Augmentation of Performance, Carcass Trait, Biochemical Profile and Lipid Metabolism Concerning the Use of Organic Acidifier in Broiler Chickens
by
, , and
Kai Qiu
1
,
Zhimin Chen
1,
Aijuan Zheng
1,
Wenhuan Chang
1
,
Huiyi Cai
1,
Xin Zhang
2,* and
Guohua Liu
1,* 1
National Engineering Research Center of Biological Feed, Institute of Feed Research, Chinese Academy of Agricultural Sciences, Beijing 100081, China
2
State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing 100193, China
*
Authors to whom correspondence should be addressed.
Agriculture 2023, 13(9), 1765; https://doi.org/10.3390/agriculture13091765
Submission received: 1 August 2023
/
Revised: 27 August 2023
/
Accepted: 1 September 2023
/
Published: 6 September 2023
(This article belongs to the Section Farm Animal Production)
Abstract
:This study aimed to disclose the effects of a new compound organic acidifier mixing with L-malic acid and L-lactic acid on broiler production. A total of 1000 1-day-old Arbor acres broiler chicks were randomly divided into two treatments of 10 replicates each, with 50 birds per replicate. The feeding trial lasted for 42 days. The treatment group was offered 0.8% of the acidifier based on the control. The growth performance of the broiler chickens was improved by treatment. The broiler chickens in treatment had lower triglyceride but higher high-density lipoprotein content in serum. Superoxide dismutase activity, total antioxidant capacity and the concentrations of immunoglobulin A, complement 3 and lysozyme were increased in the serum of the broiler chickens, while the concentrations of interleukin-2 and tumor necrosis factor-α in the mucosa of jejunum were decreased by treatment. The expressions of AMPK, CD36, FABP1, MTTP and PPARα were increased but expressions of APOB100 and PCSK9 were decreased by treatment. In conclusion, the acidifier was effective at promoting broiler production, which was probably through the improved immunity, antioxidant and hepatic lipid metabolism capacities. The acidifier may be accelerating lipid metabolism in broiler chicken liver through regulating the expression of the genes related to fat metabolism.
1. Introduction
In the past, a variety of antimicrobial or/and growth-promoting antibiotics were widely used in poultry feed to improve economic efficiency [1]. An increasing number of resistant pathogenic microorganisms are emerging in antimicrobial abuse scenarios and are circulating between farm animals and humans [2]. Currently, resistant microorganisms and antibiotic residues in chicken have become an increasing threat to human beings [3]. With the growing demand for antibiotic-free foods, more and more countries and regions have begun to ban or restrict the inclusion of antibiotics in feed and reduce therapeutic antibiotics [4]. At present, exploring new feed additives to replace antibiotics in the broiler industry is the focus of further research, such as probiotics, prebiotics, organic acids and some bioactive substances [5].
Organic acids play a huge role in the maintenance of broiler health as an antibiotic substitute and additive [6]. The dietary inclusion of three kinds of organic acids products all benefit broiler chickens with a different mode of action [7]. Adding acidifiers to broiler feed could reduce damage caused by inflammation, prevent death caused by excessive gastrointestinal dysfunction and oxidative stress and increase performance [8,9]. Antibiotics accelerate the deposition of abdominal fat in broiler chickens [10], while the addition of acidifiers to feed reduces it, improves intestinal health, performance and meat quality [8,11,12]. Acidified drinking water could supplement stomach acid, restrain pathogenic bacteria and perfect broiler performance [13,14]. The acidifier benzoic acid can replace antibiotics to improve the growth performance, antioxidant properties, nutrient absorptivity and the intestinal flora of yellow-feathered broiler chickens [15]. Humic acid has shown important application value in increasing performance and ensuring health for farm animals [16]. The organic acid complex can effectively suppress Salmonella typhimurium infection and maintain the growth performance of broiler chickens [17]. Contaminated poultry meat is thought to be the primary origin of Campylobacter infection in humans, and the acidification of drinking water by adding organic acids has been demonstrated to reduce Campylobacter colonization in the intestine of broiler chickens [18,19]. Encapsulated essential oils mixed with organic acids can be used to substitute antibiotic growth promoters and have a significant impact on the growth performance and intestinal health of broilers with necrotic enteritis [20,21]. A microencapsulated blend of organic acids and essential oils in diets can enhance the meat quality of broiler chickens and prolong their shelf life [22]. Therefore, acidifiers are expected to replace antibiotics in terms of broiler growth performance, antioxidant capacity and gut health.
As an intermediate, malic acid is directly involved in the tricarboxylic acid (TCA) cycle of aerobic respiration, while lactic acid mainly comes from the glucose anaerobic metabolism in the body. In addition to meeting the energy needs of cells, lactic acid acts as a major signaling molecule to regulate cellular activity [23]. Both of these two organic acids are renewable and very promising chemicals with broad industrial applications, especially in the food, chemical, pharmacy, beverage and cosmetic industries. Tomato seed flour enriched with malic acid is a valuable food ingredient for scavenging free radicals, anti-inflammation and regulating the intestinal flora [24]. Bio-fermented malic acid benefits the muscle antioxidant capacity of broiler chickens to promote high-quality chicken production [25]. A mixture of lactic acid bacteria can be used as a potential strategy to reduce potential antibiotic use for protecting poultry farms from Salmonella contamination [26]. Above all, a new compound organic acidifier created by mixing L-malic acid and L-lactic acid is speculated to have good application potential in promoting broiler production. Therefore, this study was conducted to reveal the effects of the new compound organic acidifier on broiler chickens in terms of performance, carcass trait, immune and antioxidant capacity and lipid metabolism.
