Next Article in Journal
Pulsatile Ventilation Flow in Polychaete Alitta succinea Burrows
Next Article in Special Issue
An Experimental Study on Estimating the Quantity of Fish in Cages Based on Image Sonar
Previous Article in Journal
Obstacle Avoidance Control for Autonomous Surface Vehicles Using Elliptical Obstacle Model Based on Barrier Lyapunov Function and Model Predictive Control
Previous Article in Special Issue
The Effects of Acute Ammonia Nitrogen Stress on Antioxidant Ability, Phosphatases, and Related Gene Expression in the Kidney of Juvenile Yellowfin Tuna (Thunnus albacares)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JMSE
Volume 12
Issue 7
10.3390/jmse12071036
jmse-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Licorice on Gene Expression Related to the Growth of Asian Seabass Lates calcarifer

by
Rui Yang
1,2,3,4,†,
Wang Zhao
1,2,3,4,†,
Yifu Wang
1,2,3,4,
Zhengyi Fu
1,2,3,4,5,
Jing Hu
1,2,3,4,
Shengjie Zhou
1,2,3,4,
Minghao Li
1,2,3,4 and
Zhenhua Ma
1,2,3,4,5,*
1
Key Laboratory of Efficient Utilization and Processing of Marine Fishery Resources of Hainan Province, Sanya Tropical Fisheries Research Institute, Sanya 572018, China
2
South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Guangzhou 510300, China
3
Hainan Engineering Research Center for Deep-Sea Aquaculture and Processing, Sanya 572018, China
4
International Joint Research Center for Conservation and Application of Fishery Resources in the South China Sea, Sanya 572018, China
5
College of Science and Engineering, Flinders University, Adelaide 5001, Australia
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
J. Mar. Sci. Eng. 2024, 12(7), 1036; https://doi.org/10.3390/jmse12071036
Submission received: 5 May 2024 / Revised: 3 June 2024 / Accepted: 18 June 2024 / Published: 21 June 2024
(This article belongs to the Special Issue New Techniques and Equipment in Large Offshore Aquaculture Platform)
Browse Figures
Versions Notes

Abstract

:
The Asian seabass (Lates calcarifer) has high economic value and is the primary aquaculture species in China. Licorice (Glycyrrhiza uralensis) as a feed additive has demonstrated significant immunological benefits in aquaculture. However, its effects on the growth of aquatic animals are largely unexplored. This study explored the influence of licorice on the level of growth-related genes in Asian seabass by conducting an experiment using artificial feed with 0%, 1%, 3%, and 5% licorice. The impact on growth performance and the expression of several genes, including growth hormone–releasing hormone (GHRH), growth hormone (GH), growth hormone receptor (GHR), insulin-like growth factor 1 (IGF1), IGF2, IGF2 receptor (IGF2R), myostatin 1 (MSTN1), and myostatin 2 (MSTN2), were studied over 56 d. According to the results, the 3% and 5% licorice-supplemented diets significantly improved survival rates and weight gain compared to the control group. Licorice affected the level of growth-associated genes in Asian seabass and significantly increased the levels of GHR and IGF1 in the liver. However, a 5% licorice diet downregulated the expression of IGF2. As the licorice content in the diet increased, the levels of IGF2R and MSTN1 in the muscle tissue first decreased and then increased, and licorice addition inhibited the MSTN2 expression. The inclusion of licorice in the feed led to a significant downregulation of the GH and GHRH expression (p < 0.05). In summary, adding a certain proportion of licorice to the diet can improve the survival rate of the Asian seabass. Moreover, a proper proportion of licorice can increase the expression of related growth genes of fish, effectively increasing their weight gain rate and specific growth rate.

