Molecular Characterization of the Actin Gene and 5′ Flanking Sequence from Brown Macroalga Saccharina japonica (Laminariales, Phaeophyta)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Kelp and Conditions for Culture
2.2. Characterization of SjACT Gene and Phylogenetic Analysis
2.3. Isolation of the 5′ Upstream Region of SjACT Gene and Analysis for Regulatory Elements
2.4. Vector Constructions
2.5. Biolistic Transformation
2.6. Detection for Transient Expression
3. Results
3.1. Isolation and Phylogenetic Analysis of the SjACT Gene
3.2. Prediction of Regulatory Elements within the 5′ Upstream Sequence of SjACT Gene
3.3. Detection of Promoter Function for the Upstream Sequence of SjACT Gene
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Charrier, B.; Abreu, M.H.; Araujo, R.; Bruhn, A.; Coates, J.C.; De Clerck, O.; Katsaros, C.; Robaina, R.R.; Wichard, T. Furthering knowledge of seaweed growth and development to facilitate sustainable aquaculture. New Phytol. 2017, 216, 967–975. [Google Scholar] [CrossRef] [PubMed]
- Wells, M.L.; Potin, P.; Craigie, J.S.; Raven, J.A.; Merchant, S.S.; Helliwell, K.E.; Smith, A.G.; Camire, M.E.; Brawley, S.H. Algae as nutritional and functional food sources: Revisiting our understanding. J. Appl. Phycol. 2017, 29, 949–982. [Google Scholar] [CrossRef] [PubMed]
- Hu, Z.M.; Shan, T.F.; Zhang, J.; Zhang, Q.S.; Critchley, A.T.; Choi, H.G.; Yotsukura, N.; Liu, F.L.; Duan, D.L. Kelp aquaculture in China: A retrospective and future prospects. Rev. Aquacult. 2021, 13, 1324–1351. [Google Scholar] [CrossRef]
- Jiang, P.; Qin, S.; Tseng, C.K. Expression of the lacZ reporter gene in sporophytes of the seaweed Laminaria japonica (Phaeophyceae) by gametophyte-targeted transformation. Plant Cell Rep. 2003, 21, 1211–1216. [Google Scholar] [CrossRef] [PubMed]
- Qin, S.; Jiang, P.; Tseng, C.K. Transforming kelp into a marine bioreactor. Trends Biotechnol. 2005, 23, 264–268. [Google Scholar] [CrossRef] [PubMed]
- Ye, N.H.; Zhang, X.W.; Miao, M.; Fan, X.; Zheng, Y.; Xu, D.; Wang, J.F.; Zhou, L.; Wang, D.S.; Gao, Y.; et al. Saccharina genomes provide novel insight into kelp biology. Nat. Commn. 2015, 6, 7986. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Chen, Z.; Li, Q.; Zhang, J.; Liu, S.; Duan, D. High-density SNP-based QTL mapping and candidate gene screening for yield-related blade length and width in Saccharina japonica (Laminariales, Phaeophyta). Sci. Rep. 2018, 8, 13591. [Google Scholar] [CrossRef] [PubMed]
- Shao, Z.R.; Zhang, P.Y.; Lu, C.; Li, S.X.; Chen, Z.H.; Wang, X.L.; Duan, D.L. Transcriptome sequencing of Saccharina japonica sporophytes during whole developmental periods reveals regulatory networks underlying alginate and mannitol biosynthesis. BMC Genom. 2019, 20, 975. [Google Scholar] [CrossRef]
- Zhang, Y.C.; Jiang, P.; Gao, J.T.; Liao, J.M.; Sun, S.L.; Shen, Z.L.; Qin, S. Recombinant expression of rt-PA gene (encoding Reteplase) in gametophytes of the seaweed Laminaria japonica (Laminariales, Phaeophyta). Sci. China Ser. C 2008, 51, 1116–1120. [Google Scholar] [CrossRef]
- Wu, M.; Comeron, J.M.; Yoon, H.S.; Bhattacharya, D. Unexpected dynamic gene family evolution in algal actins. Mol. Biol. Evol. 2009, 26, 249–253. [Google Scholar] [CrossRef]
- McElroy, D.; Zhang, W.G.; Cao, J.; Wu, R. Isolation of an efficient actin promoter for use in rice transformation. Plant Cell 1990, 2, 163–171. [Google Scholar] [CrossRef]
- An, Y.Q.C.; Meagher, R.B. Strong expression and conserved regulation of ACT2 in Arabidopsis thaliana and Physcomitrella patens. Plant Mol. Biol. Rep. 2010, 28, 481–490. [Google Scholar] [CrossRef]
- An, S.S.; Möpps, B.; Weber, K.; Bhattacharya, D. The origin and evolution of green algal and plant actins. Mol. Biol. Evol. 1999, 16, 275–285. [Google Scholar] [CrossRef] [PubMed]
