Changes in the Physiological Adaptation and Regulation Ability in Harmonia axyridis under Chlorpyrifos and Imidacloprid Stress

Abstract

As the dominant natural enemy of aphids, Harmonia axyridis plays a crucial role in integrated pest control (IPM) in agro-ecosystems. In order to study the physiological adaptation and regulation ability of Harmonia axyridis to insecticides under chemical pesticide stress, ladybirds were treated with organophosphorus chlorpyrifos (chlorpyrifos) and new nicotine imidacloprid (imidacloprid) to explore the physiological adaptability of ladybirds under chemical pesticide stress by activating trehalose metabolism. The results showed that the imidacloprid affect the larvae develop to pupate, resulted in the H. axyridis died and significantly increased the food consumption of Harmonia axyridis, while the chlorpyrifos prolong the development period of pupae significantly and decreased significantly the food intake of H. axyridis fed with aphids treated with chlorpyrifos. It was further found that Chlorpyrifos could inhibit the activity of the trehalase, while the trehalase activity increased under imidacloprid stress, but both insecticides could decrease the trehalose content. The TRE and TPS genes of Harmonia axyridis under chlorpyrifos and imidacloprid stress were upregulated or downregulated. These relevant results can provide a strong reference for the rational use of chemical pesticides or biological pesticides to control pests in the future.

1. Introduction

Harmonia axyridis (Pallas) is an important predatory natural enemy in agriculture and forestry [1]. H. axyridis can effectively control aphids, Crustacea, mealybugs, woodlice, mites, and the larvae or eggs of some lepidopteran and coleopteran pests. Meanwhile, as a common predatory species in Coccinellidae, it is known for its high feeding rate, massive oviposition, high resistance to adversity, wide distribution, and strong pest control ability. Therefore, it has good application prospects in biological control. Pest management usually depends on chemical insecticidal spray and the biological control of natural enemies in most agro-ecosystems. Chemical control is still the main and most effective intervention for pest control in China [2,3]. The concentration used to control pests is usually sufficient to kill 80% to 95% of the target pest population. The extensive use of pesticides may seriously damage natural enemies [4,5]. Pesticides have different lethal effects on the physiological and behavioral processes of these beneficial arthropods [6,7,8]. The use of pesticides even leads to the “3R” problem (resistance, resurgence, and residue). Due to the extensive use of chemical pesticides, the biological control of natural enemy insects has also been greatly threatened, so the coordination of the chemical and biological control of such insects has become a research hotspot.

Imidacloprid was first developed to effectively control the brown planthopper and is an important nenicotinic insecticide that was introduced in 1991 [9]. Neonicotine is a selective agonist of the nicotinic acetylcholine receptor (nAChR) in insects. NAChR is a pentacy cysteine cyclic-ligand-gated ion channel located in the central nervous system of insects, which provides farmers with valuable and effective methods to resist some of the most destructive crop pests in the world [10,11]. Although many insect species are still successfully controlled by neonicotine pesticides, their widespread use has put increasing selection pressure on their resistance, and in some species, pesticide resistance is a barrier to controlling the pest effectively. Chlorpyrifos is a broad-spectrum and efficient organophosphorus (OP) pesticide, which has been widely used in the control of leafhoppers, planthoppers, aphids, cotton bollworms, cabbage butterflies, and other pests in China [12,13]. These pesticides are the fastest growing and most powerful acetylcholinesterase (AChE) inhibitors in the early development phase. They phosphorylate the hydroxyl residues of AChE serine and inhibit the role of acetylcholinesterase at the synapses of neuromuscular junctions. In recent years, due to the limited use of the organophosphorus pesticide fipronil, chlorpyrifos has been used more widely and frequently in the field, and its effectiveness has declined, and even low to moderate chlorpyrifos resistance has been found in some field populations [14,15]. So far, most studies have focused on the efficiency of pest control using pesticides, and there is still a lack of physiological information on the long-term effects of insecticides on the natural enemy—ladybirds, such as changes in trehalose content, glucose content, and trehalase activity.

