Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials and RNA Isolation
2.2. Illumina Sequencing and Transcriptome Assembly
2.3. Identification and Phylogenetic Analysis of CAD Genes
2.4. Gene Expression Analysis
3. Results
3.1. De Novo Assembly of A. angustifolia Transcriptome
3.2. Functional Annotation
3.3. Identification of CAD Genes in Agaves
3.4. Phylogeny of CAD Proteins
3.5. Expression of Agave CAD Genes
4. Discussion
4.1. Features of A. angustifolia Transcriptome
4.2. Candidate CAD Genes for Lignin Biosynthesis in Agaves
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Good-Avila, S.V.; Souza, V.; Gaut, B.S.; Eguiarte, L.E. Timing and rate of speciation in Agave (Agavaceae). Proc. Natl. Acad. Sci. USA 2006, 103, 9124–9129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gross, S.M.; Martin, J.A.; Simpson, J.; Abraham-Juarez, M.J.; Wang, Z.; Visel, A. De novo transcriptome assembly of drought tolerant CAM plants, Agave deserti and Agave tequilana. BMC Genom. 2013, 14, 563. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, X.; Cushman, J.C.; Borland, A.M.; Edwards, E.; Wullschleger, S.D.; Tuskan, G.A.; Owen, N.A.; Griffiths, H.; Smith, J.A.; De Paoli, H.C.; et al. A roadmap for research on crassulacean acid metabolism (CAM) to enhance sustainable food and bioenergy production in a hotter, drier world. New Phytol. 2015, 207, 491–504. [Google Scholar] [CrossRef] [PubMed]
- García-Mendoza, A.; Chiang, F. The confusion of Agave vivipara L. and A. angustifolia Haw., two distinct taxa. Brittonia 2003, 55, 82–87. [Google Scholar] [CrossRef]
- Gutiérrez-Coronado, M.; Acedo-Félix, E.; Valenzuela-Quintanar, A. Bacanora industry and its process of production. Cienc. Tecnol. Aliment. Food 2007, 5, 394–404. [Google Scholar] [CrossRef]
- Robert, M.L.; Lim, K.Y.; Hanson, L.; Sanchez-Teyer, F.; Bennett, M.D.; Leitch, A.R.; Leitch, I.J. Wild and agronomically important Agave species (Asparagaceae) show proportional increases in chromosome number, genome size, and genetic markers with increasing ploidy. Bot. J. Linn. Soc. 2008, 158, 215–222. [Google Scholar] [CrossRef] [Green Version]
- Rosli, N.A.; Ahmad, I.; Abdullah, I. Isolation and characterization of cellulose nanocrystals from Agave angustifolia fibre. Bioresources 2013, 8, 1893–1908. [Google Scholar] [CrossRef] [Green Version]
- Jin, G.; Huang, X.; Chen, T.; Qin, X.; Xi, J.; Yi, K. The complete chloroplast genome of agave hybrid 11648. Mitochondrial DNA B Resour. 2020, 5, 2345–2346. [Google Scholar] [CrossRef]
- Raya, F.T.; Marone, M.P.; Carvalho, L.M.; Rabelo, S.C.; Paula, M.S.; Campanari, M.F.Z.; Freschi, L.; Mayer, J.L.S.; Silva, O.R.R.F.; Mieczkowski, P.; et al. Extreme physiology: Biomass and transcriptional profiling of three abandoned Agave cultivars. Ind. Crops Prod. 2021, 172, 114043. [Google Scholar] [CrossRef]
- Huang, X.; Wang, B.; Xi, J.; Zhang, Y.; He, C.; Zheng, J.; Gao, J.; Chen, H.; Zhang, S.; Wu, W.; et al. Transcriptome comparison reveals distinct selection patterns in domesticated and wild Agave species, the important CAM plants. Int. J. Genom. 2018, 2018, 5716518. [Google Scholar] [CrossRef] [Green Version]
- Huang, X.; Xiao, M.; Xi, J.; He, C.; Zheng, J.; Chen, H.; Gao, J.; Zhang, S.; Wu, W.; Liang, Y.; et al. De novo transcriptome assembly of Agave H11648 by Illumina sequencing and identification of cellulose synthase genes in Agave species. Genes 2019, 10, 103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deng, G.; Huang, X.; Xie, L.; Tan, S.; Gbokie, T., Jr.; Bao, Y.; Xie, Z.; Yi, K. Identification and Expression of SAUR Genes in the CAM Plant Agave. Genes 2019, 10, 555. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tan, S.; Liang, Y.; Huang, Y.; Xi, J.; Huang, X.; Yang, X.; Yi, K. Phylogeny and Expression Atlas of the NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER FAMILY in Agave. Plants 2022, 11, 1434. [Google Scholar] [CrossRef] [PubMed]
- Maceda-López, L.F.; Góngora-Castillo, E.B.; Ibarra-Laclette, E.; Morán-Velázquez, D.C.; Girón Ramírez, A.; Bourdon, M.; Villalpando-Aguilar, J.L.; Toomer, G.; Tang, J.Z.; Azadi, P.; et al. Transcriptome Mining Provides Insights into Cell Wall Metabolism and Fiber Lignification in Agave tequilana Weber. Plants 2022, 11, 1496. [Google Scholar] [CrossRef]
