A Study on the Characteristics of Nitrification and Denitrification of Three Small Watersheds During the Wet and Dry Seasons with Various Sources of Pollution: A Case Study of the Jinjing Basin
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Processing
2.1.1. Water Sample Collection and Pretreatment
2.1.2. Sediment Collection and Pretreatment
2.2. Determination of Potential Rates of Nitrification and Denitrification
2.2.1. Potential Nitrification Rate (PNR)
2.2.2. Potential Denitrification Rate (PDNR)
2.3. DNA Extraction and Real-Time Fluorescence Quantification
2.4. Statistical Analysis
3. Results
3.1. Microbial Activities of Nitrification and Denitrification of Sediment in Small Watershed
3.2. Gene Abundance of Microorganisms for Nitrification and Denitrification in Sediment of Small Watershed
3.3. Analysis of Influencing Factors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- US Environmental Protection Agency (EPA). Sources and Solutions: Agriculture. 2023. Available online: https://www.epa.gov/nutrientpollution/sources-and-solutions-agriculture (accessed on 15 December 2024).
- European Environment Agency (EEA). Agricultural land: Nitrogen balance. EEA Report No. 11/2019. Available online: https://www.eea.europa.eu/airs/2018/natural-capital/agricultural-land-nitrogen-balance (accessed on 15 December 2024).
- Bao, L.L.; Chen, Y.J.; Wang, X.Y. Ecological characteristics of major microorganisms in nitrogen cycling in river sediments. Microbiol. Bull. 2015, 42, 1141–1150. [Google Scholar]
- Kim, H.; Bae, H.S.; Reddy, K.R.; Ogram, A. Distributions, abundances and activities of microbes associated with the nitrogen cycle in riparian and stream sediments of a river tributary. Water Res. 2016, 106, 51–61. [Google Scholar] [CrossRef] [PubMed]
- Deng, D.; Yang, Z.; Yang, Y.; Wan, W.; Liu, W.; Xiong, X. Metagenomic insights into nitrogen-cycling microbial communities and their relationships with nitrogen removal potential in the Yangtze River. Water Res. 2024, 265, 122229. [Google Scholar] [CrossRef] [PubMed]
- Hou, L.; Zheng, Y.; Liu, M.; Li, X.; Lin, X.; Yin, G.; Gao, J.; Deng, F.; Chen, F.; Jiang, X. Anaerobic ammonium oxidation and its contribution to nitrogen removal in China’s coastal wetlands. Sci. Rep. 2015, 5, 15621. [Google Scholar] [CrossRef]
- Han, P.; Tang, X.; Koch, H.; Dong, X.; Hou, L.; Wang, D.; Zhao, Q.; Li, Z.; Liu, M.; Lücker, S.; et al. Unveiling unique microbial nitrogen cycling and nitrification driver in coastal Antarctica. Nat. Commun. 2024, 15, 3143. [Google Scholar] [CrossRef]
- Guo, L.; Ma, K. Seasonal dynamics of nitrogen and phosphorus in water and sediment of a multi-level ditch system in Sanjiang Plain, Northeast China. Chin. Geogr. Sci. 2011, 21, 437–445. [Google Scholar] [CrossRef]
- Wang, C.; Liu, J.; Wang, Z.; Pei, Y. Nitrification in lake sediment with addition of drinking water treatment residuals. Water Res. 2014, 56, 234–245. [Google Scholar] [CrossRef]