- Cresnar, B.; Mages, W.; Müller, K.; Salbaum, J.M.; Schmitt, R. Structure and expression of a single actin gene in Volvox carteri. Curr. Genet. 1990, 18, 337–346. [Google Scholar] [CrossRef] [PubMed]
- Sugase, Y.; Hirono, M.; Kindle, K.L.; Kamiya, R. Cloning and characterization of the actin-encoding gene of Chlamydomonas reinhardtii. Gene 1996, 168, 117–121. [Google Scholar] [CrossRef]
- Kakinuma, M.; Coury, D.A.; Inagaki, E.; Itoh, S.; Yoshiura, Y.; Amano, H. Isolation and characterization of a single-copy actin gene from a sterile mutant of Ulva pertusa (Ulvales, Chlorophyta). Gene 2004, 334, 145–155. [Google Scholar] [CrossRef] [PubMed]
- Aumeier, C.; Polinski, E.; Menzel, D. Actin, actin-related proteins and profilin in diatoms: A comparative genomic analysis. Mar. Genom. 2015, 23, 133–142. [Google Scholar] [CrossRef]
- Bouget, F.Y.; Kerbourc’h, C.; Liaud, M.F.; de Goër, S.L.; Quatrano, R.S.; Cerff, R.; Kloareg, B. Structural features and phylogeny of the actin gene of Chondrus crispus (Gigartinales, Rhodophyta). Curr. Genet. 1995, 28, 164–172. [Google Scholar] [CrossRef]
- Kitade, Y.; Nakamura, M.; Uji, T.; Fukuda, S.; Endo, H.; Saga, N. Structural features and gene-expression profiles of actin homologs in Porphyra yezoensis (Rhodophyta). Gene 2008, 423, 79–84. [Google Scholar] [CrossRef]
- Jiang, G.Z.; Lv, Y.M.; Niu, X.L.; Xue, L.X. The actin gene promoter-driven bar as a dominant selectable marker for nuclear transformation of Dunaliella salina. Acta Genet. Sin. 2005, 32, 424–433. [Google Scholar]
- Ramessur, A.D.; Bothwell, J.H.; Maggs, C.A.; Gan, S.Y.; Phang, S.M. Agrobacterium-mediated gene delivery and transient expression in the red macroalga Chondrus crispus. Bot. Mar. 2018, 61, 499–510. [Google Scholar] [CrossRef]
- Wu, C.H.; Jiang, P.; Guo, Y.; Liu, J.G.; Zhao, J.; Fu, H.H. Isolation and characterization of Ulva prolifera actin1 gene and function verification of the 5′ flanking region as a strong promoter. Bioengineered 2018, 9, 124–133. [Google Scholar] [CrossRef] [PubMed]
- Blomme, J.; Liu, X.J.; Jacobs, T.B.; De Clerck, O. A molecular toolkit for the green seaweed Ulva mutabilis. Plant Physiol. 2021, 186, 1442–1454. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Wilkens, A.; Hanelt, D.; von Schwartzenberg, K. Expanding the molecular toolbox for Zygnematophyceae–transient genetic transformation of the desmid Micrasterias radians var. evoluta. Eur. J. Phycol. 2021, 56, 51–60. [Google Scholar] [CrossRef]
- Wang, Z.H.; Wu, C.H.; Jiang, P. Cloning and characterization of nitrate reductase gene in kelp Saccharina japonica (Laminariales, Phaeophyta). BMC Plant Biol. 2023, 23, 78. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharya, D.; Weber, K.; An, S.S.; Berning-Koch, W. Actin phylogeny identifies Mesostigma viride as a flagellate ancestor of the land plants. J. Mol. Evol. 1998, 47, 544–550. [Google Scholar] [CrossRef] [PubMed]
- Hoef-Emden, K.; Shrestha, R.P.; Lapidot, M.; Weinstein, Y.; Melkonian, M.; Arad, S.M. Actin phylogeny and intron distribution in bangiophyte red algae (Rhodoplantae). J. Mol. Evol. 2005, 61, 360–371. [Google Scholar] [CrossRef]
- Bhattacharya, D.; Stickel, S.K.; Sogin, M.L. Molecular phylogenetic analysis of actin genic regions from Achlya bisexualis (Oomycota) and Costaria costata (Chromophyta). J. Mol. Evol. 1991, 33, 525–536. [Google Scholar] [CrossRef]
- Slajcherová, K.; Fišerová, J.; Fischer, L.; Schwarzerová, K. Multiple actin isotypes in plants: Diverse genes for diverse roles? Front. Plant Sci. 2012, 3, 226. [Google Scholar] [CrossRef] [PubMed]
- Vitale, A.; Wu, R.J.; Cheng, Z.; Meagher, R.B. Multiple conserved 5′ elements are required for high-level pollen expression of the Arabidopsis reproductive actin ACT1. Plant Mol. Biol. 2003, 52, 1135–1151. [Google Scholar] [CrossRef] [PubMed]
- Tanifuji, G.; Archibald, J.M. Actin gene family dynamics in cryptomonads and red algae. J. Mol. Evol. 2010, 71, 169–179. [Google Scholar] [CrossRef] [PubMed]