1. Introduction

The Asian seabass is a euryhaline fish found mainly in the Western Pacific, being widely farmed in Australia [1]. Renowned for its taste, rapid growth, and large size, the Asian seabass has a high economic value and is the primary aquaculture species in China [2]. Extensive studies were conducted on the dietary requirements of the Asian seabass, including proteins, fats, carbohydrates, and minerals, as well as the need for additives such as probiotics and antibiotics [3,4]. Studies have shown that some traditional Chinese herbs or extracts, such as Allium sativum [5], Cissus quadrangularis [6], Mentha piperita [7], Polygonum chinense [8], can improve the growth performance of Asian seabass. Traditional Chinese herbs, which are rich in nutrients and medicinal components, are characterized by their abundance, multi-targeting properties, diverse pharmacological effects, low toxicity, and minimal residues, making them ideal green additives for aquaculture feed [9,10,11]. These additives promote growth, enhance immunity, reduce costs, and improve profitability [12].
Licorice, a traditional medicinal herb, contains various components, including triterpene saponins, flavonoids, alkaloids, polysaccharides, and amino acids [13,14,15,16,17]. Its pharmacological actions mainly involve antitumor, anti-arrhythmic, antispasmodic, and antitussive effects, mediated by flavonoids; anti-inflammatory, antiviral, antitumor, and detoxifying effects, mediated by glycyrrhizic acid; and immunomodulatory, antiviral, and antitumor effects, mediated by polysaccharides [18,19,20,21,22,23,24,25]. Recently, licorice (Glycyrrhiza uralensis) has been studied as a feed additive in aquaculture and has been shown to significantly improve stress resistance, pathogen resistance, survival rate, and antioxidant capacity in fish [12,13]. For instance, adding fermented licorice to the feed of orange-spotted groupers (Epinephelus coioides) can reduce liver tissue damage and enhance antioxidative capacity, thereby increasing the survival rates under nitrite stress conditions [26]. In addition, licorice significantly improved the stress resistance of goldfish (Carassius auratus) and enhanced the resistance to Aeromonas hydrophila in goldfish and Chinese soft-shelled turtles (Pelodiscus sinensis) [20,27]. In terms of growth, licorice has a certain promotional effect on freshwater species such as tilapia, sturgeon, grass carp, and koi carp [28,29,30,31]. Previous studies have found that licorice can promote the growth of Asian seabass, but no further studies have been conducted [32]. In particular, whether licorice can really promote the expression of growth-related genes is still unexplored.
In this study, juvenile Asian seabass were fed with feed additives containing licorice, and then their growth performance was measured. The qrt-PCR method was used to study the effects on the level of growth-related genes and muscle growth-related genes. The present research aimed to reveal the mechanisms by which licorice influences the growth of Asian seabass at the molecular level, providing a scientific basis for its application in the aquaculture production of Asian seabass and acting as an important reference for the use of traditional Chinese herbal resources.

2. Materials and Methods

2.1. Feed Formulation and Experimental Design

Fish and soybean meals were the main protein sources used. Fish oil and wheat flour were the main fat and carbohydrate sources, respectively. A single-factor concentration gradient method was employed to design four levels of licorice feed with mass fractions of 0%, 1%, 3%, and 5%. The basic feed without licorice served as a control group. According to the nutritional requirements of Asian seabass [33], the experimental feeds were formulated to have a protein level of 41% and a lipid level of 17%, with consistency maintained across all experimental groups. The raw materials were ground and sieved through a 40-mesh sieve, mixed thoroughly using a mixer, pelletized using a small pellet machine (pellet diameter 2.0 mm), and stored at −20 °C for later use. The feed ingredients and nutritional components are listed in Table 1.

2.2. Experimental Method

Juvenile Asian seabass were bred by the Sanya Tropical Fisheries Research Institute Lingshui Experimental Center (Lingshui, Hainan, China). The fish weighed 13.93 ± 0.87 g and had a length of 8.78 ± 0.39 cm. Three hundred and sixty healthy, active, and responsive Asian seabass with smooth skin, no injuries, and good feeding behavior were randomly classified into four experimental groups, with three replicates per gradient and 30 fish per replicate. The feeding trial was conducted in flow-through seawater culture tanks (800 L) at the Sanya Tropical Fisheries Research Institute Lingshui Experimental Center (Lingshui, Hainan, China). During the experiment, the feeding behavior and mortality of the fish, as well as the water quality were monitored and recorded. The key water quality parameters were 26–29 °C, pH 7.3–7.8, and nitrite < 0.02 mg/L. Feeding was performed at 9:00 AM and 3:00 PM every day, using a satiation feeding method until the fish stopped feeding. Approximately 1 h after feeding, the tanks were siphoned to remove feces and prevent water pollution. The water was changed at 4:30 PM, with two-thirds of the water being replaced. The experiment lasted for 56 d, after which the fish were weighed for calculated growth performance.

