CrossRef]
- Regnath, T.; Raecke, O.; Enninger, A.; Ignatius, R. Increasing metronidazole and rifampicin resistance of Helicobacter pylori isolates obtained from children and adolescents between 2002 and 2015 in southwest Germany. Helicobacter 2017, 22. [Google Scholar] [CrossRef]
- Boyanova, L. Prevalence of multidrug-resistant Helicobacter pylori in Bulgaria. J. Med. Microbiol. 2009, 58, 930–935. [Google Scholar] [CrossRef]
- Thyagarajan, S.P.; Ray, P.; Das, B.K.; Ayyagari, A.; Khan, A.A.; Dharmalingam, S.; Rao, U.A.; Rajasambandam, P.; Ramathilagam, B.; Bhasin, D.; et al. Geographical difference in antimicrobial resistance pattern of Helicobacter pylori clinical isolates from Indian patients: Multicentric study. J. Gastroenterol. Hepatol. 2003, 18, 1373–1378. [Google Scholar] [CrossRef]
- van Doorn, L.J.; Schneeberger, P.M.; Nouhan, N.; Plaisier, A.P.; Quint, W.G.; de Boer, W.A. Importance of Helicobacter pylori cagA and vacA status for the efficacy of antibiotic treatment. Gut 2000, 46, 321–326. [Google Scholar] [CrossRef] [Green Version]
- Rudi, J.; Reuther, S.; Sieg, A.; Hoerner, M.; Stremmel, W. Relevance of underlying disease and bacterial vacA and cagA status on the efficacy of Helicobacter pylori eradication. Digestion 2002, 65, 11–15. [Google Scholar] [CrossRef] [PubMed]
- Sugimoto, M.; Yamaoka, Y. Virulence factor genotypes of Helicobacter pylori affect cure rates of eradication therapy. Arch. Immunol. Ther. Exp. 2009, 57, 45–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alarcon-Millan, J.; Fernandez-Tilapa, G.; Cortes-Malagon, E.M.; Castanon-Sanchez, C.A.; De Sampedro-Reyes, J.; Cruz-Del Carmen, I.; Betancourt-Linares, R.; Roman-Roman, A. Clarithromycin resistance and prevalence of Helicobacter pylori virulent genotypes in patients from Southern Mexico with chronic gastritis. Infect. Genet. Evol. 2016, 44, 190–198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karabiber, H.; Selimoglu, M.A.; Otlu, B.; Yildirim, O.; Ozer, A. Virulence factors and antibiotic resistance in children with Helicobacter pylori gastritis. J. Pediatr. Gastroenterol. Nutr. 2014, 58, 608–612. [Google Scholar] [CrossRef] [PubMed]
- Rasheed, F.; Campbell, B.J.; Alfizah, H.; Varro, A.; Zahra, R.; Yamaoka, Y.; Pritchard, D.M. Analysis of clinical isolates of Helicobacter pylori in Pakistan reveals high degrees of pathogenicity and high frequencies of antibiotic resistance. Helicobacter 2014, 19, 387–399. [Google Scholar] [CrossRef]