2. Materials and Methods
2.1. Test Additive and Experimental Design
The compound organic acidifier was obtained by mixing L-malic acid and L-lactic acid at the weight ratio of 1:1. Both of the organic acids were generated by microbial fermentation. In the present study, 1000 newborn Arbor acres (AA) broiler chicks with body weight (BW) of 47 ± 2.48 g were randomly assigned into 2 treatments of 10 replicates each, with 50 birds per replicate. The feeding period was 42 d, which was separated into 3 stages: 0~14 d, 15~28 d and 29~42 d. The control group (Ctrl) was fed a corn and soybean meal diet. The treatment group (COA) was offered the diet with an additional 0.8% compound organic acidifier. The basal diet was prepared with reference to the National Research Council 1994 and NY/T 33-2004 in conjunction with the AA Broiler Feeding Manual. The formula and nutrients of the basal diet are presented in Table 1. The diets were readied in the form of cold-pressed pellets.
2.2. Bird Management and Data Recording
The broiler chickens were housed in a three-level battery under an automatic controlled environment with humidity (50~80%) and light/dark (23:1 h). Ten birds were raised in one wire cage (120 × 100 × 48 cm). The ambient temperature was kept at 33 °C for 3 days, then decreased by 3 °C weekly until 24 °C. All of the broiler chicks were vaccinated with Marek’s disease at birth, and Newcastle disease and avian infectious bronchitis at 1 w of age. Birds were free to consume feed and water. The number of dead chickens per day and total feed intake for each replicate weekly were recorded. After 8 h fasting, the BW of each replicate was weighed on day 0, 21 and 42. Average daily feed intake (ADFI), death and culling rate (DCR), average daily gain (ADG) and feed conversion ratio (FCR, feed/gain) were calculated from the records.
2.3. Carcass Traits, Meat Quality and Sample Collection
At the end of the trial, in each replicate, one broiler close to their average BW was taken for slaughter, and the blood was collected from the heart after 8 h of fasting. Serum samples were obtained through the centrifugation of blood for 10 min at 3000× g and 4 °C, and kept at −20 °C [25]. Then, these selected broiler chickens were slaughtered and divided to measure carcass traits. The weight of the broiler without blood and feather divided by the live weight results in dressing percentage. Half- or full-eviscerated percentages of the broiler were obtained from their weight divided by the live weight of broiler chickens. The percentages of breast muscle, leg muscle and abdominal fat were calculated based on the full-eviscerated weight [25].
The middle of the left pectoralis major muscle was taken immediately after slaughter and the cuboid trimmed (30 × 15 × 5 mm). Then, one end of the meat sample was caught with iron wire, positioning the muscle fiber vertically up, weighted, and put it into a plastic bag with air. The meat sample was kept without it touching the wall of the bag, the bag mouth strapped, and hung at 4 °C for 1 d. Subsequently, the meat sample was taken out its surface gently dried with blotting paper. The dripping loss of the muscle samples was calculated from the records. The liver and mucosa of mid-jejunum were sampled and stored at −80 °C after quick-freezing in liquid nitrogen [25].
2.4. Quantitative Real-Time PCR Analysis
The mRNA samples were extracted from liver tissues using a HiPure Total RNA Mini Kit (Magen, Shanghai, China). Then, cDNA was obtained by reverse-transcription of mRNA with the help of a PrimeScriptTM RT reagent Kit containing gDNA Eraser (TaKaRa, Kyoto, Japan). RT-qPCR was conducted in an AJ qTOWER 2.2 Real-Time PCR system (Analytik Jena AG, Jena, Germany) with a quantitative real-time PCR (RT-qPCR) kit (TaKaRa). The primers (Table 2) using in the present study were designed by ourselves and their effectiveness was verified. Three parallel assays were measured per cDNA sample. The housekeeping gene was GAPDH. The relative mRNA expression of test genes was obtained using the 2−ΔΔCt method [27].
2.5. Detection Assays Utilizing Commercial Kits
As reported in our previous study [28], the content or activity of several chemical indexes in serum and jejunum mucosa were analyzed using commercial kits and strictly referring to their manuals (http://www.njjcbio.com/ accessed on 17 January 2023). All of the kits were bought from the Bioengineering Institute (Nanjing Jiancheng, Nanjing, China) and the product codes are listed in Table S1. The indexes measured in serum include high-density lipoprotein (HDL), very low-density-lipoprotein (VLDL), total cholesterol (TC), triglyceride (TG), aspartate aminotransferase (AST), total bilirubin (TBil), catalase (CAT), alanine aminotransferase (ALT), total superoxide dismutase (T-SOD), malondialdehyde (MDA), glutathione peroxidase (GSH-PX), total anti-oxidative capacity (T-AOC), immunoglobulin A (IgA), IgM, IgG, complement 3 (C3), C4 and lysozyme. The indexes analyzed in jejunum mucosa were interleukin-2 (IL-2), IL-6, tumor necrosis factor-α (TNF-α) and secretory immunoglobulin A (sIgA).
2.6. Statistical Analysis
Experimental data were organized by Excel 2019 and then analyzed using the t-test of SPSS software (v19.1). p < 0.05 was the threshold of statistical difference.
3. Results
3.1. Performance, Carcass Traits and Meat Quality
As shown in Table 3, the birth BW of broiler chickens between the two groups was not different. The average BW of broiler chickens on day 14, 28 and 42 in the COA was significantly (p < 0.05) increased relative to the Ctrl. The ADG of broiler chickens during weeks 1~2, 3~4 and 1~6 in the COA was greater (p < 0.05) than those in the Ctrl, while no difference was observed between the two groups for ADG during weeks 4~6. The ADFI of broiler chickens in the COA was markedly higher (p < 0.05) during weeks 3~4 relative to the Ctrl, while no difference existed during weeks 1~2, 4~6 and 1~6. The FCR of broiler chickens in the COA was lower (p < 0.05) than those in the Ctrl during weeks 1~2, 3~4 and 1~6, but no with difference observed for weeks 4~6. There were no differences between the two groups for the DCR of broiler chickens throughout the feeding trial.
The carcass traits of broiler chickens are shown in Table 4. No difference was found between the two groups for the percentage of dressing, half evisceration, full evisceration, abdominal fat, breast muscle and leg muscle of the broiler chickens. The dropping loss of breast muscle was observably (p < 0.05) decreased in the COA compared to the Ctrl.