2.3. Experiment Sampling

At the end of the feeding trial, three fish were sampled from each tank (i.e., nine fish per treatment) and placed in seawater containing 7 mg/L eugenol (provided by Changshu Shangchi Dental Materials Co., Ltd., Changshu, China) for anesthesia. Once anesthetized, the fish were quickly dissected to collect the brain tissue for GHRH and GH; the liver tissue for GHR, IGF1, and IGF2; and the muscle tissue for IGF2R, myostatin 1 (MSTN1), and Myosta2tin 2 (MSTN2). The tissues were then placed in cryogenic vials, flash-frozen, and stored at −80 °C.

2.4. RNA Extraction

The stored tissues were ground, and the total RNA was extracted using the previous method [34]. The concentration of the extracted RNA was detected using an ND 5000 micro-volume spectrophotometer (Beijing Baitake Biotechnology Co., Ltd., Beijing, China) at 260 and 280 nm to analyze the RNA integrity and purity.

2.5. qrtPCR Experiment

The extracted RNA was used for cDNA synthesis based on the PrimeScript™ Mix (Takara Bio Engineering Company) protocol and was then stored at −20 °C. The reaction mix for reverse transcription included 2 μL RT Master Mix. The conditions for the reverse transcription reaction were 37 °C for half an hour, followed by 85 °C for 5 s. The growth-related gene sequences of Asian seabass, including GHRH, GH, GHR, IGF1, IGF2, IGF2R, MSTN1, and MSTN2 were obtained from the NCBI database, and primers were designed with a reference gene as the control (Table 2). The qPCR was performed on an rt-PCR device (Langji Scientific Company). The 20 μL reaction mix included 10 μL 2 × Real PreMix, 0.6 μL 10 μM primers, and 2 μL diluted cDNA. The PCR program was as follows: 95 °C for 15 min; 95 °C for 10 s; 58 °C for 20 s; 72 °C for 30 s; 40 cycles. A melt curve was applied to ensure the specificity of the products and the absence of primer–dimer formation. A no-DNA template control was used to confirm the absence of contamination during PCR.

2.6. Calculation and Statistical Analysis

The calculation formulas of survival rate (SR), weight gain (WG), feed intake (FI), and specific growth rate (SGR) are as follows:
SR (%) = 100 × number of fish at the end of the test/number of fish at the beginning of the test:
WG (g fish−1) = Wt − W0
FI (g fish−1 d−1) = (feed consumed per tank/fish)/t
SGR (%/d) = 100 × [(LnWt − LnW0)]/t
Wt—final average weight (g); W0—initial average weight (g); t—the number of days the feeding text lasted.
The relative levels of gene mRNA were detected based on the 2−ΔΔCt approach, with the β-actin as the reference gene for normalization. Experimental data were presented as mean ± SD. The SPSS 19.0 tool was applied for statistical treatment data. The Shapiro–Wilk test was employed to check the data for normal distribution, and the Levene test was used to assess the homogeneity of variance. Comparisons among the groups were conducted using the ANOVA (LSD test), with a statistical level of 0.05.

3. Results

3.1. Effects of Licorice in Feed on the Growth Performance of Asian Seabass

After adding different levels of licorice to the feed and feeding for 56 days, the survival rate, weight gain rate, body-length growth rate, and specific growth rate of the seabass are shown in Figure 1. The survival rate of the 3% and 5% licorice-supplemented diet group was significantly higher than that of the control group (p < 0.05) (Figure 1A). The survival rate reached the maximum in the 3% licorice-supplemented diet group, and the value was (98.89 ± 1.93) %. The WG was significantly increased in all the licorice treatment groups compared to the control group (p < 0.05) (Figure 1B). The FI was not significant among the groups (p > 0.05) (Figure 1C). The SGR of the 5% licorice-supplemented diet group was significantly higher than that of the control group (p < 0.05) (Figure 1D).

3.2. Effects of Licorice on the Expression of Growth-Related Genes in the Asian Seabass Liver

As shown in Figure 2, adding licorice to the feed significantly affected the level of the GHR and IGF genes in the livers of Asian seabass. According to the comparison result, the relative expression level of the GHR gene in the liver increased significantly after the addition of licorice (p < 0.05), and the influence of licorice on the GHR gene’s relative expression level varied with its concentration, with the highest increase of 362% observed in the 5% group, followed by the 1% group, and the lowest in the 3% group. The relative expression level of the IGF1 gene in the livers of the experimental groups significantly increased with the increase in licorice content in the feed (p < 0.05), with the 5% group showing the max level of the IGF1 gene, which was 751% of the control group’s level. The IGF2 gene level showed an initial increase, followed by a decrease with increasing licorice content, with significant differences between the two groups (p < 0.05). The 1% group had the highest level, followed by the 3% group, with both levels significantly increased (p < 0.05). The IGF2 level in the 5% group was significantly lower (p < 0.05).