- Sicinschi, L.A.; Correa, P.; Peek, R.M.; Camargo, M.C.; Piazuelo, M.B.; Romero-Gallo, J.; Hobbs, S.S.; Krishna, U.; Delgado, A.; Mera, R.; et al. CagA C-terminal variations in Helicobacter pylori strains from Colombian patients with gastric precancerous lesions. Clin. Microbiol. Infect. 2010, 16, 369–378. [Google Scholar] [CrossRef] [Green Version]
- De Francesco, V.; Margiotta, M.; Zullo, A.; Hassan, C.; Valle, N.D.; Burattini, O.; D’Angelo, R.; Stoppino, G.; Cea, U.; Giorgio, F.; et al. Claritromycin resistance and Helicobacter pylori genotypes in Italy. J. Microbiol. (Seoul Korea) 2006, 44, 660–664. [Google Scholar]
- Elviss, N.C.; Owen, R.J.; Xerry, J.; Walker, A.M.; Davies, K. Helicobacter pylori antibiotic resistance patterns and genotypes in adult dyspeptic patients from a regional population in North Wales. J. Antimicrob. Chemother. 2004, 54, 435–440. [Google Scholar] [CrossRef] [Green Version]
Target Gene | Primer Designation | Oligonucleotide Sequence (5′–3′) | Annealing Temperature (°C) | PCR Product (bp) | Reference |
---|---|---|---|---|---|
cagA | 93089 93261 | AATACACCAACGCCTCCAAG TTGTTGCCGCTTTTGCTCTC | 57 | 400 | [37] |
cagL | CagL-B4 CagL-B5 | GCAGAATTCATAACAAGCGGCTTAAAG ATTAGAATTCATAGCCTATCGTCTCAG | 60 | 695 | [37] |
vacA s1/s2 | VA1-F VA1-R | ATGGAAATACAACAAACACAC CTGCTTGAATGCGCCAAAC | 57 | 259/286 | [37] |
vacA m1/m2 | VAG-F VAG-R | CAATCTGTCCAATCAAGCGAG GCGTCAAAATAATTCCAAGG | 57 | 570/645 | [37] |
babA2 | Bab7-F Bab7-R | CCAAACGAAACAAAAAGCGT GCTTGTGTAAAAGCCGTCGT | 52 | 271 | [37] |
sabA | F1-HP726-jhp663 R1-HP725-jhp662 | TTTTTGTCAGCTACGCGTTC ACCGAAGTGATAACGGCTTG | 55 | 581 | [37] |
oipA | OipA-F OipA-R | CAAGCGCTTAACAGATAGGC AAGGCGTTTTCTGCTGAAGC | 56 | 450 | [40] |
dupA | DupA-F DupA-R | ATTCACGCCTAAGACCTCA CTGAGAAGCCTTATTATCTTGTTGG | 52 | 487 | [38] |
frxA | frx1 frx2 | TGGATATGGCAGCCGTTTA GGTTATCAAAAAGCTAACAGCG | 52 | 729 | [41] |
rdxA | rdx1 rdx2 | ATGGTAATTGTTTCGTTAGGG CTCCTTGAACTTTAATTTAG | 48 | 758 | [41] |
gyrA | gyrAPF gyrAPR | AGCTTATTCCATGAGCGTGA TCAGGCCCTTTGACAAATTC | 52 | 582 | [42] |
gyrB | gyrBPF gyrBPR | CCCTAACGAAGCCAAAATCA GGGCGCAAATAACGATAGAA | 51 | 465 | [42] |
23S rRNA | Hp23-1 Hp23-2 | CCACAGCGATGTGGTCTCAG CTCCATAAGAGCCAAAGCCC | 54 | 425 | [43] |
Antibiotic Agents | MIC Range | MIC50 | MIC90 | No. (%) of MIC (mg/L) | |
---|---|---|---|---|---|
Susceptible | Resistant | ||||
MNZ | 0.25–128 | 32 | 64 | 12 (17.6) | 56 (82.4) |
CLR a | 0.06–16 | 0.125 | 8 | 40 (58.8) | 23 (33.8) |
AMX | 0.03–0.5 | 0.06 | 0.5 | 47 (69.1) | 21 (30.9) |