- Gall, L.L.; Lelong, C.; Rusig, A.M.; Favrel, P. Characterization of an actin gene family in Palmaria palmata and Porphyra purpurea (Rhodophyta). Cah. Biol. Mar. 2005, 46, 311–322. [Google Scholar]
- Dong, M.T.; Zhang, X.W.; Chi, X.Y.; Mou, S.L.; Xu, J.F.; Xu, D.; Wang, W.Q.; Ye, N.H. The validity of a reference gene is highly dependent on the experimental conditions in green alga Ulva linza. Curr. Genet. 2012, 58, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Motomura, T.; Ichihara, K.; Matsuda, Y.; Yoshimura, K.; Kosugi, C.; Nagasato, C. Application of CRISPR-Cas9 genome editing by microinjection of gametophytes of Saccharina japonica (Laminariales, Phaeophyceae). J. Appl. Phycol. 2023, 35, 1431–1441. [Google Scholar] [CrossRef]
- Yang, Z.; Yu, Y.; Tay, Y.X.; Yue, G.H. Genome editing and its applications in genetic improvement in aquaculture. Rev. Aquacult. 2021, 14, 178–191. [Google Scholar] [CrossRef]
- Lee, T.M.; Lin, J.Y.; Tsai, T.H.; Yang, R.Y.; Ng, I.S. Clustered regularly interspaced short palindromic repeats (CRISPR) technology and genetic engineering strategies for microalgae towards carbon neutrality: A critical review. Bioresour. Technol. 2023, 368, 128350. [Google Scholar] [CrossRef] [PubMed]
- De, S.J.; Coulembier, V.E.; Lee, H.; Park, J.; Blomme, J. Genome editing in macroalgae: Advances and challenges. Front. Genome Ed. 2024, 6, 1380682. [Google Scholar] [CrossRef]
- Li, F.C.; Qin, S.; Jiang, P.; Wu, Y.; Zhang, W. The integrative expression of GUS gene driven by using FCP promoter in the seaweed Laminaria japonica (Phaeophyta). J. Appl. Phycol. 2009, 21, 287–293. [Google Scholar] [CrossRef]
- Ladygin, V.G. The transformation of the unicellular alga Chlamydomonas reinhardtii by electroporation. Microbiol. 2003, 72, 585–591. [Google Scholar] [CrossRef]
- Tonui, W.K.; Ahuja, V.; Beech, C.J.; Connolly, J.B.; Dass, B.; Glandorf, D.C.M.; James, S.; Muchiri, J.N.; Mugoya, C.F.; Okoree, E.A.; et al. Points to consider in seeking biosafety approval for research, testing, and environmental release of experimental genetically modified biocontrol products during research and development. Transgenic Res. 2022, 31, 607–623. [Google Scholar] [CrossRef] [PubMed]
Purposes | Primers | Sequences (5′-3′) |
---|---|---|
Genomic DNA | act1 | CCTATCGCACCGTCTTGGTTGGAG |
act2 | ACAATCGTAAATGATCTTGCTCCA | |
act3 | TCCTTGTTCGCCTTGGGGTTGAGG | |
act4 | AGAACCCTCTAGCTCCCTTTAG | |
act5 | ATGGCGGACGAGGATGTACAA | |
act6 | GTCGGCATGGACCAGAAGGA | |
act7 | TCACGCTTAGAAGCACTTGCGG | |
cDNA fragment | act8 | GAACCCCCCACAGCTACACTC |
act9 | ATGAGCGACTCATCCTCGCAC | |
5′-genome walking | SP1 | AGCGCACCCAACTCTCGTGAGTAC |
SP2 | CAAAGGACTCACCATGATTCCGG | |
SP3 | CGTTGTCCACCACCAAGGCTTGTA | |
Vector | lacZ-5′-Nhe I | gtgagctagcCGAACGCATCAAAATTCC 1 |
lacZ-3′-Bgl II | gaagatctGATAAAAAGAGAGTGTAGCT | |
EGFP-5′-Xho I | ccgctcgagTCGAACGCATCAAAATTCC | |
EGFP-3′-BamH I | cgggatccGATAAAAAGAGAGTGTAGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, H.; Wang, Z.; Zhang, Y.; Jiang, P. Molecular Characterization of the Actin Gene and 5′ Flanking Sequence from Brown Macroalga Saccharina japonica (Laminariales, Phaeophyta). J. Mar. Sci. Eng. 2024, 12, 887. https://doi.org/10.3390/jmse12060887
Xu H, Wang Z, Zhang Y, Jiang P. Molecular Characterization of the Actin Gene and 5′ Flanking Sequence from Brown Macroalga Saccharina japonica (Laminariales, Phaeophyta). Journal of Marine Science and Engineering. 2024; 12(6):887. https://doi.org/10.3390/jmse12060887
Chicago/Turabian StyleXu, Hao, Zhenghua Wang, Yichen Zhang, and Peng Jiang. 2024. "Molecular Characterization of the Actin Gene and 5′ Flanking Sequence from Brown Macroalga Saccharina japonica (Laminariales, Phaeophyta)" Journal of Marine Science and Engineering 12, no. 6: 887. https://doi.org/10.3390/jmse12060887