3.2. Serum Indexes Related to Lipid Metabolism, Liver Health, Antioxidant Capacity, and Immunity
As shown in Table 5, the TG content in serum was lower (p < 0.05) in the COA than that in the Ctrl group. The broiler chickens in the COA had higher (p < 0.05) HDL content in serum that those in the Ctrl. There were no significant changes between the two groups for the content of TC, VLDL and TBil and the activities of AST and ALT in serum. The serum indexes reflecting the antioxidant capacity of broiler chickens were listed in Table 6. The activities of SOD and T-AOC in serum of the broiler chickens in the COA was significantly (p < 0.05) increased relative to the Ctrl. No significant differences were observed between the two groups for CAT and GSH-PX activities and MDA content in serum. Serum immunity is presented in Table 7. The contents of IgA, C3 and lysozyme in serum were impressively (p < 0.05) increased by dietary supplementation with acidifier. There was no difference between the two groups for the concentrations of IgM, IgG and C4 in the serum.
3.3. Jejunum Immunity
As shown in Table 8, the contents of inflammatory factors in the mucosa of jejunum were measured including IL-2, IL-6, TNF-α and sIgA. The concentrations of IL-2 and TNF-α were lower (p < 0.05) in the COA than those in the Ctrl. The results were similar between the two groups for the concentrations of IL-6 and sIgA.
3.4. Liver Lipid Metabolism
The relative mRNA expression of genes regulating the liver lipid metabolism of broiler chickens was presented in Figure 1, including acetyl-CoA carboxylase alpha (ACACA), protein kinase AMP-activated catalytic subunit alpha 1 (AMPK), apolipoprotein B (APOB100), CD36 molecule (CD36), fatty acid binding protein 1(FABP1), solute carrier family 27 member 5 (FATP5), lecithin-cholesterol acyltransferase (LCAT), microsomal triglyceride transfer protein (MTTP), proprotein convertase subtilisin/kexin type 9 (PCSK9) and peroxisome proliferator activated receptor alpha (PPARα). The expression of the housekeeping gene GAPDH was no different between the samples. The expressions of AMPK, CD36, FABP1, MTTP and PPARα were observably (p < 0.05) increased in the COA compared to the Ctrl. The liver of broiler chickens in the COA showed lower (p < 0.05) expressions of APOB100 and PCSK9 than those in the Ctrl. No difference between the two groups was found for the expressions of ACACA, FATP5 and LCAT in the liver of broiler chickens.
4. Discussion
L-malic acid and L-lactic acid have strong functional and nutritional properties universally as additives in the feed and food industries. The new acidifier made from lactic and malic acid is speculated to have a growth-promoting effect in broiler chickens and is worth verifying and revealing through feeding experiments.
At present, organic acids have been extensively studied to have antibacterial, immune-boosting and growth-promoting effects in broiler chickens [29]. The dietary addition of malic acid could facilitate the growth and body health of broiler chickens [25]. The functional components in fermented feed, including lactic acid bacteria, lactic acid and other organic acids, play the main role in improving the intestinal health and growth of broiler chickens [30]. An organic acids cocktail made from lactic-L plus formic-F acid in diets benefits the growth and body health of broiler chickens [31]. Organic acids could replace antibiotic growth promoters in the diets of broiler chickens during the finisher phase [32]. The potential of blended organic acids to improve the growth and health of broiler chickens infected with necrotic enteritis was demonstrated [33]. The beneficial effects of organic acids on broiler growth and meat quality were confirmed again in the present study. It could be deduced that the compound organic acidifier mixed with L-malic acid and L-lactic acid is a qualified candidate to improve broiler production.
Metabolic dysfunction-associated fatty liver disease not only seriously threatens human health, but also greatly limits economic profits in poultry industry [27]. The amounts of TC, TG, HDL and LDL in serum are commonly used indexes to reflect the body’s lipid metabolism, especially liver fat metabolism. The activities of AST, ALT and TBil in serum are often used as convenient indicators to assess liver health. The dietary supplementation of lactic acid has beneficial impacts on blood parameters and oxidative status [34]. In the present study, inclusion of compound organic acidifier in diets observably reduced TG content, elevated HDL content, and did not affect the activities of AST, ALT and TBil in serum. Therefore, we concluded that the compound organic acidifier is efficacious to improve hepatic lipid metabolism capacity without negative effects on the liver health of broiler chickens. It may be part of the explanation for the improved production performance of broiler chickens and their meat quality.
Multiple organic acids were demonstrated to have the potential to improve immunity and gut health in broiler chickens [29,30,35]. Malic acid in diets elevated the performance and health status of broiler chickens, probably by strengthening immunity and improving the structure of the cecal flora [25]. Lactic acid bacteria is a candidate used for the normal productive capacity of the broiler chickens to protect against aflatoxin B1 challenges in feeds [36]. In the current study, the compound organic acidifier obviously increased serum immunity and antioxidant capacities and decreased the contents of pro-inflammatory factors in jejunum of broiler chickens. Therefore, it shows that the acidifier used in this study is similar to the various acidifiers in previous studies and has the effect of improving the immunity and antioxidant capacity of broiler chickens, which may also be a way for acidifiers to promote broiler chickens’ health.
ACACA, an essential fatty acid synthesis rate-limiting enzyme in fatty acid metabolism, is a therapeutic target for the metabolic syndrome [37]. The increase of AMPK activity could suppress the synthesis of fatty acids and cholesterol and increase fatty acid oxidation and lipid breakdown to maintain the balance of lipid metabolism in the body [38]. Reductions in LDL-C and APOB100 were induced by the down-expression of TNF-α and PCSK9 after enzyme replacement therapy, an improvement in dyslipidemia [39]. CD36, located on the cell membrane, is a key regulator of lipid metabolism and a fatty acid sensor [40]. FABP1, also known as the fatty acid-binding protein, is a critical regulator of the hepatic lipid metabolism [41]. FATP5 participates in fatty acid transport and bile acid metabolism, whose knockout increases polyunsaturated lipids, leading to lipid peroxidation [42]. LCAT plays an important role in HDL metabolism and cholesterol reverse transport, and its increasing activity improves plasma lipid metabolism [43]. MTTP is an endoplasmic reticulum resident protein that is essential for the assembly and secretion of triglyceride–rich and apoB-containing lipoproteins [44]. PPARα activation, together with PPARβ/δ agonism, could improve non-alcoholic fatty liver disease and many PPARα target genes that are involved in fatty acid metabolism [45]. In the current study, for broiler chickens fed the compound organic acidifier, the expressions of genes that promote fat metabolism including AMPK, CD36, FABP1, MTTP and PPARα increased, and the expressions of inhibitory genes such as APOB100 and PCSK9 decreased in the liver. Therefore, it suggests that the compound organic acidifier is effective in promoting the liver lipid metabolism of broiler chickens.