- Deng, D.; He, G.; Yang, Z.; Xiong, X.; Liu, W. Activity and community structure of nitrifiers and denitrifiers in nitrogen-polluted rivers along a latitudinal gradient. Water Res. 2024, 254, 121317. [Google Scholar] [CrossRef]
- Wang, M.; Jiang, T.; Mao, Y.; Wang, F.; Yu, J.; Zhu, C. Current Situation of Agricultural Non-Point Source Pollution and Its Control. Water Air Soil. Pollut. 2023, 234, 471. [Google Scholar] [CrossRef]
- Wang, X.; Li, Y.; Ciampitti, I.A.; He, P.; Xu, X.; Qiu, S.; Zhao, S. Response of soil denitrification potential and community composition of denitrifying bacteria to different rates of straw return in north-central China. Appl. Soil. Ecol. 2022, 170, 104312. [Google Scholar] [CrossRef]
- Suzuki, M.T.; Taylor, L.T.; Delong, E.F. Quantitative analysis of small-subunit rRNA genes in mixed microbial populations via 5′-nuclease assays. Appl. Environ. Microbiol. 2000, 66, 4605–4614. [Google Scholar] [CrossRef] [PubMed]
- Witzel, K.; Rotthauwe, J. The ammonia monooxygenase structural gene amoA as a functional marker: Molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl. Environ. Microbiol. 1997, 63, 4704–4712. [Google Scholar]
- Tourna, M.; Freitag, T.E.; Nicol, G.W.; Prosser, J.I. Growth, activity and temperature responses of ammonia-oxidizing archaea and bacteria in soil microcosms. Environ. Microbiol. 2008, 10, 1357–1364. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Liu, J.; Zhang, X.; Liu, D.; Shi, Y.; Yuan, J.; Lu, M. Molecular detection of denitrifying bacteria in paddy soils: Development of primers and T-RFLP analysis. Appl. Soil. Ecol. 2010, 46, 143–150. [Google Scholar]
- Throback, I.N.; Enwall, K.; Jarvis, A.; Hallin, S. Reassessing PCR primers targeting nirS, nirK and nosZ genes for community surveys of denitrifying bacteria with DGGE. Fems Microbiol. Ecol. 2004, 49, 401–417. [Google Scholar] [CrossRef]
- Henry, S.; Baudoin, E.; Lopez-Gutierrez, J.C.; Martin-Laurent, F.; Brauman, A.; Philippot, L. Quantification of denitrifying bacteria in soils by nirK gene targeted real-time PCR. J. Microbiol. Methods 2004, 59, 327–335. [Google Scholar] [CrossRef]
- Yang, N.; Zhang, C.; Wang, L.; Li, Y.; Zhang, W.; Niu, L.; Zhang, H.; Wang, L. Nitrogen cycling processes and the role of multi-trophic microbiota in dam-induced river-reservoir systems. Water Res. 2021, 206, 117730. [Google Scholar] [CrossRef]
- Wang, Y.; Li, Y.; Zhang, X.; Shi, Z. Spatial variability and environmental controls on nitrification and denitrification in the Jinjing River Basin. Ecol. Eng. 2016, 96, 12–20. [Google Scholar]
- Strauss, E.A.; Lamberti, G.A.; Vaughn, C.C. Nitrification and denitrification in streams: Role of organic matter and environmental factors. Can. J. Fish. Aquat. Sci. 2002, 59, 552–563. [Google Scholar]
- Vogeler, I.; Vachey, A.; Deurer, M.; Bolin, N. Impact of plants on the microbial activity in soils with high and low levels of copper. Eur. J. Soil. Biol. 2008, 44, 92–100. [Google Scholar] [CrossRef]