CIP | 0.06–32 | 0.5 | 16 | 45 (66.2) | 23 (33.8) |
LEV | 0.03–32 | 0.25 | 8 | 49 (72.1) | 19 (27.9) |
RIF | 0.03–32 | 0.5 | 8 | 46 (67.6) | 22 (32.4) |
TCN | 0.06–4 | 0.125 | 0.5 | 65 (95.6) | 3 (4.4) |
MIC (mg/L) | No. (%) | ||||||
---|---|---|---|---|---|---|---|
MNZ | CLR | AMX | CIP | LEV | RIF | TCN | |
0.03 | NA | NA | 24 (35.3) | NA | 5 (7.3) | 5 (7.3) | NA |
0.06 | NA | 25 (36.8) | 15 (22) | 3 (4.4) | 4 (5.9) | 9 (13.2) | 17 (25) |
0.125 | NA | 11 (16.2) | 8 (11.8) | 17 (25) | 10 (14.7) | 15 (22) | 32 (47) |
0.25 | 4 (5.9) | 4 (5.9) | 12 (17.6) | 13 (19.1) | 15 (22) | 4 (5.9) | 7 (10.3) |
0.5 | ND | 5 (7.3) | 9 (13.2) | 5 (7.3) | 6 (8.8) | 8 (11.8) | 5 (7.3) |
1 | 3 (4.4) | 5 (7.3) | ND | 7 (10.3) | 9 (13.2) | 5 (7.3) | 4 (5.9) |
2 | ND | 6 (8.8) | ND | 8 (11.8) | 7 (10.3) | 9 (13.2) | 2 (2.9) |
4 | ND | 3 (4.4) | ND | 3 (4.4) | 4 (5.9) | 2 (2.9) | 1 (1.5) |
8 | 5 (7.3) | 2 (2.9) | NA | 2 (2.9) | 3 (4.4) | 5 (7.3) | ND |
16 | 16 (23.5) | 7 (10.3) | NA | 9 (13.2) | 4 (18.2) | 4 (5.9) | ND |
32 | 14 (20.6) | ND | NA | 1 (1.5) | 1 (1.5) | 2 (2.9) | NA |
64 | 19 (27.9) | ND | NA | NA | NA | NA | NA |
128 | 7 (10.3) | NA | NA | NA | NA | NA | NA |
256 | ND | NA | NA | NA | NA | NA | NA |
Resistance Profiles | Clinical Diagnosis | Total No. (%) | ||
---|---|---|---|---|
CG (n = 42) | PUD (n = 18) | IM (n = 7) | ||
Single drugs | ||||
CLR | 2 | 1 | 0 | 3 (4.5) |
AMX | 1 | 0 | 0 | 1 (1.5) |
RIF | 2 | 0 | 0 | 2 (3) |
CIP | 0 | 1 | 0 | 1 (1.5) |
MNZ | 6 | 2 | 1 | 9 (13.4) |
Double drugs | ||||
MNZ + AMX | 3 | 2 | 0 | 5 (7.5) |
MNZ + RIF | 4 | 1 | 1 | 6 (8.9) |
CIP + RIF | 3 | 1 | 0 | 4 (6) |
MNZ + CIP | 2 | 1 | 0 | 3 (4.5) |
MNZ + LEV | 1 | 1 | 0 | 2 (3) |
Triple drugs | ||||
MNZ + CLR + LEV | 1 | 2 | 1 | 4 (6) |
MNZ + AMX + RIF | 3 | 1 | 0 | 4 (6) |
MNZ + CLR + CIP | 2 | 1 | 1 | 4 (6) |
MNZ + CLR + AMX | 1 | 0 | 1 | 2 (3) |
MNZ + AMX + CIP/LEV | 2 | 1 | 0 | 3 (4.5) |
MNZ + RIF + CIP/LEV | 3 | 0 | 0 | 3 (4.5) |
Quadruple drugs | ||||
MNZ + CLR + AMX + LEV | 2 | 1 | 0 | 3 (4.5) |
MNZ + CLR + AMX + CIP/LEV | 0 | 0 | 1 | 1 (1.5) |
MNZ + CLR + TCN + LEV | 1 | 1 | 0 | 2 (3) |
MNZ + TCN + RIF + LEV | 0 | 0 | 1 | 1 (1.5) |
MNZ + CLR + AMX + CIP | 1 | 1 | 0 | 2 (3) |
MNZ + CLR + CIP + RIF | 2 | 0 | 0 | 2 (3) |
Strains | Metronidazole Resistance Phenotype | MIC (mg/L) | No. of Nucleotide ins/del | Mutations | No. of Nucleotide ins/del | Mutation | SDR/MDR | Clinical Diagnosis |
---|---|---|---|---|---|---|---|---|
frxA | rdxA | |||||||
OC80 | Susceptible | 0.25 | None a | In-frame | None a | In-frame | N c | CG |