- Schuster, S.C. Next-generation sequencing transforms today’s biology. Nat. Methods 2008, 5, 16–18. [Google Scholar] [CrossRef]
- Weng, J.K.; Chapple, C. The origin and evolution of lignin biosynthesis. New Phytol. 2010, 187, 273–285. [Google Scholar] [CrossRef]
- Vanholme, R.; Demedts, B.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin biosynthesis and structure. Plant Physiol. 2010, 153, 895–905. [Google Scholar] [CrossRef] [Green Version]
- Qi, K.; Song, X.; Yuan, Y.; Bao, J.; Gong, X.; Huang, X.; Khanizadeh, S.; Zhang, S.; Tao, S. CAD Genes: Genome-Wide Identification, Evolution, and Their Contribution to Lignin Biosynthesis in Pear (Pyrus bretschneideri). Plants 2021, 10, 1444. [Google Scholar] [CrossRef]
- Preisner, M.; Wojtasik, W.; Kostyn, K.; Boba, A.; Czuj, T.; Szopa, J.; Kulma, A. The cinnamyl alcohol dehydrogenase family in flax: Differentiation during plant growth and under stress conditions. J. Plant Physiol. 2018, 221, 132–143. [Google Scholar] [CrossRef]
- Vanholme, R.; Morreel, K.; Darrah, C.; Oyarce, P.; Grabber, J.H.; Ralph, J.; Boerjan, W. Metabolic engineering of novel lignin in biomass crops. New Phytol. 2012, 196, 978–1000. [Google Scholar] [CrossRef] [Green Version]
- Chantreau, M.; Grec, S.; Gutierrez, L.; Dalmais, M.; Pineau, C.; Demailly, H.; Paysant-Leroux, C.; Tavernier, R.; Trouvé, J.P.; Chatterjee, M.; et al. PT-Flax (phenotyping and TILLinG of flax): Development of a flax (Linum usitatissimum L.) mutant population and TILLinG platform for forward and reverse genetics. BMC Plant Biol. 2013, 13, 159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, X.; Chen, J.; Bao, Y.; Liu, L.; Jiang, H.; An, X.; Dai, L.; Wang, B.; Peng, D. Transcript profiling reveals auxin and cytokinin signaling pathways and transcription regulation during in vitro organogenesis of ramie (Boehmeria nivea L. Gaud). PLoS ONE 2014, 9, e113768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Katz, K.; Shutov, O.; Lapoint, R.; Kimelman, M.; Brister, J.R.; O’Sullivan, C. The Sequence Read Archive: A decade more of explosive growth. Nucleic Acids Res. 2022, 50, D387–D390. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [Green Version]
- Bairoch, A.; Apweiler, R. The SWISS-PROT protein sequence data bank and its supplement TrEMBL in 1999. Nucleic Acids Res. 1999, 27, 49–54. [Google Scholar] [CrossRef]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotech. 2011, 29, 644–652. [Google Scholar] [CrossRef] [Green Version]
- Kanehisa, M.; Goto, S. KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
- Pruitt, K.D.; Tatusova, T.; Maglott, D.R. NCBI Reference Sequence (RefSeq): A curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 2005, 33, D501–D504. [Google Scholar] [CrossRef] [Green Version]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Kim, S.J.; Kim, M.R.; Bedgar, D.L.; Moinuddin, S.G.; Cardenas, C.L.; Davin, L.B.; Kang, C.; Lewis, N.G. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 2004, 101, 1455–1460. [Google Scholar] [CrossRef] [Green Version]
- Park, H.L.; Kim, T.L.; Bhoo, S.H.; Lee, T.H.; Lee, S.W.; Cho, M.H. Biochemical Characterization of the Rice Cinnamyl Alcohol Dehydrogenase Gene Family. Molecules 2018, 23, 2659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abraham, P.E.; Yin, H.; Borland, A.M.; Weighill, D.; Lim, S.D.; De Paoli, H.C.; Engle, N.; Jones, P.C.; Agh, R.; Weston, D.J.; et al. Transcript, protein and metabolite temporal dynamics in the CAM plant Agave. Nat. Plants 2016, 2, 16178. [Google Scholar] [CrossRef] [Green Version]
- Harkess, A.; Zhou, J.; Xu, C.; Bowers, J.E.; Van der Hulst, R.; Ayyampalayam, S.; Mercati, F.; Riccardi, P.; McKain, M.R.; Kakrana, A.; et al. The asparagus genome sheds light on the origin and evolution of a young Y chromosome. Nat. Commun. 2017, 8, 1279. [Google Scholar] [CrossRef]
- Amborella Genome Project. The Amborella genome and the evolution of flowering plants. Science 2013, 342, 1241089. [Google Scholar] [CrossRef]
- Rombel, I.T.; Sykes, K.F.; Rayner, S.; Johnston, S.A. ORF-FINDER: A vector for high-throughput gene identification. Gene 2002, 282, 33–41. [Google Scholar] [CrossRef]
- ProtParam Tool. Available online: web.expasy.org/protparam/ (accessed on 2 June 2022).