Trehalose as a non-reducing disaccharide is widely found in bacteria, algae, fungi, plants, and invertebrates [16]. Moreover, trehalose is regarded as ‘blood sugar’, since it is the primary carbohydrate substance in insects. It plays a key role in normal physiological processes, such as growth, development, and molting [17], and is an immediate source of energy and the main blood sugar in insects [18]. Trehalose is not only an energy storage substance that provides energy for the metabolism of organisms, but it is also a stress factor, which regulates the stress response through the expression of related genes [19,20]. Trehalose synthesis in insects and other invertebrates is thought to be carried out by trehalos-6-phosphatase (TPS) and trehalos-6-phosphatase (TPP) pathways [21,22]. There are two kinds of trehalose in insects, namely soluble trehalase (TRE1) and membrane-bound trehalase (TRE2). In insects, TRE2 is involved in several physiological processes such as flight, reproduction, development, and digestion [23,24].

These studies corroborate the fact that trehalose plays an important role in the physiological response of insects to growth and development. In recent years, a large number of studies have shown that insects, including H. axyridis, have diverse detoxification effects on pesticides. However, the roles of trehalose in the response of insects to environmental stresses such as pesticides are worthy of further study. In this study, we investigated changes in the physiological regulation of ladybirds under two pesticides stress, with the aim of providing fundamental data for chemical control, which is helpful to coordinate the relationship between biological control and the use of chemical pesticides.

2. Materials and Methods

2.1. Insects

Experimental populations of H. axyridis were collected from a wild field, reared, and maintained in a laboratory over a 6-year period. The populations were maintained at 25 ± 1 °C, 70% ± 5% relative humidity, and a 16:8 h (light/dark) photoperiod. Adult H. axyridis individuals and pea aphids were reared in an insect cage. The H. axyridis individuals fed on the pea aphids and the pea aphids fed on broad bean seedlings planted in the cage. New eggs were immediately transferred into another cage and were kept in the cage before developing to the late 3rd instar. Hundreds of the late 3rd instar individuals were placed in plastic tubes sealed with a sponge (ten individuals per tube). Specifically, treatments were divided into 5 groups after ladybirds developed to the 4th instar for 12 h: (i) control, involving 4th instar larvae with 12 h starvation + feeding on aphids; (ii) Ti-Ha (imidacloprid-treated H. axyridis individuals + common pea aphids), where the 4th instar H. axyridis individuals were drip-fed with imidacloprid and the common pea aphids were fed after 12 h starvation treatment; (iii) Ti-Ag (imidacloprid-treated pea aphids + common H. axyridis), where H. axyridis individuals were treated with 12 h starvation then fed pea aphids sprayed with imidacloprid; (iv) Tc-Ha (chlorpyrifos-treated H. axyridis individuals + common pea aphids), where the 4th instar H. axyridis individuals were drip-fed with chlorpyrifos and common pea aphids were fed after 12 h starvation treatment; (v) Tc-Ag (chlorpyrifos-treated pea aphids + common H. axyridis individuals), where H. axyridis individuals underwent starvation for 12 h then fed on chlorpyrifos-sprayed pea aphids. All treated ladybirds were collected for two parts of the experiment: one for observations of the phenotypic changes and developmental duration, whereby the aphids were fed regularly every day; the other for bioactivity detection and qPCR testing, where the treated ladybirds were collected and stored at –80 °C in a refrigerator.

2.2. Methods

2.2.1. Screening for the Effective concentrations of Imidacloprid and Chlorpyrifos and the Formal Experimental Concentration Design

The 4th instar ladybirds were selected to drip 0 ug/mL, 20 ug/mL, 100 ug/mL, and 500 ug/mL imidacloprid solutions. At the same time, 0 μg/mL, 0.002 μg/mL, 0.01 μg/mL, and 0.05 μg/mL chlorpyrifos solutions were used to drip on the 4th instar ladybirds, and the death of ladybirds at 12 h and 24 h after treatment was observed. The ladybirds were selected for the 4 concentrations of each solution, covering 0 to 100% mortality.

2.2.2. Phenotypes and Developmental Duration

The 4th instar ladybirds were selected from the treatment groups, and their food consumption, height, and developmental duration were determined.

(i).

Food consumption: The 4th instar ladybirds were placed in the tubes and starved for 12 h, then 20 pea aphids were added to feed the ladybirds. The numbers of pea aphids eaten by the ladybirds were recorded at 12 h and 24 h, and three replications per treatment were conducted, with 15 insects per treatment;

(ii).