OC112 | Resistant | 32 | ND b | ND b | None a | In-frame | MDR | CG |
HC114 | Resistant | 16 | Ins (2)/Del (4) | Frameshift | None a | In-frame | SDR | PUD |
HC138 | Resistant | 32 | Del (2) | Frameshift | None a | In-frame | MDR | PUD |
HC168 | Resistant | 32 | Del (1) | Frameshift | ND b | ND b | MDR | PUD |
OC179 | Resistant | 64 | ND b | ND b | ND b | ND b | SDR | CG |
OC180 | Resistant | 32 | Del (2) | Frameshift | Del (4) | Frameshift | MDR | IM |
OC217 | Resistant | 32 | Del (1) | Frameshift | Ins (1) | Frameshift | MDR | CG |
OC218 | Susceptible | 0.25 | ND b | ND b | ND b | ND b | SDR | CG |
OC235 | Resistant | 32 | Del (2) | Frameshift | Ins (9) | Frameshift | MDR | PUD |
OC245 | Resistant | 8 | ND b | ND b | ND b | ND b | MDR | IM |
OC250 | Susceptible | 1 | None a | In-frame | None a | In-frame | SDR | PUD |
OC485 | Resistant | 128 | Del (1) | Frameshift | None a | In-frame | MDR | CG |
OC494 | Susceptible | 0.25 | None a | In-frame | None a | In-frame | MDR | CG |
OC557 | Resistant | 64 | Del (3) | Frameshift | None a | In-frame | MDR | PUD |
OC562 | Susceptible | 8 | None a | In-frame | None a | In-frame | SDR | CG |
OC571 | Resistant | 64 | None a | In-frame | None a | In-frame | MDR | CG |
OC576 | Resistant | 64 | Del (1) | Frameshift | Q50Stop | PTC | SDR | CG |
OC688 | Resistant | 16 | Del (1) | Frameshift | Q50Stop | PTC | MDR | IM |
OC797 | Resistant | 16 | Del (1) | Frameshift | None a | In-frame | MDR | IM |
OC803 | Resistant | 16 | None a | In-frame | None a | In-frame | MDR | CG |
OC810 | Resistant | 64 | None a | In-frame | Del (1) | Frameshift | MDR | CG |
OC824 | Resistant | 128 | None a | In-frame | Q50Stop | PTC | MDR | PUD |
OC840 | Susceptible | 1 | None a | In-frame | None a | In-frame | SDR | PUD |
OC852 | Resistant | 16 | ND b | ND b | Ins (4) | Frameshift | MDR | IM |
OC897 | Resistant | 16 | None a | In-frame | Ins (6)/Del (2) | Frameshift | SDR | PUD |
OC912 | Resistant | 16 | Del (1) | Frameshift | Del (1) | Frameshift | MDR | PUD |
OC913 | Resistant | 128 | Ins (3)/Del (1) | Frameshift | None a | In-frame | MDR | PUD |
OC937 | Resistant | 128 | ND b | ND b | Del (1) | Frameshift | SDR | CG |
OC939 | Resistant | 64 | Q5Stop | PTC | None a | In-frame | MDR | PUD |
OC975 | Resistant | 64 | None a | In-frame | ND b | ND b | MDR | IM |
OC985 | Resistant | 64 | None a | In-frame | Del (1) | Frameshift | MDR | CG |
OC1031 | Resistant | 128 | Ins (2) | Frameshift | Del (1) | Frameshift | MDR | CG |