5. Conclusions
The new compound organic acidifier mixed with L-malic acid and L-lactic acid was demonstrated to be effective in increasing growth performance and feed conversion efficiency in the broiler industry. The positive effects on the performance and meat quality of broiler chickens probably result from the improved immunity, antioxidant and hepatic lipid metabolism capacities of broiler chickens. The compound organic acidifier enhances the liver lipid metabolism of broiler chickens by increasing the expressions of genes that promote fat metabolism including AMPK, CD36, FABP1, MTTP and PPARα, and decreasing the expressions of inhibitory genes such as APOB100 and PCSK9.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture13091765/s1, Table S1: The information of commercial kits used for chemical analysis.
Author Contributions
Conceptualization and project administration were performed by G.L., X.Z. and K.Q. Animal experiment, chemical analysis and data collection were carried out by K.Q., Z.C. and A.Z. Original draft was prepared by K.Q. Writing—review was done by G.L., X.Z., W.C. and H.C. All authors have read and agreed to the published version of the manuscript.
Funding
This study was funded by the Beijing Municipal Natural Science Foundation (6214046), the Modern Agroindustry Technology Research System (CARS-41) and the Agricultural Science and Technology Innovation Program (ASTIP) of the Chinese Academy of Agricultural Sciences.
Institutional Review Board Statement
The present study was approved by the Animal Care and Use Committee of the Institute of Feed Research of the Chinese Academy of Agricultural Sciences (Approval ID: AEC-CAAS-20221127).
Data Availability Statement
The raw data of this article will be available without reservation upon contacting the corresponding author.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Gadde, U.; Kim, W.H.; Oh, S.T.; Lillehoj, H.S. Alternatives to antibiotics for maximizing growth performance and feed efficiency in poultry: A review. Anim. Health Res. Rev. 2017, 18, 26–45. [Google Scholar] [CrossRef]
- Neveling, D.P.; Dicks, L.M.T. Probiotics: An antibiotic replacement strategy for healthy broilers and productive rearing. Probiot. Antimicrob. Proteins 2021, 13, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Roth, N.; Käsbohrer, A.; Mayrhofer, S.; Zitz, U.; Hofacre, C.; Domig, K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: A global overview. Poult. Sci. 2019, 98, 1791–1804. [Google Scholar] [CrossRef] [PubMed]
- Andrew Selaledi, L.; Mohammed Hassan, Z.; Manyelo, T.G.; Mabelebele, M. The current status of the alternative use to antibiotics in poultry production: An african perspective. Antibiotics 2020, 9, 594. [Google Scholar] [CrossRef]
- Zhu, Q.; Sun, P.; Zhang, B.; Kong, L.; Xiao, C.; Song, Z. Progress on gut health maintenance and antibiotic alternatives in broiler chicken production. Front. Nutr. 2021, 8, 692839. [Google Scholar] [CrossRef]
- Dai, D.; Qiu, K.; Zhang, H.J.; Wu, S.G.; Han, Y.M.; Wu, Y.Y.; Qi, G.H.; Wang, J. Organic acids as alternatives for antibiotic growth promoters alter the intestinal structure and microbiota and improve the growth performance in broilers. Front. Microbiol. 2020, 11, 618144. [Google Scholar] [CrossRef]
- Sun, H.Y.; Zhou, H.B.; Liu, Y.; Wang, Y.; Zhao, C.; Xu, L.M. Comparison of organic acids supplementation on the growth performance, intestinal characteristics and morphology, and cecal microflora in broilers fed corn-soybean meal diet. Anim. Biosci. 2022, 35, 1689–1697. [Google Scholar] [CrossRef]
- Sun, Y.; Ni, A.; Jiang, Y.; Li, Y.; Huang, Z.; Shi, L.; Xu, H.; Chen, C.; Li, D.; Han, Y.; et al. Effects of replacing in-feed antibiotics with synergistic organic acids on growth performance, health, carcass, and immune and oxidative statuses of broiler chickens under clostridium perfringens type a challenge. Avian Dis. 2020, 64, 393–400. [Google Scholar] [CrossRef]
- Ateya, A.I.; Arafat, N.; Saleh, R.M.; Ghanem, H.M.; Naguib, D.; Radwan, H.A.; Elseady, Y.Y. Intestinal gene expressions in broiler chickens infected with Escherichia coli and dietary supplemented with probiotic, acidifier and synbiotic. Vet. Res. Commun. 2019, 43, 131–142. [Google Scholar] [CrossRef]
- Li, D.; Zhang, K.; Pan, Z.; Yu, M.; Lu, Y.; Wang, G.; Wu, J.; Zhang, J.; Zhang, K.; Du, W. Antibiotics promote abdominal fat accumulation in broilers. Anim. Sci. J. 2020, 91, e13326. [Google Scholar] [CrossRef]