Height and developmental duration: Insects were transferred into weighed Petri dishes and photographs were taken to record the morphological changes among the developmental phases. The time and weight of pupation, the time of emergence, and the weights of adults were also recorded.

(iii).

Phenotypic observation: Imidacloprid and chlorpyrifos treatments were conducted for 12 h, and the developmental phenotypes of experimental insects in different treatment groups were observed and photographed.

2.2.3. Determination of Trehalase Activity and Sugar Content

From the adults, three pieces of abdominal tissue were placed in a 1.5 mL Eppendorf tube. After adding 200 μL 20 mM phosphate-buffered saline (PBS, pH 6.0), the tissues were homogenized at 0 °C (TGrinder OSE-Y20 homogenizer, Tiangen Biotech Co., Beijing, China), followed by sonication for 30 s (VCX 130PB, Sonics, CO, USA). The homogenates were centrifuged at 12,000× g at 4 °C for 10 min after adding 800 μL PBS. The precipitates were removed, and aliquots of supernatant were assayed to determine the protein content using a protein dye binding method (Bio-Rad, Hangzhou, China) with bovine serum albumin as the standard. Then, 500 μL of supernatant was added to a 1.5 mL tube and boiled, after which the solution was centrifuged at 12,000× g for 10 min to remove any residual protein. The supernatants were processed for the measurement of trehalose. The trehalose content was estimated using a modified version of a protocol that was described previously [25]. A total of 50 μL of supernatant was put into a 1.5 mL tube, 50 μL 1% H₂SO₄ was added, and the tube was incubated in 90 °C water for 10 min to hydrolyze glycogen, after which it was cooled on ice for 3 min. Then, the supernatant was again incubated in 90 °C water for 10 min after the addition of 50 μL 30% potassium hydroxide solution to decompose the glucose. The supernatant then only contained trehalose without other carbohydrates or proteins. Next, four volumes of 0.2% (M/V) anthrone (Sigma, Shanghai, China) in 80% H₂SO₄ solution were added after it was cooled on ice for 3 min, then the supernatant was boiled for 10 min. After cooling, 200 μL of reaction solution was placed into a 96-well plate, and the absorbance at 620 nm was determined using a SpectraMax M5 (Molecular Device, CA, USA). The trehalose content was calculated based on a standard curve and compared to trehalose per gram of total protein. Finally, the result was expressed as mg trehalose per g total protein.

2.2.4. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR) Analysis

The total RNA was isolated from H. axyridis adults after cold induction and 1 μg total RNA was used for the synthesis of first-strand cDNA using the method described above. The expression levels of all known soluble trehalase genes from H. axyridis, including five TRE1 genes, two TRE2 genes, TPS (trehalose-6-phosphate synthase), GS (glycogen synthase), and GP (glycogen phosphorylase), were estimated via real-time PCR using a Bio-Rad CFX96™ system (Bio-Rad) and SsoFastTM EvaGreen^® Supermix (Bio-Rad). Then, real-time PCR was performed in a 20 μL total reaction volume containing 1 μL cDNA sample, 1 μL (10 μmol/μL) of each primer, 7 μL RNase-free and DNase-free water, and 10 μL SoFastTM EvaGreen^® Supermix. The primers were replaced with H₂O as negative controls and Harp49 (H. axyridis ribosomal protein 49 gene, AB552923) was used as an endogenous control. All primers for the ten trehalase genes of H. axyridis were designed to determine the expression levels of the corresponding homologous genes of the trehalose and chitin metabolism pathways for each pair of primers (

Table 1. Primers used for qRT-PCR determination of trehalose, glycogen, and TPS genes.