3.3. Effects of Licorice on Level of Muscle Growth-Related Genes in Asian Seabass

As indicated in Figure 3, licorice significantly affected the level of the muscle growth-associated genes IGF2R, MSTN1, and MSTN2 in Asian seabass. With an increase in the licorice content in the feed, the expression level of the IGF2R gene initially decreased and then increased; however, the expression levels of IGF2R in all experimental groups were significantly lower than those in the other group (p < 0.05). Similar to the results of the IGF2R gene, the MSTN1 gene level also initially decreased and then increased, with the lowest level observed in the 1% group. The level increased in the 3% group and was significantly higher compared to the other groups (p < 0.05) and continued to increase in the 5% group, reaching 333% of that in the control group. The addition of licorice to the feed caused a significant reduction in the MSTN2 gene level at all levels (p < 0.05).

3.4. Effects of Licorice on Level of Growth-Related Genes in Brain Tissue of Asian Seabass

The influence of licorice on the level of the growth-related genes GH and GHRH in the brain tissue of Asian seabass is illustrated in Figure 4. After adding licorice, the level of GH decreased significantly (p < 0.05). The level of the GHRH gene exhibited a trend of initially decreasing and then increasing with increasing licorice content. The lowest level appeared in the 3% licorice group, followed by the 5% licorice group, with the highest level observed in the 1% licorice group. However, the expression levels of GHRH in all experimental groups were significantly lower than those in the control group (p < 0.05).

4. Discussion

We found that adding a proper concentration of licorice in the feed significantly promoted the expression of genes related to GHR, IGF1, and IGF2 in the liver of Asian seabass. The growth of teleost fish is primarily adjusted by the GH/IGF system and other endocrine factors. GH binds to GHR on the surface of target organs, stimulating the liver to secrete IGF [35,36]. IGF binds to IGF receptors in target tissues, initiating a series of cellular processes related to growth, such as cell proliferation and differentiation, leading to overall growth [37]. In the present research, it was found that adding licorice to Asian seabass feed significantly upregulated the level of GHR. The downstream genes of the GH/IGF axis in the liver, IGF1, and IGF2 showed significant changes, confirming that GH can exert biological effects through IGF1 and IGF2 after binding to GHR [38]. When the addition of licorice did not exceed 3%, the levels of IGF1 and IGF2 significantly increased, suggesting that a 3% licorice addition could significantly promote processes related to cell growth. The max level of IGF1 appeared in the 5% licorice group but the significant downregulation of the IGF2 expression indicates that high levels of licorice in Asian seabass feed might affect the functions related to IGF2.
In Nile tilapia (Oreochromis niloticus), GH is expressed only in the pituitary gland, whereas GHR is expressed in various tissues and organs, including muscle, hypothalamus, and thymus, with the highest expression in the liver, indicating that GH has multiple physiological functions [39]. In teleosts, MSTN1 primarily inhibits muscle hyperplasia but not hypertrophy, which is mainly achieved through the downregulation of MSTN2 expression [40]. This research showed the variable influence of licorice on MSTN1 expression, indicating the stages of rapid muscle hyperplasia in Asian seabass [41]. The lower expression of MSTN1 and MSTN2 with 1% licorice suggests reduced inhibition of muscle hyperplasia and promotion of muscle hypertrophy, while the increased MSTN1 expression with 3% and 5% licorice indicates an enhanced inhibition of muscle hyperplasia and the promotion of muscle hypertrophy.
This study found that after adding licorice, the level of GH in the brain samples of Asian seabass was downregulated, and the levels of GHR, IGF1, and IGF2 in the liver tissue were upregulated, possibly due to a delayed regulatory effect of GH on the growth rate and its negative feedback regulation with IGF1 [42]. The hypothalamus-secreted GHRH physiologically regulates the generation and release of GH in the pituitary gland, which is an important hormone for regulating fish growth, development, reproduction, and immunity [43]. In the present research, the GHRH and GH expression was significantly downregulated and did not show a linear relationship, which may be related to the multifactorial influence on GH secretion that maintains a dynamic balance between promoting and inhibiting factors [44].
The beneficial effects of licorice may be attributed to glycyrice polysaccharides (GPS). Dietary supplementation of GPS has been found to enhance growth performance, body size, and the relative expression of the growth-related gene IGF-1 in broilers [45]. Furthermore, it can improve serum and intestinal immune status, promote the expression of immune-related genes in the spleen, and enhance broiler immunity. The optimal supplemental concentration is 600 mg/kg [46,47]. In weaned piglets, GPS supplementation significantly promotes the mRNA expression levels of the IGF-1 gene in the liver, as well as the IGF-1 and IGF-2 genes in the dorsal longus muscle (p < 0.05) [48]. Additionally, the dietary addition of GPS improves growth performance, reduces diarrhea rate, enhances humoral immunity, promotes the related growth gene expression, and even exhibits a certain level of resistance against PRRSV infection in piglets. Supplementation with 1000 mg/kg GPS alleviates stress response, reduces diarrhea rate, and improves growth performance by enhancing the intestinal mucosal barrier effect, immune function, and intestinal microflora structure in weaned piglets [49]. Moreover, GPS exhibits inhibitory effects on the TLR4/MyD88/NF-κB signaling pathway, thereby reducing the excessive expression of immune and inflammatory, apoptosis, and tight junction protein genes induced by LPS in IPEC-J2 cells [50]. Additionally, they enhance the cell’s antioxidant capacity and decrease ROS accumulation and the apoptosis rate, ultimately alleviating the inflammatory damage caused by LPS in the IPEC-J2 cells. It also enhances antioxidant capacity, reduces ROS accumulation and cell apoptosis rates, and mitigates inflammatory damage induced by LPS in IPEC-J2 cells. GPS serves as an effective immune enhancer to enhance the integrity of the intestinal barrier [51]. The addition of licorice to animal feed can effectively stimulate the growth of terrestrial animals such as chickens and pigs, as well as that of aquatic species such as Asian seabass. Moreover, it exhibits immune-enhancing properties, thereby positioning licorice as a promising feed additive with excellent application prospects.