- Gao, C.Q.; Shi, H.Q.; Xie, W.Y.; Zhao, L.H.; Zhang, J.Y.; Ji, C.; Ma, Q.G. Dietary supplementation with acidifiers improves the growth performance, meat quality and intestinal health of broiler chickens. Anim. Nutr. 2021, 7, 762–769. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, J.; Sharİf, M.; Suleman, M.N.; Saeed, M.; Ahamd, F.; Kamboh, A.A.; Ayaşan, T.; Arslan, M. Effect of dietary supplementation of a nonantibiotic growth promoter on growth performance and intestinal histomorphology in broilers. Pak. J. Zool. 2022, 54, 1629–1636. [Google Scholar] [CrossRef]
- Hamid, H.; Shi, H.Q.; Ma, G.Y.; Fan, Y.; Li, W.X.; Zhao, L.H.; Zhang, J.Y.; Ji, C.; Ma, Q.G. Influence of acidified drinking water on growth performance and gastrointestinal function of broilers. Poult. Sci. 2018, 97, 3601–3609. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Guo, Y.; Wang, Z.; Wang, Y.; Chen, B.; Du, P.; Zhang, X.; Huang, Y.; Li, P.; Michiels, J.; et al. Acidification of drinking water improved tibia mass of broilers through the alterations of intestinal barrier and microbiota. Anim. Biosci. 2022, 35, 902–915. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, Y.; Lin, X.; Gou, Z.; Fan, Q.; Ye, J.; Jiang, S. Potential effects of acidifier and amylase as substitutes for antibiotic on the growth performance, nutrient digestion and gut microbiota in yellow-feathered broilers. Animals 2020, 10, 1858. [Google Scholar] [CrossRef]
- Arif, M.; Alagawany, M.; Abd El-Hack, M.E.; Saeed, M.; Arain, M.A.; Elnesr, S.S. Humic acid as a feed additive in poultry diets: A review. Iran J. Vet. Res. 2019, 20, 167–172. [Google Scholar]
- Adhikari, P.; Yadav, S.; Cosby, D.E.; Cox, N.A.; Jendza, J.A.; Kim, W.K. Research Note: Effect of organic acid mixture on growth performance and Salmonella Typhimurium colonization in broiler chickens. Poult. Sci. 2020, 99, 2645–2649. [Google Scholar] [CrossRef]
- Lu, T.; Marmion, M.; Ferone, M.; Wall, P.; Scannell, A.G.M. On farm interventions to minimise Campylobacter spp. contamination in chicken. Br. Poult. Sci. 2021, 62, 53–67. [Google Scholar] [CrossRef]
- Peh, E.; Kittler, S.; Reich, F.; Kehrenberg, C. Antimicrobial activity of organic acids against Campylobacter spp. and development of combinations-A synergistic effect? PLoS ONE 2020, 15, e0239312. [Google Scholar] [CrossRef]
- Pham, V.H.; Abbas, W.; Huang, J.; He, Q.; Zhen, W.; Guo, Y.; Wang, Z. Effect of blending encapsulated essential oils and organic acids as an antibiotic growth promoter alternative on growth performance and intestinal health in broilers with necrotic enteritis. Poult. Sci. 2022, 101, 101563. [Google Scholar] [CrossRef]
- Sevim, B.; Gümüş, E.; Harman, H.; Ayasan, T.; Başer, E.; Altay, Y.; Akbulut, K. Effects of dietary rosemary essential oil on growth performance, carcass traits and some hematological values of chukar partridge. Turk. J. Agric. Food Sci. Technol. 2020, 8, 430–435. [Google Scholar] [CrossRef]
- Stamilla, A.; Russo, N.; Messina, A.; Spadaro, C.; Natalello, A.; Caggia, C.; Randazzo, C.L.; Lanza, M. Effects of microencapsulated blend of organic acids and essential oils as a feed additive on quality of chicken breast meat. Animals 2020, 10, 640. [Google Scholar] [CrossRef] [PubMed]
- Niu, D.; Wu, Y.; Lei, Z.; Zhang, M.; Xie, Z.; Tang, S. Lactic acid, a driver of tumor-stroma interactions. Int. Immunopharmacol. 2022, 106, 108597. [Google Scholar] [CrossRef] [PubMed]
- Choe, U.; Sun, J.; Wang, T.T.Y.; Rao, J.; Yu, L.L.; Gao, B.; Bailoni, E.; Chen, P.; Li, Y. Chemical composition of tomato seed flours, and their radical scavenging, anti-inflammatory and gut microbiota modulating properties. Molecules 2021, 26, 1478. [Google Scholar] [CrossRef] [PubMed]
- Qiu, K.; He, W.; Zhang, H.; Wang, J.; Qi, G.; Guo, N.; Zhang, X.; Wu, S. Bio-fermented malic acid facilitates the production of high-quality chicken via enhancing muscle antioxidant capacity of broilers. Antioxidants 2022, 11, 2309. [Google Scholar] [CrossRef]
- Kim, Y.J.; Youk, S.; Song, C.S. Effectiveness of administering a mixture of lactic acid bacteria to control Salmonella ser. Enteritidis infections in broilers. Animals 2022, 12, 374. [Google Scholar] [CrossRef]
- Qiu, K.; Zhao, Q.; Wang, J.; Qi, G.-H.; Wu, S.-G.; Zhang, H.-J. Effects of pyrroloquinoline quinone on lipid metabolism and anti-oxidative capacity in a high-fat-diet metabolic dysfunction-associated fatty liver disease chick model. Int. J. Mol. Sci. 2021, 22, 1458. [Google Scholar] [CrossRef]
- Qiu, K.; Wang, X.; Zhang, H.; Wang, J.; Qi, G.; Wu, S. Dietary supplementation of a new probiotic compound improves the growth performance and health of broilers by altering the composition of cecal microflora. Biology 2022, 11, 633. [Google Scholar] [CrossRef]