Primer	Forward Primer (5′–3′)	Reverse Primer (5′–3′)
RTHATREH1-1	CTTCGCCAGTCAAACGTCA	CCGTTTGGGACATTCCAGATA
RTHATREH1-2	TGACAACTTCCAACCTGGTAATG	TTCCTTCGAGACATCTGGCTTA
RTHATREH1-3	ACAGTCCCTCAGAATCTATCGTCA	GGAGCCAAGTCTCAAGCTCATC
RTHATREH1-4	TTACTGCCAGTTTGATGACCATT	CATTTCGCTAATCAGAAGACCCT
RTHATREH1-5	TGATGATGAGGTACGACGAGAA	GTAGCAAGGACCTAACAAACTGC
RTHATREH2-like	TTCCAGGTGGGAGATTCAGG	GGGATCAATGTAGGAGGCTGTG
RTHATREH2-2	CAATCAGGGTGCTGTAATGTCG	CGTAGTTGGCTCATTCGTTTCC
RTHATPS	GACCCTGACGAAGCCATACC	AAAGTTCCATTACACGCACCA
RTHAGP	GCTGAAGCCCTCTACCAACT	CGCCGTACTCGTATCTTATGC
RTHAGS	CCCTTAGGATCGGATGTTCTC	CACCAGCCATCTCCCAGTT
QHA-arp49-	GCGATCGCTATGGAAAACTC	TACGATTTTGCATCAACAGT

). The target amplification efficiency was the same as that of the reference amplification for each annealing temperature. The cycling parameters were 95 °C for 3 min for initial denaturation, followed by 40 cycles at 95 °C for 10 s and 56–62.5 °C for 30 s; a melting curve analysis at 65–95 °C was performed to ensure that only a single product was amplified. After amplification, a melting curve analysis was performed in triplicate, and the results were averaged. The values were calculated using three independent biological samples, and the 2−^△△CT method was used for the analysis of relative gene expression [26].

The PCR products were separated by electrophoresis on 1.0% agarose gels, and the cDNA fragments of interest were purified using a DNA gel extraction kit (OMEGA, Hangzhou, China). The purified DNA was ligated into the pMD18-T vector (TaKaRa) and sequenced using the dideoxy nucleotide method.

2.2.5. Statistical Analyses

The mRNA expression levels in the deionized water injection group were designated as the controls. All of the data obtained in this study are presented as the means ± standard errors (SEs) of 3–6 replicates and were analyzed using one-way analysis of variance (ANOVA) and Tukey’s test. p-values of <0.05 and 0.01 were considered significant or highly significant, respectively. An asterisk indicates a statistically significant difference in mRNA levels between the deionized water injection group and each of the validamycin injection groups measured at the same time (p < 0.05, t-test), and a double asterisk indicates a highly significant difference (p < 0.01, t-test).

3. Results

3.1. Developmental Duration and Phenotypic Changes of Ladybird

As the ladybirds and pea aphids were treated with different kinds of pesticides and fed with different methods, the development and phenotypic changes of ladybirds were observed. Figure 1 shows the Tc-Ha and Tc-Ag groups for ladybirds fed on the aphid treated with chlorpyrifos, which developed from the 4th instar larvae to the adult stage. The group that was exposed to the insecticide indirectly by feeding on aphids sprayed with imidacloprid in this experiment failed to pupate.

3.2. Effect of Food Consumption on Ladybirds

For the treatments with imidacloprid and chlorpyrifos, the number of aphids that the ladybirds ate increased in 12 h compared to the control group. The consumption rate of H. axyridis of 12.26 in Ti-Ha was extremely significantly different from the control (p < 0.01), and the consumption rate of 12.00 in Ti-Ag was significantly increased compared to the group (p < 0.05) (Figure 2). In contrast, the consumption of ladybirds decreased among those treated after 12–24 h. The consumption rate of ladybugs in Ti-Ag was 4.12, which was extremely different from the four treatments (Figure 2). Here, 24 h after treatment, the consumption rate of ladybirds increased significantly compared to 12 h, and the consumption rates of Ti-Ha and Tc-Ha increased significantly, reaching 18.73 (p < 0.05) and 19.80 (p < 0.01), respectively.

3.3. Single Average Weight and Developmental Duration (from Pupa to Adult) of Ladybirds

Figure 3a shows that the two insecticides affected the ladybirds’ individual weight as compared with the control group, although there was no significant difference in pupa and adult weights between Tc-Ha and Tc-Ag treatments. The weights increased significantly in the pupa and adult stages in the Ti-Ha group compared with the control. However, the Ti-Ag treatment could not pupate, and their weight was not recorded (Figure 3a). Figure 3b shows that the pupal stage of the Tc-Ag group was 6.8 days, which was significantly longer than the control (df = 14, q = 12.63, p < 0.05), while for Ti-Ha, Ti-Ag, and Tc-Ha treatments the respective erosion periods lasted 5.3, 0, and 5.15 days, which were not significantly different from the control group (Figure 3b).