5. Conclusions

In conclusion, the inclusion of licorice in the diet of Asian seabass significantly enhances growth performance and survival rates. Specifically, diets supplemented with 3% and 5% licorice showed notable improvements in weight gain and survival compared to the control group. Licorice supplementation positively influenced the expression of growth-related genes, particularly increasing the GHR and IGF1 levels in the liver. However, higher levels of licorice (5%) resulted in the downregulation of IGF2 expression and complex effects on the IGF2R and MSTN1 levels in the muscle tissue. Additionally, licorice inhibited the expression of GH, GHRH, and MSTN2. These findings suggest that incorporating an optimal proportion of licorice into the diet can effectively enhance the growth and health of Asian seabass in aquaculture.

Author Contributions

Conceptualization, Z.M. and R.Y.; methodology, W.Z. and Y.W.; software, J.H. and M.L.; validation, J.H.; formal analysis, Y.W. and W.Z.; investigation, M.L. and S.Z.; resources, S.Z. and Z.M.; data curation, W.Z. and Y.W.; writing—original draft preparation, R.Y. and W.Z.; writing—review and editing, Z.F. and Z.M.; visualization, S.Z. and R.Y.; supervision, Z.M.; project administration, R.Y. and J.H.; funding acquisition, Z.M. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Central Public-Interest Scientific Institution Basal Research Fund, CAFS (grant number 2023TD58, 2023YJ03); the Central Public-Interest Scientific Institution Basal Research Fund, South China Sea Fisheries Research Institute, CAFS (grant number 2021SD09); the Hainan Provincial Natural Science Foundation of China (grant number 321QN094); the Hainan Province Science and Technology Special Fund (grant number ZDYF2022XDNY349); the Guangxi Science and technology planning project (grant number GUIKE AD21238026); the Hainan Province Natural Science Foundation enterprise talent project (grant number 324QY579).