Strains | Resistance Phenotype CIP/LEV | MIC (mg/L) | Mutations | SDR/MDR | Clinical Diagnosis | ||
---|---|---|---|---|---|---|---|
CIP | LEV | gyrA | gyrB | ||||
OC80 | Susceptible/Susceptible | 0.5 | 0.06 | M191I, V199A, G208E | D481E | N c | CG |
OC112 | Susceptible/Susceptible | 0.25 | 0.25 | M191I, G208E | None a | MDR | CG |
HC114 | Susceptible/Susceptible | 0.12 | 0.12 | M191I, G208E | None a | SDR | PUD |
HC138 | Resistant/Susceptible | 16 | 0.5 | V150A, M191I, G208E | None a | MDR | PUD |
HC168 | Susceptible/Susceptible | 0.25 | 0.06 | D143E, G208K, I212S, E214K | ND b | MDR | PUD |
OC179 | Susceptible/Susceptible | 0.5 | 0.06 | M191I, V199A, G208A | ND b | SDR | CG |
OC180 | Susceptible/Susceptible | 0.12 | 0.06 | V150A, M191I, V199A, G208E | None a | MDR | IM |
OC217 | Susceptible/Susceptible | 0.12 | 0.06 | M191I, G208E | ND b | MDR | CG |
OC218 | Susceptible/Susceptible | 0.12 | 0.06 | ND b | ND b | SDR | CG |
OC235 | Susceptible/Susceptible | 0.25 | 0.06 | D86N, M191I, G208E | None a | MDR | PUD |
OC245 | Resistant/Resistant | 16 | 16 | M191I, V199A, G208A | None a | MDR | IM |
OC250 d | Resistant/Susceptible | 16 | 0.5 | D86G, M191I | None a | SDR | PUD |
OC485 d | Resistant/Susceptible | 2 | 0.12 | D86N, A183V, M191I | None a | MDR | CG |
OC494 d | Resistant/Susceptible | 32 | 0.5 | None a | None a | MDR | CG |
OC557 | Susceptible/Resistant | 0.12 | 16 | V199A, G208E | None a | MDR | PUD |
OC562 | Susceptible/Susceptible | 1 | 0.12 | D86G, M191I, A207T, G208E | ND b | SDR | CG |
OC571 | Resistant/Resistant | 16 | 16 | D86G, M191I, V199A, G208E | None a | MDR | CG |
OC576 | Susceptible/Susceptible | 0.06 | 0.5 | V199A, G208E | D481E | SDR | CG |
OC688 | Susceptible/Susceptible | 1 | 1 | M191I, V199A, G208E | None a | MDR | IM |
OC797 | Resistant/Susceptible | 2 | 0.03 | M191I, V199A, G208E | D481E, R484K | MDR | IM |
OC803 | Resistant/Susceptible | 2 | 0.03 | S63P, M191I, V199A, G208E | None a | MDR | CG |
OC810 | Susceptible/Resistant | 1 | 32 | M191I, G208E | None a | MDR | CG |
OC824 | Resistant/Resistant | 16 | 16 | M191I, G208E | D481E, R484K | MDR | PUD |
OC840 | Susceptible/Susceptible | 1 | 0.06 | G208E | None a | SDR | PUD |
OC852 | Susceptible/Resistant | 0.5 | 2 | M191I, G208E | D481E, R484K | MDR | IM |
OC897 | Susceptible/Susceptible | 0.25 | 0.03 | A97V, G208E | None a | SDR | PUD |
OC912 | Resistant/Susceptible | 2 | 0.12 | G208E | D481E, R484K | MDR | PUD |
OC913 | Susceptible/Resistant | 0.25 | 16 | M191I, G208E | D481E, R484K | MDR | PUD |