- Zhang, M.; Daraz, U.; Sun, Q.; Chen, P.; Wei, X. Denitrifier abundance and community composition linked to denitrification potential in river sediments. Environ. Sci. Pollut. Res. 2021, 28, 51928–51939. [Google Scholar] [CrossRef] [PubMed]
- Groffman, P.M.; Dorsey, A.M.; Mayer, P.M. N processing within geomorphic structures in urban streams. J. N. Am. Benthol. Soc. 2005, 24, 613–625. [Google Scholar] [CrossRef]
- Li, R.Z.; Zheng, X.; Gao, S.D.; Ye, J. Analysis of nitrification and denitrification potential in stream sediments under anthropogenic disturbance. Environ. Sci. 2017, 38, 4598–4606. [Google Scholar]
- Yang, D.; Wang, D.; Chen, S.; Ding, Y.; Gao, Y.; Tian, H.; Cai, R.; Yu, L.; Deng, H.; Chen, Z. Denitrification in urban river sediment and the contribution to total nitrogen reduction. Ecol. Indic. 2021, 120, 106960. [Google Scholar] [CrossRef]
- Li, Z.; Tang, Z.; Song, Z.; Chen, W.; Tian, D.; Tang, S.; Wang, X.; Wang, J.; Liu, W.; Li, J.; et al. Variations and controlling factors of denitrification rate in soils. Glob. Chang. Biol. 2021, 27, 2896–2908. [Google Scholar] [CrossRef]
- Liu, S.; Shen, L.; Lou, L.; Tian, G.; Zheng, P.; Hu, B. Spatial distribution and factors shaping the niche segregation of ammonia-oxidizing microorganisms in the Qiantang River, China. Appl. Environ. Microbiol. 2013, 79, 4065–4071. [Google Scholar] [CrossRef]
- Liu, Z.; Huang, S.; Sun, G.; Xu, Z.; Xu, M. Diversity and abundance of ammonia-oxidizing archaea in the Dongjiang River, China. Microbiol. Res. 2011, 166, 337–345. [Google Scholar] [CrossRef]
- Yang, Y.; Gao, Y.; Huang, X.; Ni, P.; Wu, Y.; Deng, Y.; Zhan, A. Adaptive shifts of bacterioplankton communities in response to nitrogen enrichment in a highly polluted river. Environ. Pollut. 2019, 245, 290–299. [Google Scholar] [CrossRef]
- Xu, T.; Shen, Y.; Ding, Z.; Zhu, B. Seasonal dynamics of microbial communities in rhizosphere and bulk soils of two temperate forests. Rhizosphere 2023, 25, 100673. [Google Scholar] [CrossRef]
- Verhamme, D.T.; Prosser, J.I.; Nicol, G.W. Ammonia concentration determines differential growth of ammonia-oxidising archaea and bacteria in soil microcosms. ISME J. 2011, 5, 1067–1071. [Google Scholar] [CrossRef]
- Kits, K.D.; Sedlacek, C.J.; Lebedeva, E.V.; Han, P.; Bulaev, A.; Pjevac, P.; Daebeler, A.; Romano, S.; Albertsen, M.; Stein, L.Y.; et al. Kinetic analysis of a complete nitrifier reveals an oligotrophic lifestyle. Nature 2017, 549, 269–272. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Han, S.; Lee, D.J. Genomic studies on natural and engineered aquatic denitrifying eco-systems: A research update. Bioresour. Technol. 2021, 326, 124740. [Google Scholar] [CrossRef] [PubMed]
- Ligi, T.; Truu, M.; Truu, J.; Nõlvak, H.; Kaasik, A.; Kaasik, W.J.; Mander, Ü. Effects of soil chemical characteristics and water regime on denitrification genes (nirS, nirK, and nosZ) abundances in a created riverine wetland complex. Ecol. Eng. 2014, 72, 47–55. [Google Scholar] [CrossRef]