Institutional Review Board Statement

This animal study was reviewed and approved by the Animal Care and Use Committee of South China Sea Fisheries Research Institute, the Chinese Academy of Fishery Sciences. The ethical code is 2020TD15, approved on 10 March 2020.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Nandakumar, S.; Ambasankar, K.; Ali, S.S.R.; Syamadayal, J.; Vasagam, K. Replacement of fish meal with corn gluten meal in feeds for Asian seabass (Lates calcarifer). Aquac. Int. 2017, 25, 1495–1505. [Google Scholar] [CrossRef]
  2. Zhao, W.; Hu, J.; Ma, Z.; Yu, G.; Yang, R.; Wang, L. Path analysis and growth curve fitting of morphological traits to body weight of juvenile Lates calcarifer. J. South. Agric. 2017, 48, 1700–1707. [Google Scholar]
  3. Li, Z.; Yuan, F.; Lin, H.; Lu, X.; Yang, Q. Efects ofBacilhs lichen ifom is suppement on grwoth perform anceand digestive enzymes activities of the sea bass, Lates calcarifer. J. Oceanogr. Taiwan Strait 2011, 30, 43–48. [Google Scholar]
  4. Lin, H.; Yuan, F.; Li, Z.; Lu, X. Effects of dietary photosyn thetic bacteria PS2 on growth performance, digestive enzymes and nonspecific immune enzymes. South China Fish. Sci. 2013, 6, 25–29. [Google Scholar]
  5. Al-Khamees, A.M.A.S.M.E.-B.S. Influence of Dietary Garlic (Allium sativum) and/orAscorbic Acid on Performance, Feed Utilization, Body Composition and Hemato-Biochemical Parameters of Juvenile Asian Sea Bass (Lates calcarifer). Animals 2020, 10, 2396. [Google Scholar]
  6. Chinnasamy, C.D.A. Dietary administration of natural immunostimulants on growth performance, haematological, biochemical parameters and disease resistance of Asian Sea bass Lates calcarifer (Bloch, 1790). Aquac. Res. 2017, 48, 1131–1145. [Google Scholar]
  7. Talpur, A.D. Mentha piperita (Peppermint) as feed additive enhanced growth performance, survival, immune response and disease resistance of Asian seabass, Lates calcarifer (Bloch) against Vibrio harveyi infection. Aquaculture 2014, 420–421, 71–78. [Google Scholar] [CrossRef]
  8. Razak, R.A.; Shariff, M.; Md Yusoff, F.; Safinar, I. Enhanced growth performance, haemato-biochemical and immune parameters of asian seabass, lates calcarifer (bloch, 1790) fed dietary supplementation with polygonum chinense. Asian Fish. Sci. 2019, 32, 19–28. [Google Scholar] [CrossRef]
  9. Lu, X.; Lin, H.; Li, Z. Effect of dietary Chinese herbalm edicines on hematological and blood biochemical indices incultured seabass Lates calarifer. J. Dalian Fish. Univ. 2009, 24, 279–282. [Google Scholar]
  10. Zhou, H.; Zhou, H.Q. Effects of Chinese herbal medicine on growth and immune function of Litopenaeus vannamei. J. Hebei Fish. 2008, 9, 44–48. [Google Scholar]
  11. Shi, H.; Lou, B.; Hu, Z. Effects of Chinese herbal feed additives on growth and non-specific immunity of juvenile Bream (Pagrosomus major). Prog. Mod. Biomed. 2007, 7, 548–556. [Google Scholar]
  12. Jin, E.; Xiong, X.; Su, Y. Effects of compound Chinese herbal preparation on immune function, antioxidant function and proliferative and apoptotic gene expression of bursa of Fabricius in green foot chicken. J. Northeast Agric. Univ. 2019, 50, 66–77. [Google Scholar]
  13. Wang, Q.e.; Ren, H.; Zeng, X. Research and Utilization Statue of Licorice. Chin. Agric. Sci. Bull. 2011, 27, 290–295. [Google Scholar]
  14. Zhao, S.; Nong, Z.; Zhong, Z. Experimental study on antitumor effect of the total flavonoids from radix glyeyrrhizae and its mechanisms. Guangxi Med. J. 2006, 28, 1496–1499. [Google Scholar]
  15. Zhang, F.; Shen, Y. Advances in studies on cardioprotection of glycyrrhizie acid compound and flavonoids. Drugs Clinie 2012, 27, 429–434. [Google Scholar]