OC937 | Susceptible/Susceptible | 0.12 | 0.5 | G208E | None a | SDR | CG |
OC939 | Resistant/Susceptible | 4 | 0.12 | M191I, G208E | None a | MDR | PUD |
OC975 | Susceptible/Resistant | 0.25 | 16 | D86N, R140K, M191I, G208E | None a | MDR | IM |
OC985 | Susceptible/Susceptible | 0.12 | 0.06 | ND b | None a | MDR | CG |
OC1031 | Resistant/Resistant | 16 | 16 | D86N, M191I, G208E | ND b | MDR | CG |
Strains | Clarithromycin Resistance Phenotype | MIC (mg/L) | Mutations | SDR/MDR | Clinical Diagnosis |
---|---|---|---|---|---|
OC80 | Susceptible | 0.062 | None a | N c | CG |
OC112 | Susceptible | 0.125 | ND b | MDR | CG |
HC114 | Susceptible | 0.062 | None a | SDR | PUD |
HC138 | Resistant | 16 | None a | MDR | PUD |
HC168 | Susceptible | 0.062 | None a | MDR | PUD |
OC179 | Susceptible | 0.062 | ND b | SDR | CG |
OC180 | Resistant | 16 | A2143G | MDR | IM |
OC217 | Susceptible | 0.062 | ND b | MDR | CG |
OC218 | Susceptible | 0.25 | ND b | SDR | CG |
OC235 | Intermediate | 0.5 | None a | MDR | PUD |
OC245 | Resistant | 16 | ND b | MDR | IM |
OC250 | Susceptible | 0.25 | None a | SDR | PUD |
OC485 | Resistant | 2 | None a | MDR | CG |
OC494 | Susceptible | 0.062 | None a | MDR | CG |
OC557 | Resistant | 2 | C2195T | MDR | PUD |
OC562 | Intermediate | 0.5 | ND b | SDR | CG |
OC571 | Susceptible | 0.25 | None a | MDR | CG |
OC576 | Susceptible | 0.125 | ND b | SDR | CG |
OC688 | Susceptible | 0.125 | None a | MDR | IM |
OC797 | Resistant | 16 | None a | MDR | IM |
OC803 | Resistant | 1 | ND b | MDR | CG |
OC810 | Resistant | 2 | C2195T | MDR | CG |
OC824 | Susceptible | 0.062 | None a | MDR | PUD |
OC840 | Resistant | 1 | A2143G | SDR | PUD |
OC852 | Resistant | 2 | ND b | MDR | IM |
OC897 | Susceptible | 0.062 | None a | SDR | PUD |
OC912 | Intermediate | 0.5 | None a | MDR | PUD |
OC913 | Susceptible | 0.125 | None a | MDR | PUD |
OC937 | Susceptible | 0.125 | None a | SDR | CG |
OC939 | Resistant | 4 | None a | MDR | PUD |
OC975 | Susceptible | 0.125 | None a | MDR | IM |
OC985 | Susceptible | 0.125 | None a | MDR | CG |
OC1031 | Susceptible | 0.062 | None a | MDR | CG |
Virulence Genotypes | Resistance No. (%) | Total No. (%) | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
MNZ | CLR | AMX | CIP | LEV | RIF | TCN | ||||||||||
S (n = 12) | R (n = 56) | S (n = 40) | I (n = 5) | R (n = 23) | S (n = 47) | R (n = 21) | S (n = 45) | R (n = 23) | S (n = 49) | R (n = 19) | S (n = 46) | R (n = 22) | S (n = 65) | R (n = 3) | ||