3.4. Effect on TRE1 and TRE2 Enzyme Activity

When treated with different pesticides, the changes in TRE1 and TRE2 in ladybirds were different. The activity levels of TRE1 and TRE2 with Tc-Ha and Tc-Ag in ladybirds were 0.002356, 0.001095, and 0.008752, 0.0124, respectively, meaning they were significantly decreased compared to the control (0.089729, 0.0328) (p < 0.01) under chlorpyrifos stresses. These differences demonstrated that the ladybirds have obvious physiological responses to pesticide stress (Figure 4a,b). The activity levels of TRE1 and TRE2 in all groups of ladybirds treated with imidacloprid showed increased enzyme activities. Compared to the chlorpyrifos treatment, the activity changes in TRE1 and TRE2 were totally different under the imidacloprid stress. The activity level of TRE1 in Ti-Ag was 0.00107 under imidacloprid stress, which was significantly lower than in Ti-Ha. However, the activity changes in TRE2 were significantly increased both in Tc-Ha and Tc-Ag (0.0136, 0.012) compared to the control (0.00676) (p < 0.01) (Figure 4b).

3.5. Changes in Trehalose, Glucose, and Glycogen Contents in Ladybirds

When treated with the two pesticides, the trehalose content in ladybirds was 0.0219, and it was significantly decreased in Ti-Ag (p < 0.01) (Figure 5a), while the trehalose contents in Tc-Ha and Tc-Ag were 0.195 and 0.1615, respectively, being significantly decreased compared to the control (p < 0.05) (Figure 5a). According to the direct (Tc-Ha) or indirect (Tc-Ag) exposure to pesticides, the glucose levels in ladybirds treated with chlorpyrifos showed a significant increase or decrease (p < 0.05) (Figure 5b), and the glycogen content in Tc-Ag was significantly increased, while the rest showed no significant change (p < 0.01) (Figure 5c). The glucose content in Ti-Ha showed a significant increase (p < 0.05) (Figure 5c), while the glycogen content showed a decreasing trend but was not obvious in the Ti-Ag (Figure 5c).

3.6. Relative Expression Levels of Key Genes for Trehalase Metabolism in Ladybirds

The expression levels of several genes, including five TRE1 genes, two TRE2-like genes, TPS, GS, and GP, were measured via qRT-PCR. Compared with the control group, the expression levels of the TRE1 genes and TRE2 genes in the Ti-HA group were significantly different, of which the expression levels of TRE 1-3 (p < 0.05) and TRE 1-5 (p < 0.01) were significantly downregulated, but the expression levels of TRE 1-1, TRE 2-2, and TRE2-like were significantly upregulated (p < 0.01) (Figure 6a).

In the Ti-Ag group, all five TRE1 genes and two TRE2 genes were significantly downregulated, with TRE1-4, TRE1-5, and TRE2-2 genes being especially significantly downregulated (p < 0.01) (Figure 6a).

In the Tc-Ha group, the expression levels of all five TRE1 genes were downregulated, of which the expression levels of TRE1-1 and TRE1-4 genes were significantly downregulated (p < 0.01), and on the contrary, the expression levels of TRE1-3, TRE2-like and TRE2-2 genes were significantly upregulated compared with the control group (p < 0.01) (Figure 6a).

In the Tc-Ag group, the expression levels of all TRE1 and TRE2 genes were significantly upregulated, and all the other six genes were greatly significantly upregulated (p < 0.01) except TRE1-5 genes (p < 0.05).

There was no significant difference in TPS expression level between the four treatments and the control group, except that the expression level of TPS was significantly downregulated in the Tc-Ag group (p < 0.01) (Figure 6b), GP and GS genes showed similar responses to the 4 treatments, with significantly upregulated expression level in Ti-Ag group (p < 0.01) and significantly downregulated expression level in the other three groups (p < 0.01).