- Khan, R.U.; Naz, S.; Raziq, F.; Qudratullah, Q.; Khan, N.A.; Laudadio, V.; Tufarelli, V.; Ragni, M. Prospects of organic acids as safe alternative to antibiotics in broiler chickens diet. Environ. Sci. Pollut. Res. Int. 2022, 29, 32594–32604. [Google Scholar] [CrossRef]
- Sugiharto, S.; Ranjitkar, S. Recent advances in fermented feeds towards improved broiler chicken performance, gastrointestinal tract microecology and immune responses: A review. Anim. Nutr. 2019, 5, 1–10. [Google Scholar] [CrossRef]
- Al-Ghamdi, E.S. Growth performance, carcass characteristics, and blood biochemical indices of broilers affected by dietary organic acids blend’s supplementation. Anim. Biotechnol. 2022, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.; Singh, A.K.; Chen, X.; Lv, J.; Kim, W.K. Application of organic acids and essential oils as alternatives to antibiotic growth promoters in broiler chickens. Animals 2022, 12, 2178. [Google Scholar] [CrossRef] [PubMed]
- Kumar, A.; Toghyani, M.; Kheravii, S.K.; Pineda, L.; Han, Y.; Swick, R.A.; Wu, S.B. Potential of blended organic acids to improve performance and health of broilers infected with necrotic enteritis. Anim. Nutr. 2021, 7, 440–449. [Google Scholar] [CrossRef]
- Negm, M.H.; Aboul Ela, S.S.; Abd El-Hack, M.E. Does the use of lactic acid as an antibiotic substitute in broiler diets affect growth, carcass traits, blood indices and intestinal microbiota? Anim. Biotechnol. 2023, 34, 1163–1169. [Google Scholar] [CrossRef]
- Manvatkar, P.N.; Kulkarni, R.C.; Awandkar, S.P.; Chavhan, S.G.; Durge, S.M.; Avhad, S.R.; Channa, G.R.; Kulkarni, M.B. Performance of broiler chicken on dietary supplementation of protected organic acids blend. Br. Poult. Sci. 2022, 63, 633–640. [Google Scholar] [CrossRef]
- Liu, N.; Ding, K.; Wang, J.; Deng, Q.; Gu, K.; Wang, J. Effects of lactic acid bacteria and smectite after aflatoxin B(1) challenge on the growth performance, nutrient digestibility and blood parameters of broilers. J. Anim. Physiol. Anim. Nutr. 2018, 102, 953–961. [Google Scholar] [CrossRef]
- Chen, L.; Duan, Y.; Wei, H.; Ning, H.; Bi, C.; Zhao, Y.; Qin, Y.; Li, Y. Acetyl-CoA carboxylase (ACC) as a therapeutic target for metabolic syndrome and recent developments in ACC1/2 inhibitors. Expert Opin. Investig. Drugs 2019, 28, 917–930. [Google Scholar] [CrossRef]
- Fang, C.; Pan, J.; Qu, N.; Lei, Y.; Han, J.; Zhang, J.; Han, D. The AMPK pathway in fatty liver disease. Front. Physiol. 2022, 13, 970292. [Google Scholar] [CrossRef]
- Garside, B.; Ho, J.H.; Kwok, S.; Liu, Y.; Dhage, S.; Donn, R.; Iqbal, Z.; Jones, S.A.; Soran, H. Changes in PCSK 9 and apolipoprotein B100 in Niemann-Pick disease after enzyme replacement therapy with olipudase alfa. Orphanet J. Rare Dis. 2021, 16, 107. [Google Scholar] [CrossRef]
- Li, Y.; Huang, X.; Yang, G.; Xu, K.; Yin, Y.; Brecchia, G.; Yin, J. CD36 favours fat sensing and transport to govern lipid metabolism. Prog. Lipid Res. 2022, 88, 101193. [Google Scholar] [CrossRef]
- Rodriguez Sawicki, L.; Bottasso Arias, N.M.; Scaglia, N.; Falomir Lockhart, L.J.; Franchini, G.R.; Storch, J.; Córsico, B. FABP1 knockdown in human enterocytes impairs proliferation and alters lipid metabolism. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2017, 1862, 1587–1594. [Google Scholar] [CrossRef] [PubMed]
- Gao, Q.; Zhang, G.; Zheng, Y.; Yang, Y.; Chen, C.; Xia, J.; Liang, L.; Lei, C.; Hu, Y.; Cai, X.; et al. SLC27A5 deficiency activates NRF2/TXNRD1 pathway by increased lipid peroxidation in HCC. Cell Death Differ. 2020, 27, 1086–1104. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.; Wang, J.; Xiang, H.; Ding, P.; Wu, T.; Ji, G. LCAT- targeted therapies: Progress, failures and future. Biomed. Pharmacother. 2022, 147, 112677. [Google Scholar] [CrossRef] [PubMed]
- Peng, H.; Chiu, T.Y.; Liang, Y.J.; Lee, C.J.; Liu, C.S.; Suen, C.S.; Yen, J.J.; Chen, H.T.; Hwang, M.J.; Hussain, M.M.; et al. PRAP1 is a novel lipid-binding protein that promotes lipid absorption by facilitating MTTP-mediated lipid transport. J. Biol. Chem. 2021, 296, 100052. [Google Scholar] [CrossRef]
- Pawlak, M.; Lefebvre, P.; Staels, B. Molecular mechanism of PPARα action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J. Hepatol. 2015, 62, 720–733. [Google Scholar] [CrossRef]
Figure 1.
Effects of dietary inclusion of compound organic acidifier on relative mRNA expression of genes regulating liver lipid metabolism of broiler chickens. The housekeeping gene is GAPDH. * means significant difference (p < 0.05) between the two groups.
Figure 1.
Effects of dietary inclusion of compound organic acidifier on relative mRNA expression of genes regulating liver lipid metabolism of broiler chickens. The housekeeping gene is GAPDH. * means significant difference (p < 0.05) between the two groups.
Table 1.