- Yu, C.S.; Chen, Y.C.; Lu, C.H.; Hwang, J.K. Prediction of protein subcellular localization. Proteins 2006, 64, 643–651. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- DNAMAN7. Available online: www.lynnon.com (accessed on 2 June 2022).
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 2011, 12, 323. [Google Scholar] [CrossRef] [Green Version]
- Mortazavi, A.; Williams, B.A.; Mccue, K.; Schaeffer, L.; Wold, B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods 2008, 5, 621–628. [Google Scholar] [CrossRef] [PubMed]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Zolfaghari, F.; Khosravi, H.; Shahriyari, A.; Jabbari, M.; Abolhasani, A. Hierarchical cluster analysis to identify the homogeneous desertification management units. PLoS ONE 2019, 14, e0226355. [Google Scholar] [CrossRef]
- Sadamoto, H.; Takahashi, H.; Okada, T.; Kenmoku, H.; Toyota, M.; Asakawa, Y. De novo sequencing and transcriptome analysis of the central nervous system of mollusc Lymnaea stagnalis by deep RNA sequencing. PLoS ONE 2012, 7, e42546. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Waititu, J.K.; Zhang, C.; Liu, J.; Wang, H. Plant Non-Coding RNAs: Origin, Biogenesis, Mode of Action and Their Roles in Abiotic Stress. Int. J. Mol. Sci. 2020, 21, 8401. [Google Scholar] [CrossRef] [PubMed]
- Chase, M.W.; Reveal, J.L.; Fay, M.F. A subfamilial classification for the expanded asparagalean families Amaryllidaceae, Asparagaceae and Xanthorrhoeaceae. Bot. J. Linn. Soc. 2009, 161, 132–136. [Google Scholar] [CrossRef] [Green Version]
- Liu, Q.; Luo, L.; Zheng, L. Lignins: Biosynthesis and Biological Functions in Plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef] [Green Version]
- Shang, H.; Zhang, N.; Xie, Z.; Deng, S.; Yi, L.; Huang, X. Genome-Wide Identification and Expression of the PIN Auxin Efflux Carrier Gene Family in Watermelon (Citrullus lanatus). Agriculture 2021, 11, 447. [Google Scholar] [CrossRef]
- Bottani, S.; Zabet, N.R.; Wendel, J.F.; Veitia, R.A. Gene Expression Dominance in Allopolyploids: Hypotheses and Models. Trends Plant Sci. 2018, 23, 393–402. [Google Scholar] [CrossRef]
Gene ID | Forward Primer | Reverse Primer | Product Size (bp) |
---|---|---|---|
CAD1 | TGAGATCACCGGCATAATCA | TCTGTCAGCAACCAGCATTC | 223 |
CAD2 | GACGCCTACTTGGTCAGCTC | GAACTGCATTGGCTGATTGA | 171 |
CAD3 | TTGCAGTCAAGTTTGGCAAG | TTGAGCAACTGCAGAATTGG | 214 |
CAD4 | TCAGTACAAGCGCATCCAAG | ACCCCACCAACTTTCAACAG | 181 |
CAD5 | CAAAAGAGAACGGGAAGCAG | TGCTGTGAAGGTCTGAGTGG | 183 |
CAD6 | TGGGATGAAGGTGACAGTGA | AAAAGATCAACGGCACAAGG | 182 |
CAD7 | TGTCACCGAAGTAGGCACTG | AATCCATAGGCAAGGTGTCG | 248 |
PP2A | CCTCCTCCTCCTTCGGTTTG | GCCATGAATGTCACCGCAGA | 235 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, X.; Xu, B.; Tan, S.; Huang, Y.; Xi, J.; Qin, X.; Chen, T.; Chen, H.; Yang, X.; Yi, K. Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species. Agriculture 2022, 12, 1003. https://doi.org/10.3390/agriculture12071003
Huang X, Xu B, Tan S, Huang Y, Xi J, Qin X, Chen T, Chen H, Yang X, Yi K. Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species. Agriculture. 2022; 12(7):1003. https://doi.org/10.3390/agriculture12071003
Chicago/Turabian StyleHuang, Xing, Bochao Xu, Shibei Tan, Yanlei Huang, Jingen Xi, Xu Qin, Tao Chen, Helong Chen, Xiaohan Yang, and Kexian Yi. 2022. "Transcriptome Sequencing of Agave angustifolia Reveals Conservation and Diversification in the Expression of Cinnamyl Alcohol Dehydrogenase Genes in Agave Species" Agriculture 12, no. 7: 1003. https://doi.org/10.3390/agriculture12071003