  16. Wang, F.; Su, Y. Pharmacological action and clinical application of licorice. Lishizhen Med. Mater. Medica Res. 2002, 13, 303–304. [Google Scholar]
  17. Zhu, Y.; Su, Y.; Chen, J. Inhibition of flavone from Glycyrrhiza uralensis on capsaicin-induced cough reflex in guinea pig. Chin. Tradit. HerbalDrugs 2006, 37, 1048–1051. [Google Scholar]
  18. Zhang, F.; Shen, Y. Advances in studies on glyeyrrhizic acid and its derivatives in anti-inflammationand anti-allergy. Drugs Climie 2011, 26, 359–364. [Google Scholar]
  19. Huang, Q.; Ma, Z. Pharmacological research progress of glyeyrrhizie acid. Drug Eval. Res. 2011, 34, 384–387. [Google Scholar]
  20. Liu, Q. Summary of chemical composition and pharmacological action of licorice. Chin. Med. Mod. Distance Educ. China 2011, 9, 84. [Google Scholar]
  21. Xie, H.; Du, X.; Yu, D. Research Progress in Pharmacological Effects of Glycyrrhiza Polysaccharide. Chin. J. Vet. Drug 2011, 30, 285. [Google Scholar]
  22. Hu, J.; Ao, M.; Cui, Y. Anti-tumor Effect of Polysaccharide from Glycyrrhizaand Its Influence on immunological Function. Nat. Prod. Res. Dev. 2008, 20, 911–913, 938. [Google Scholar]
  23. Zhu, L.; Liu, X.; Yin, S.; Wang, Q.; Ni, C.; Yang, F. Effects of Chinese herbal medicine on growth performance and antioxidant indexes of tilapia. China Feed 2014, 23, 38–41. [Google Scholar]
  24. Tan, J.; Deng, F.; Cao, Y.; Yao, Y. Effects of Chinese herbal compound in feed on growth, musclecomposition and immune-related enzyme activities of juvenile grass carp (Ctenopharyngodon idellus). Guangdong Agric. Sci. 2015, 10, 109–113. [Google Scholar]
  25. Wang, B.; Fang, P.; Lin, X. Effect of Liquorice Extracts on the Resistance of Carassius auratus to Stress and Pathogen Infection. Freshw. Fish. 2007, 37, 3–6. [Google Scholar]
  26. Weng, Q.; Li, Z.; Lu, K. Effect of different levels of fermented licorice on the blood index and antioxidant ability of grouper under nitrite stress. Feed Res. 2019, 5, 24–27. [Google Scholar]
  27. Chen, C.R.; Chen, X.H.; Chen, C.F. Effect of oral glycyrrhizin on anti-Aeromonas hydrophila infection of juvenile soft-shelled turtle, Trionyx sinensis. J. Huazhong Agric. Unversity 2000, 19, 577–580. [Google Scholar]
  28. Adineh, H.; Naderi, M.; Yousefi, M.; Hamidi, M.K.; Ahmadifar, E.; Hoseini, S.M. Dietary licorice (Glycyrrhiza glabra) improves growth, lipid metabolism, antioxidant and immune responses, and resistance to crowding stress in common carp, Cyprinus carpio. Aquac. Nutri. 2021; 27, 417–426. [Google Scholar] [CrossRef]
  29. Meng, X.; You, F.; Cao, H. Effects of dietary licorice (Glycyrrhiza uralensis) supplementation on growth performance, muscle quality, and immunity in the common carp (Cyprinus carpio haematopterus). Aquac. Rep. 2022, 27, 101331. [Google Scholar] [CrossRef]
  30. Abdel-Tawwab, M.; El-Araby, D.A. Immune and antioxidative effects of dietary licorice (Glycyrrhiza glabra L.) on performance of Nile tilapia, Oreochromis niloticus (L.) and it susceptibility to Aeromonas hydrophila infection. Aquaculture 2021, 530, 735828. [Google Scholar] [CrossRef]
  31. Zhang, H.; Xia, L.; Peng, X.; Zhao, M.; Lan, Y.; Tang, X. Study on growth and fatty liver repair of Acipenser sinensis by licorice and salvia miltiorrhiza. Chin. Fish. Qual. Stand. 2014, 4, 46–53. [Google Scholar]
  32. Yang, R.; Han, M.; Fu, Z.; Wang, Y.; Zhao, W.; Yu, G.; Ma, Z. Immune Responses of Asian Seabass Lates calcariferto Dietary Glycyrrhiza uralensis. Animals 2020, 10, 1629. [Google Scholar] [CrossRef] [PubMed]
  33. Ma, Z.; Yu, G.; Meng, X. Culture Biology and Processing of Barramundi (Lates calcarifer); China Agriculture Press: Beijing, China, 2019. [Google Scholar]