- Mosier, A.C.; Francis, C.A. Denitrifier abundance and activity across the San Francisco Bay estuary. Environ. Microbiol. Rep. 2010, 2, 667–676. [Google Scholar] [CrossRef]
- Garcia-Lledo, A.; Vilar-Sanz, A.; Trias, R.; Hallin, S.; Bañeras, L. Genetic potential for N2O emissions from the sediment of a free water surface constructed wetland. Water Res. 2011, 45, 5621–5632. [Google Scholar] [CrossRef]
- Song, Y.-N.; Lin, Z.-M.; Yan, L. Response of denitrifying bacteria community structure and abundance to nitrogen in paddy fields. Chin. J. Eco. Agric. 2021, 20, 7–12. [Google Scholar] [CrossRef]
- Fan, M.; Shibata, H. Simulation of watershed hydrology and stream water quality under land use and climate change scenarios in Teshio River watershed, northern Japan. Ecol. Indic. 2015, 50, 79–89. [Google Scholar] [CrossRef]
- Hou, J.; Song, C.; Cao, X.; Zhou, Y. Shifts between ammonia-oxidizing bacteria and archaea in relation to nitrification potential across trophic gradients in two large Chinese lakes (Lake Taihu and Lake Chaohu). Water Res. 2013, 47, 2285–2296. [Google Scholar] [CrossRef]
- Wang, Z.H.; Li, S.X. Nitrate N loss by leaching and surface runoff in agricultural land: A global issue (a review). Adv. Agron. 2019, 156, 159–217. [Google Scholar]
- Sun, W.; Xia, C.; Xu, M.; Guo, J.; Wang, A.; Sun, G. Distribution and abundance of archaeal and bacterial ammonia oxidizers in the sediments of the Dongjiang River, a drinking water supply for Hong Kong. Microbes Environ. 2013, 28, 457–465. [Google Scholar] [CrossRef]
Gene | Primers | Primer Sequence | Data Source |
---|---|---|---|
16S rRNA | 1369F | CGGTGAATACGTTCYCGG | [13] |
1492R | GGWTACCTTGTTACGACT | ||
AOB amoA | amoA-1F | GGGGTTTCTACTGGTGGT | [14] |
amoA-2R | CCCCTCKGSAAAGCCTTCTTC | ||
AOA amoA | 23F | ATGGTCTGGCTWAGACG | [15] |
616R | GCCATCCATCTGTATGTCCA | ||
narG | narG-517F | CCGATYCCGGCVAT-GTCSAT | [16] |
narG-773R | GGNACGTTNGADCCCCA | ||
nirS | nirS-cd3aF | GTSAACGTSAAGGARACSGG | [17] |
nirS-R3cd | GASTTCGGRTGSGTCTTGA | ||
nirK | nirK-876F | ATYGGCGGVCAYGGCGA | [18] |
nirK-1040R | GCCTCGATCAGRTTRTGGTT |
Location | Site | PNR (μg·kg−1·h−1) | PDNR (mg·kg−1·h−1) | ||
---|---|---|---|---|---|
Wet Season | Dry Season | Wet Season | Dry Season | ||
Jinjing River (residential area) | A1 | 6.21 | 3.14 | 0.28 | 0.51 |
A2 | 4.56 | 4.32 | 1.15 | 1.01 | |
A3 | 0.43 | 4.12 | 1.02 | 1.04 | |
Guanjia River (woodland) | B1 | 4.19 | 3.85 | 0.78 | 0.73 |
B2 | 0.38 | 0.27 | 0.32 | 0.33 | |
B3 | 5.32 | 4.92 | 0.22 | 0.24 | |
Guanjia River sub-stream | D1 | 5.37 | 4.92 | 0.98 | 0.53 |
D2 | 0.32 | 0.27 | 0.72 | 0.13 | |
D3 | 1.29 | 1.47 | 0.62 | 0.17 | |
Tuojia River (farmland) | C1 | 39.7 | 4.06 | 3.25 | 2.71 |
C2 | 11.2 | 2.58 | 1.73 | 0.57 | |
C3 | 2.30 | 3.39 | 0.39 | 0.12 | |
Tuojia River sub-stream | E1 | 14.1 | 0.48 | 2.89 | 0.21 |
E2 | 6.93 | 1.31 | 1.36 | 0.25 | |
E3 | 5.84 | 2.78 | 2.36 | 1.13 |
Environmental Factor | PNR | PDNR | |
---|---|---|---|
Waterbody | NH4+-N | 0.733 ** | −0.088 |
NO3--N | −0.153 | 0.647 ** | |
TN | −0.216 | 0.379 * | |