Formula and nutrients of basal diet.
| Items | Day 1~14 | Day 15~28 | Day 29~42 |
|---|---|---|---|
| Ingredients, % | |||
| Corn | 58.20 | 58.70 | 61.00 |
| Soybean meal | 34.85 | 33.02 | 30.85 |
| Soybean oil | 2.54 | 4.48 | 4.72 |
| CaHPO4 | 2.27 | 2.00 | 1.82 |
| CaCO3 | 0.82 | 0.72 | 0.70 |
| NaCl | 0.35 | 0.35 | 0.35 |
| DL-Met | 0.34 | 0.26 | 0.20 |
| L-Lys·HCl | 0.31 | 0.15 | 0.04 |
| Premix 1 | 0.22 | 0.22 | 0.22 |
| Choline chloride (50%) | 0.10 | 0.10 | 0.10 |
| In total | 100.00 | 100.00 | 100.00 |
| Nutrient levels 2 | |||
| AME, MJ/kg | 12.35 | 12.97 | 13.18 |
| CP, % | 22.00 | 21.00 | 20.00 |
| Calcium, % | 1.00 | 1.00 | 0.90 |
| AP, % | 0.50 | 0.45 | 0.40 |
| Lys, % | 1.29 | 1.15 | 1.09 |
| Met, % | 0.55 | 0.52 | 0.48 |
| Met + Cys, % | 0.94 | 0.84 | 0.84 |
| Thr, % | 0.82 | 0.77 | 0.69 |
| Trp, % | 0.24 | 0.22 | 0.18 |
1 Premix offers the following ingredients in one kg of diets: VA, 12.500 IU; VD3, 2.500 IU; VK3, 2.65 mg; VB1, 2 mg; VB2, 6 mg; VB12, 0.025 mg; VE, 30 IU; biotin 0.0325 mg; folic acid, 1.25 mg; pantothenic acid, 12 mg; nicotinic acid, 50 mg; Cu, 8 mg; Zn, 75 mg; Fe, 80 mg; Mn, 100 mg; Se, 0.15 mg; I, 0.35 mg. 2 Are calculated values. AME, apparent metabolizable energy; Met, Methionine; Lys, Lysine; CP, Crude protein; AP, Available phosphorus; Cys, cysteine; Thr, Threonine; Trp, Tryptophan.
Table 2.
Primers used for the determination of mRNA expression of genes.
| Gene Name | Sequence (5′-3′) | Annealing Temperature (°C) | Product Size (bp) |
|---|---|---|---|
| ACACA | F: CCAGGCACAGTCTTTAGGGA | 60 | 208 |
| R: AATCTCGTTTCCTCCTGGCA | |||
| AMPK | F: CAAGCCCGCCAGATTCTTTT | 59 | 184 |
| R: CGACTCTGACTCCGTATCCC | |||
| APOB100 | F: AAATGTCCAAGGTGCAGCAG | 59 | 185 |
| R: CAATCAGCTTCCCGTTACCG | |||
| CD36 | F: ACACTGGGTAGCTGCAGAAT | 59 | 162 |
| R: GCTGCAGTCTTCCAAGCTTT | |||
| FABP1 | F: AAAGTACGAGCTCCAGTCCC | 61 | 227 |
| R: ACTTGGCCTTCTCTCCTGTC | |||
| FATP5 | F: GGGACCTTCAAGCAATGCAA | 59 | 158 |
| R: TACAGGTTGAGGCTCCCATC | |||
| GAPDH | F: AGCCATTCCTCCACCTTTGA | 61 | 190 |
| R: CAACAAAGGGTCCTGCTTCC | |||
| LCAT | F: TGTGGGAGGACATGAAGGAC | 59 | 184 |
| R: TCTGAGCTGCGTTTGTTGAC | |||
| MTTP | F: CCCATTAGCGTCGTGAAAGG | 59 | 174 |
| R: CCGGTTCTTGACGTTGGTTT | |||
| PCSK9 | F: GGTTGCTCCCTACTGTCCTT | 61 | 232 |
| R: CCAGCAGGTCCTTAACTCCA | |||
| PPARα | F: AGTGACCGCTCTACTTGACC | 61 | 250 |
| R: GATGCTGGTGAAAGGGTGTC |
Table 3.
Effects of dietary inclusion of compound organic acidifier on growth performance of broiler chickens.
Table 3.
Effects of dietary inclusion of compound organic acidifier on growth performance of broiler chickens.
| Ctrl | COA | SEM | p-Value | |
|---|---|---|---|---|
| Body Weight, g | ||||
| d 0 | 43.91 | 43.89 | 0.06 | 0.992 |
| d 14 | 537.48 | 561.14 | 13.45 | <0.001 |
| d 28 | 1704.44 | 1785.76 | 0.04 | <0.001 |
| d 42 | 3189.91 | 3250.06 | 0.09 | 0.040 |
| Weeks 1~2 | ||||
| ADG, g | 38.28 | 39.94 | 0.98 | <0.001 |
| ADFI, g | 43.65 | 43.14 | 1.05 | 0.144 |
| FCR, g/g | 1.14 | 1.08 | 0.01 | <0.001 |
| DCR, % | 0.01 | 0.01 | 0.02 | 0.609 |
| Weeks 3~4 | ||||
| ADG, g | 83.12 | 87.36 | 2.38 | <0.001 |
| ADFI, g | 122.12 | 127.13 | 2.82 | <0.001 |
| FCR, g/g | 1.47 | 1.46 | 0.02 | 0.035 |
| DCR, % | 0.02 | 0.02 | 0.03 | 0.818 |
| Weeks 5–6 | ||||
| ADG, g | 105.84 | 104.19 | 4.56 | 0.273 |
| ADFI, g | 181.86 | 182.09 | 5.24 | 0.896 |
| FCR, g/g | 1.72 | 1.75 | 0.06 | 0.121 |
| DCR, % | 0.03 | 0.03 | 0.04 | 0.617 |
| Weeks 1~6 | ||||
| ADG, g | 75.75 | 77.16 | 1.98 | 0.034 |
| ADFI, g | 115.88 | 117.45 | 2.51 | 0.061 |
| FCR, g/g | 1.44 | 1.43 | 0.02 | 0.031 |
| DCR, % | 0.05 | 0.06 | 0.05 | 0.427 |
Ctrl, the control group; COA, the compound organic acidifier group; ADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversion ratio; DCR, death and culling rate; SEM, standard error of means.
Table 4.
Effects of dietary inclusion of compound organic acidifier on carcass traits of broiler chickens.
Table 4.