cagL+ | 11 (16.2) | 55 (80.9) | 38 (55.9) | 5 (7.5) | 23 (33.8) | 46 (67.6) | 20 (29.4) | 43 (63.2) | 23 (33.8) | 47 (69.1) | 19 (27.9) | 44 (64.7) | 22 (32.3) | 63 (92.6) | 3 (4.4) | 66/68 (97) |
cagL¯ | 1 (1.5) | 1 (1.5) | 2 (2.9) | 0 | 0 | 1 (1.5) | 1 (1.5) | 2 (2.9) | 0 | 2 (2.9) | 0 | 2 (2.9) | 0 | 2 (2.9) | 0 | 2/68 (2.9) |
cagA+ | 5 (7.5) | 52 (76.5) | 33 (48.5) | 4 (5.9) | 20 (29.4) | 39 (57.3) | 18 (26.5) | 36 (52.9) | 21 (30.9) | 40 (58.8) | 17 (25) | 38 (55.9) | 19 (27.9) | 54 (79.4) | 3 (4.4) | 57/68 (83.8) |
cagA¯ | 7 (10.4) | 4 (5.9) | 7 (10.4) | 1 (1.5) | 3 (4.4) | 8 (11.8) | 3 (4.4) | 9 (13.2) | 2 (2.9) | 9 (13.2) | 2 (2.9) | 8 (11.8) | 3 (4.4) | 11 (16.2) | 0 | 11/68 (16.2) |
cagA EPIYA motifs | ||||||||||||||||
ABC | 3 (5.3) | 36 (63.1) | 24 (42.1) | 2 (3.5) | 13 (22.8) | 29 (50.9) | 10 (17.5) | 28 (49.1) | 11 (19.3) | 27 (47.4) | 12 (21) | 27 (47.4) | 12 (21) | 37 (64.9) | 2 (3.5) | 39/57 (68.4) |
ABCC | 1 (1.7) | 3 (5.3) | 2 (3.5) | 0 | 2 (3.5) | 1 (1.7) | 3 (5.3) | 1 (1.7) | 3 (5.3) | 3 (5.3) | 1 (1.7) | 2 (3.5) | 2 (3.5) | 4 (7)) | 0 | 4/57 (7) |
ABCCC | 0 | 2 (3.5) | 1 (1.7) | 0 | 1 (1.7) | 0 | 2 (3.5) | 0 | 2 (3.5) | 1 (1.7) | 1 (1.7) | 2 (3.5) | 0 | 1 (1.7) | 1 (1.7) | 2/57 (3.5) |
Mixed type a | 1 (1.7) | 11 (19.3) | 6 (10.5) | 2 (3.5) | 4 (7) | 9 (15.8) | 3 (5.3) | 7 (12.3) | 5 (8.8) | 9 (15.8) | 3 (5.3) | 7 (12.3) | 5 (8.8) | 12 (21) | 0 | 12/57 (21) |
cagPAI integrity | ||||||||||||||||
Intact cagPAI | 5 (7.5) | 39 (58.2) | 24 (35.2) | 3 (4.5) | 17 (25.4) | 32 (47.8) | 12 (17.9) | 26 (38.8) | 18 (26.9) | 31 (46.3) | 13 (22.8) | 26 (38.8) | 18 (26.9) | 41 (61.2) | 3 (4.5) | 44/67 (65.7) |
Partial cagPAI | 7 (10.4) | 16 (23.9) | 15 (22.4) | 2 (3) | 6 (8.9) | 14 (20.9) | 9 (13.4) | 18 (26.9) | 5 (7.5) | 17 (25.4) | 6 (8.9) | 19 (28.3) | 4 (5.9) | 23 (34.3) | 0 | 23/67 (34.3) |
Totally deleted cagPAI | 0 | 1 (1.5) | 1 (1.5) | 0 | 0 | 1 (1.5) | 0 | 1 (1.5) | 0 | 1 (1.5) | 0 | 1 (1.5) | 0 | 1 (1.5) | 0 | 1/68 (1.5) |
vacA alleles | ||||||||||||||||
vacA s1m1 | 7 (10.4) | 23 (33.8) | 14 (20.6) | 2 (2.9) | 10 (14.7) | 18 (26.5) | 8 (11.8) | 17 (25) | 9 (13.2) | 19 (27.9) | 7 (10.4) | 18 (26.5) | 8 (11.8) | 25 (36.8) | 1 (1.5) | 26/68 (38.2) |
vacA s1m2 | 4 (5.9) | 29 (42.6) | 22 (32.3) | 2 (2.9) | 11 (16.2) | 26 (38.2) | 9 (13.2) | 24 (35.3) | 11 (16.2) | 26 (38.2) | 9 (13.2) | 23 (33.8) | 12 (17.6) | 33 (48.5) | 2 (2.9) | 35/68 (51.5) |
vacA s2m2 | 1 (1.5) | 4 (5.9) | 4 (5.9) | 1 (1.5) | 2 (2.9) | 3 (4.4) | 4 (5.9) | 4 (5.9) | 3 (4.4) | 4 (5.9) | 3 (4.4) | 5 (7.5) | 2 (2.9) | 7 (10.4) | 0 | 7/68 (10.3) |