TP | −0.047 | 0.358 * | |
DOC | 0.362 * | 0.287 | |
T | 0.429 * | 0.267 | |
DO | 0.294 | −0.352 * | |
pH | −0.214 | −0.136 | |
Eh | 0.157 | 0.214 | |
Sediment | NH4+-N | 0.070 | 0.035 |
NO3−-N | −0.158 | 0.111 | |
TN | 0.439 * | 0.712 ** | |
SOM | 0.605 ** | 0.792 ** | |
DOC | 0.269 | 0.029 | |
pH | −0.213 | −0.416 * |
16S rRNA | AOA | AOB | nirS | nirK | narG | ||
---|---|---|---|---|---|---|---|
Sediment | NH4+-N | −0.071 | 0.231 | 0.335 | 0.062 | 0.159 | 0.171 |
NO3−-N | −0.035 | −0.057 | −0.012 | −0.139 | −0.078 | 0.011 | |
TN | 0.632 ** | −0.193 | −0.179 | 0.399 * | 0.303 | 0.103 | |
SOM | 0.601 ** | −0.140 | −0.099 | 0.394 * | 0.339 | 0.178 | |
DOC | −0.065 | −0.221 | −0.275 | −0.104 | −0.091 | −0.345 | |
pH | −0.623 ** | −0.326 | −0.205 | −0.155 | −0.111 | −0.178 | |
PNR | −0.007 | −0.052 | −0.018 | 0.161 | 0.001 | 0.237 | |
PDNR | 0.581 ** | −0.133 | −0.053 | 0.405 * | 0.405 * | 0.332 | |
Waterbody | NH4+-N | 0.251 | −0.381 * | 0.376 * | 0.478* | 0.347 | 0.030 |
NO3−-N | 0.005 | 0.039 | 0.235 | 0.103 | 0.173 | 0.074 | |
TN | 0.250 | −0.020 | 0.090 | 0.494 ** | 0.468 * | 0.173 | |
TP | 0.322 | 0.105 | 0.143 | 0.250 | 0.373 | 0.147 | |
DOC | 0.120 | 0.064 | 0.313 | 0.145 | 0.285 | 0.249 | |
T | 0.089 | 0.326 | 0.399 * | 0.399 * | 0.408 * | 0.671 ** | |
DO | −0.160 | −0.294 | 0.412 * | −0.194 | −0.240 | −0.492 ** | |
pH | 0.095 | 0.045 | −0.056 | −0.246 | −0.203 | −0.455 * |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tong, L.; Karim, M.; Yusoff, F.M.; Aris, A.Z.; Abdullah, A.F.; Liu, F.; Li, D.; Puvanasundram, P. A Study on the Characteristics of Nitrification and Denitrification of Three Small Watersheds During the Wet and Dry Seasons with Various Sources of Pollution: A Case Study of the Jinjing Basin. Agriculture 2024, 14, 2330. https://doi.org/10.3390/agriculture14122330
Tong L, Karim M, Yusoff FM, Aris AZ, Abdullah AF, Liu F, Li D, Puvanasundram P. A Study on the Characteristics of Nitrification and Denitrification of Three Small Watersheds During the Wet and Dry Seasons with Various Sources of Pollution: A Case Study of the Jinjing Basin. Agriculture. 2024; 14(12):2330. https://doi.org/10.3390/agriculture14122330
Chicago/Turabian StyleTong, Lingling, Murni Karim, Fatimah M. Yusoff, Ahmad Zaharin Aris, Ahmad Fikri Abdullah, Feng Liu, Dejun Li, and Puvaneswari Puvanasundram. 2024. "A Study on the Characteristics of Nitrification and Denitrification of Three Small Watersheds During the Wet and Dry Seasons with Various Sources of Pollution: A Case Study of the Jinjing Basin" Agriculture 14, no. 12: 2330. https://doi.org/10.3390/agriculture14122330
APA StyleTong, L., Karim, M., Yusoff, F. M., Aris, A. Z., Abdullah, A. F., Liu, F., Li, D., & Puvanasundram, P. (2024). A Study on the Characteristics of Nitrification and Denitrification of Three Small Watersheds During the Wet and Dry Seasons with Various Sources of Pollution: A Case Study of the Jinjing Basin. Agriculture, 14(12), 2330. https://doi.org/10.3390/agriculture14122330