Effects of dietary inclusion of compound organic acidifier on carcass traits of broiler chickens.
| Item, % | Ctrl | COA | SEM | p-Value |
|---|---|---|---|---|
| Dressing percentage | 91.73 | 91.75 | 0.61 | 0.969 |
| Half evisceration | 84.79 | 84.38 | 1.25 | 0.270 |
| Full evisceration | 77.95 | 77.60 | 1.34 | 0.373 |
| Abdominal fat | 1.49 | 1.48 | 0.59 | 0.875 |
| Breast muscle | 29.65 | 29.61 | 1.22 | 0.630 |
| Leg muscle | 29.49 | 29.64 | 1.41 | 0.980 |
| Dropping loss | 4.34 | 3.82 | 0.43 | 0.032 |
Ctrl, the control group; COA, the compound organic acidifier group; SEM, standard error of means.
Table 5.
Effects of dietary inclusion of compound organic acidifier on serum lipid metabolism and liver health of broiler chickens.
Table 5.
Effects of dietary inclusion of compound organic acidifier on serum lipid metabolism and liver health of broiler chickens.
| Ctrl | COA | SEM | p-Value | |
|---|---|---|---|---|
| TC, mmol/L | 2.98 | 3.05 | 0.55 | 0.803 |
| TG, mmol/L | 19.95 | 17.18 | 1.80 | 0.042 |
| HDL, mmol/L | 0.84 | 1.07 | 0.14 | 0.003 |
| VLDL, mmol/L | 0.65 | 0.58 | 0.13 | 0.280 |
| AST, U/L | 224.53 | 216.80 | 18.24 | 0.380 |
| ALT, U/L | 2.40 | 2.35 | 0.75 | 0.878 |
| TBil, μmol/L | 4.43 | 4.01 | 2.19 | 0.693 |
Ctrl, the control group; COA, the compound organic acidifier group; TC, total cholesterol; TG, triglyceride; HDL, high-density lipoprotein; VLDL, very-low-density lipoprotein; AST, aspartate aminotransferase; ALT, alanine aminotransferase; TBil, total bilirubin; SEM, standard error of means.
Table 6.
Effects of dietary inclusion of compound organic acidifier on serum antioxidant capacity of broiler chickens.
Table 6.
Effects of dietary inclusion of compound organic acidifier on serum antioxidant capacity of broiler chickens.
| Ctrl | COA | SEM | p-Value | |
|---|---|---|---|---|
| CAT, U/mL | 40.34 | 43.36 | 8.12 | 0.457 |
| SOD, U/mL | 69.75 | 77.33 | 6.47 | 0.026 |
| GSH-PX, U/mL | 427.08 | 390.27 | 53.48 | 0.162 |
| T-AOC, U/mL | 5.36 | 6.46 | 1.03 | 0.043 |
| MDA, nmol/mL | 4.69 | 4.46 | 0.94 | 0.607 |
Ctrl, the control group; COA, the compound organic acidifier group; CAT, catalase; GSH-PX, glutathione peroxidase; T-AOC, total anti-oxidative capacity; MDA, malondialdehyde; SEM, standard error of means.
Table 7.
Effects of dietary inclusion of compound organic acidifier on serum immunity of broiler chickens.
Table 7.
Effects of dietary inclusion of compound organic acidifier on serum immunity of broiler chickens.
| Ctrl | COA | SEM | p-Value | |
|---|---|---|---|---|
| IgA, g/L | 1.45 | 1.88 | 0.42 | 0.042 |
| IgM, g/L | 1.50 | 1.41 | 0.39 | 0.600 |
| IgG, g/L | 3.75 | 4.13 | 0.43 | 0.078 |
| C3, g/L | 0.51 | 0.61 | 0.06 | 0.049 |
| C4, g/L | 0.07 | 0.07 | 0.02 | 0.398 |
| Lysozyme, mg/L | 3.54 | 4.12 | 0.27 | 0.026 |
Ctrl, the control group; COA, the compound organic acidifier group; IgA/M/G, immunoglobulin A/M/G; C3/4, complement 3/4; SEM, standard error of means.
Table 8.
Effects of dietary inclusion of compound organic acidifier on jejunum immunity of broiler chickens.
Table 8.
Effects of dietary inclusion of compound organic acidifier on jejunum immunity of broiler chickens.
| Ctrl | COA | SEM | p-Value | |
|---|---|---|---|---|
| IL-2, ng/mL | 5.28 | 3.31 | 0.54 | 0.034 |
| IL-6, ng/mL | 0.67 | 0.74 | 0.16 | 0.713 |
| TNF-α, ng/mL | 1.84 | 1.33 | 0.21 | 0.027 |
| sIgA, µg/mL | 31.92 | 33.47 | 5.28 | 0.419 |
Ctrl, the control group; COA, the compound organic acidifier group; IL-2/6, interleukin 2/6; TNF-α, tumor necrosis factor-α; sIgA, secretory immunoglobulin A; SEM, standard error of means.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Qiu, K.; Chen, Z.; Zheng, A.; Chang, W.; Cai, H.; Zhang, X.; Liu, G. Augmentation of Performance, Carcass Trait, Biochemical Profile and Lipid Metabolism Concerning the Use of Organic Acidifier in Broiler Chickens. Agriculture 2023, 13, 1765. https://doi.org/10.3390/agriculture13091765
AMA Style
Qiu K, Chen Z, Zheng A, Chang W, Cai H, Zhang X, Liu G. Augmentation of Performance, Carcass Trait, Biochemical Profile and Lipid Metabolism Concerning the Use of Organic Acidifier in Broiler Chickens. Agriculture. 2023; 13(9):1765. https://doi.org/10.3390/agriculture13091765
Chicago/Turabian StyleQiu, Kai, Zhimin Chen, Aijuan Zheng, Wenhuan Chang, Huiyi Cai, Xin Zhang, and Guohua Liu. 2023. "Augmentation of Performance, Carcass Trait, Biochemical Profile and Lipid Metabolism Concerning the Use of Organic Acidifier in Broiler Chickens" Agriculture 13, no. 9: 1765. https://doi.org/10.3390/agriculture13091765
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