4. Discussion

The ladybird is an efficient predatory natural enemy that is widely used in agro-ecosystems for pest control. Imidacloprid and chlorpyrifos are also widely used in agro-ecosystems, and this leads to systems involving different feed spray pesticides and pesticide spraying on the bodies of the ladybirds, which affect their growth and development. Insecticide applications consistently result in pest resurgence for declining natural enemy populations. This study reveals the physiological and biochemical changes of the insecticides to the ladybird, thereby changing its growth and development process.

An interesting phenomenon was found in the experiment. After feeding on the aphids sprayed with imidacloprid, the H. axyridis did not enter the pupal stage and remained in the larval state until death; however, the H. axyridis dipped with imidacloprid successfully pupated and survived. Imidacloprid is a systematic insecticide with contact toxicity and gastric toxicity [27]. The food consumption results showed that the feeding amount of H. axyridis increased significantly under insecticide stress. As the aphids treated with imidacloprid fed on H. axyridis, leading to a large amount of imidacloprid accumulation in the body. So, its gastric toxicity was greatly enhanced, leading to its failure to enter the pupal stage. While the H. axyridis dipped with imidacloprid only tolerate contact toxicity, and as a result of the composition such as chitin in insect cuticle, leads to lowly contact toxicity. This indicated that pesticides may be more harmful to natural enemies than pests, and that more efficient pest control requires less use of pesticides. This is also true for beneficial insects such as bees. Makkapati found that with the increase in imidacloprid concentration, the average larval mortality of honeybees increased, and the average larval weight, average pupal weight, pupation rate, emergence rate, and developmental success rate decreased [28]. It was also observed that the food consumption and weight of H. axyridis individuals increased significantly after 12 h of treatment. Food is decomposed into soluble sugars glucose and trehalose in insects, which are finally converted into energy through metabolism. It was found that the glucose content and TRE1 activity of H. Axyridis also increased after the pesticide treatment. This indicates that the physiological mechanism of the pesticide detoxification of H. axyridis to insecticides is related to the accumulation of energy in the body. Previous studies also showed that crude fat and soluble sugar contents in nymphs and adults developed from nymphs feeding on rice plants treated with insecticides significantly increase compared with controls [29].

Sugars are not only necessary substances for the growth, development, and movement (flight) of insects, but are also important in insect detoxification. Trehalose is directly involved in the energy storage of H. axyridis and in the oxidative function of various physiological activities, thereby providing an energy source for its growth and development. When faced with a variety of adverse stresses, H. axyridis uses different strategies, releasing harmful exudates to expel natural enemies. Trehalase can decompose the important energy storage material and the stress metabolite trehalose in insects [30,31,32]. Differing from animals, insects firstly use trehalose to produce energy in response to various stresses by converting trehalose into glucose. In this study, the trehalose content in H. axyridis was significantly decreased and the TRE1 and TRE2 activities were significantly increased under the pesticide stress (Figure 5a,b). The results indicated that trehalose was decomposed and the activities of the two trehalose synthases were increased to maintain the trehalose content in response to pesticide stress. This strict control of trehalase regulates the concentration of trehalose, which is essential for normal function, through a phenomenon called enantiostasis, which ensures the maintenance and protection of the metabolism in response to environmental changes [32,33].

It was reported that the sustained expression and activity of TRE2 genes are necessary for the metabolism of hemolymph trehalose to meet the energy requirements of the midgut cells [34]. The results of this study found that the TRE1 and TRE2 gene expression levels were significantly upregulated in most of the ladybirds sprayed with pesticides, but significantly downregulated in ladybirds feeding on aphids treated with pesticides (Figure 6a). At the same time, the expression levels of TPS, GS, and GP genes in H. axyridis were significantly upregulated when sprayed with imidacloprid and significantly downregulated for the rest of the treatments.

In recent years, the physiological effects of insecticides on pests and their natural enemies have become an important index for the research and development of new pesticides. In the current study, H. axyridis food consumption increased, failure to develop to pupa and adjusted to the insecticides stress via accelerating the decomposition of trehalose into glucose, enhanced trehalase enzyme activity by regulating trehalose metabolism. The research can guide the scientific and rational use of pesticides and coordinate the comprehensive application of chemical and biological control, maintaining the important theoretical basis of agricultural ecosystem monitoring.