Adhesions | ||||||||||||||||
Oip “on” | 10 (14.7) | 49 (72) | 37 (54.4) | 3 (4.4) | 19 (27.9) | 44 (64.7) | 15 (22) | 38 (55.9) | 21 (30.9) | 42 (61.8) | 17 (25) | 40 (58.8) | 19 (27.9) | 57 (83.8) | 2 (2.9) | 59/68 (86.8) |
Oip “off” | 2 (2.9) | 7 (10.4) | 3 (4.4) | 2 (2.9) | 4 (5.9) | 3 (4.4) | 6 (8.8) | 7 (10.4) | 2 (2.9) | 7 (10.4) | 2 (2.9) | 6 (8.8) | 3 (4.4) | 8 (11.8) | 1 (1.5) | 9/68 (13.2) |
babA2+ | 10 (14.7) | 55 (80.9) | 37 (54.4) | 5 (7.5) | 23 (33.8) | 45 (66.2) | 20 (29.4) | 43 (63.2) | 22 (32.3) | 46 (67.6) | 19 (27.9) | 44 (64.7) | 21 (30.9) | 62 (91.2) | 3 (4.4) | 65/68 (95.6) |
babA2¯ | 2 (2.9) | 1 (1.5) | 3 (4.4) | 0 | 0 | 2 (2.9) | 1 (1.5) | 2 (2.9) | 1 (1.5) | 3 (4.4) | 0 | 2 (2.9) | 1 (1.5) | 3 (4.4) | 0 | 3/68 (4.4) |
sabA+ | 3 (4.4) | 52 (76.5) | 32 (47) | 4 (5.9) | 19 (27.9) | 38 (55.9) | 17 (25) | 36 (52.9) | 19 (27.9) | 41 (60.3) | 14 (20.6) | 37 (54.4) | 18 (26.5) | 52 (76.5) | 3 (4.4) | 55/68 (80.9) |
sabA¯ | 9 (13.2) | 4 (5.9) | 8 (11.8) | 1 (1.5) | 4 (5.9) | 9 (13.2) | 4 (5.9) | 9 (13.2) | 4 (5.9) | 8 (11.8) | 5 (7.5) | 9 (13.2) | 4 (5.9) | 13 (19.1) | 0 | 13/68 (19.1) |
dupA+ | 5 (7.5) | 53 (77.9) | 34 (50) | 4 (5.9) | 20 (29.4) | 40 (58.8) | 18 (26.5) | 38 (55.9) | 20 (29.4) | 42 (61.8) | 16 (23.5) | 39 (57.3) | 19 (27.9) | 56 (82.3) | 2 (2.9) | 58/68 (85.3) |
dupA¯ | 7 (10.4) | 3 (4.4) | 6 (8.8) | 1 (1.5) | 3 (4.4) | 7 (10.4) | 3 (4.4) | 7 (10.4) | 3 (4.4) | 7 (10.4) | 3 (4.4) | 7 (10.4) | 3 (4.4) | 9 (13.2) | 1 (1.5) | 10/68 (14.7) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Farzi, N.; Yadegar, A.; Sadeghi, A.; Asadzadeh Aghdaei, H.; Marian Smith, S.; Raymond, J.; Suzuki, H.; Zali, M.R. High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping. J. Clin. Med. 2019, 8, 2004. https://doi.org/10.3390/jcm8112004
Farzi N, Yadegar A, Sadeghi A, Asadzadeh Aghdaei H, Marian Smith S, Raymond J, Suzuki H, Zali MR. High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping. Journal of Clinical Medicine. 2019; 8(11):2004. https://doi.org/10.3390/jcm8112004
Chicago/Turabian StyleFarzi, Nastaran, Abbas Yadegar, Amir Sadeghi, Hamid Asadzadeh Aghdaei, Sinéad Marian Smith, Josette Raymond, Hidekazu Suzuki, and Mohammad Reza Zali. 2019. "High Prevalence of Antibiotic Resistance in Iranian Helicobacter pylori Isolates: Importance of Functional and Mutational Analysis of Resistance Genes and Virulence Genotyping" Journal of Clinical Medicine 8, no. 11: 2004. https://doi.org/10.3390/jcm8112004