  34. Fu, Z.; Yang, R.; Chen, X. Dietary non-protein energy source regulates antioxidant status and immune response of barramundi (Lates calcarifer). Fish Shellfish Immunol. 2019, 95, 697–704. [Google Scholar] [CrossRef]
  35. Picha, M.E.; Turano, M.J.; Beckman, B.R.; Borski, R.J. Endocrine Biomarkers of Growth and Applications to Aquaculture: A Minireview of Growth Hormone, Insulin-like Growth Factor (igf)-i, and Igf-binding Proteins as Potential Growth Indicators in Fish. N. Am. J. Aquac. 2008, 70, 196–211. [Google Scholar] [CrossRef]
  36. Rolland, M.; Dalsgaard, J.; Holm, J.; Gómez-Requeni, P.; Skov, P.V. Dietary Methionine Level Affects Growth Performance and Hepatic Gene Expression of Gh–igf System and Protein Turnover Regulators in Rainbow Trout (oncorhynchus Mykiss) Fed Plant Protein-based Diets. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2015, 181, 33–41. [Google Scholar] [CrossRef]
  37. Wan, Z. Studies on Juvenile Development and Digestive Physiology of Takifugu rufifin. Master’s Thesis, Ocean University of China, Qingdao, China, 2005. [Google Scholar]
  38. Figueiredo, M.; Lanes, C.; Almeida, D. The Effect of Gh Overexpression on Ghr and Igf-i Gene Regulation in Different Genotypes of Gh-transgenic Zebrafish. Comp. Biochem. Physiol. Part D Genom. Proteom. 2007, 2, 228–233. [Google Scholar]
  39. Ma, X.; Zhang, Y.; Huang, W. cDNAs cloning of growth hormone, growth hormone receptor and the different expression between male and female Nile tilapia (Oreochromis niloticus). Curr. Zool. 2006, 52, 924–933. [Google Scholar]
  40. Santis, C.; Gomes, G.; Jerry, D. Abundance of Myostatin Gene Transcripts and Their Correlation with Muscle Hypertrophy During the Development of Barramundi, Lates Calcarifer. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2012, 163, 101–107. [Google Scholar] [CrossRef]
  41. Johnston, I. Muscle Development and Growth: Potential Implications for Flesh Quality in Fish. Aquaculture 1999, 177, 99–115. [Google Scholar] [CrossRef]
  42. Gabillard, J.; Montserrat, B. Coordinated Regulation of the Gh/igf System Genes During Refeeding in Rainbow Trout (oncorhynchus Mykiss). J. Endocrinol. 2006, 191, 15–24. [Google Scholar] [CrossRef]
  43. Nam, B.; Moon, J.; Kim, Y. Molecular and Functional Analyses of Growth Hormone-releasing Hormone (ghrh) from Olive Flounder (paralichthys Olivaceus). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2011, 159, 84–91. [Google Scholar] [CrossRef]
  44. Canosa, L.; Chang, J.; Peter, R. Neuroendocrine Control of Growth Hormone in Fish. Gen. Comp. Endocrinol. 2007, 151, 1–26. [Google Scholar] [CrossRef]
  45. Danhui, W.; Youbing, Y.; Ying, L. Effect of Glycyrrhiza polysaccharide in diets on growth performance, body size index and IGF-1 gene relative expression in broilers. Mod. J. Anim. Husb. Vet. Med. 2021, 12, 28–31. [Google Scholar]
  46. Wenbin, C.; Xueying, W.; Cai, Z. Effect of Glycyrrhiza polysaccharide on growth performance and immunologic function of broilers. Feed Res. 2022, 18, 34–40. [Google Scholar]
  47. Chen, W. Effects of Glycyrrhiza polysaccharides on Growth Performance, Immune Function and Intestinal Health of Broilers. Master’s Thesis, Henan University of Science and Technology, Zhengzhou, China, 2022. [Google Scholar]
  48. Youbing, Y.; Xinyue, L.; Ran, L. Effects of Glycyrrhiza polysaccharides on Growth Performance and Growth Gene Expression in Weaned Piglets. Jiangsu Agric. Sci. 2023, 13, 182–189. [Google Scholar]
  49. Lou, R. Effects of Glycyrrhiza polysaccharides on Growth Performance and Expression of PRRSV-Related Genes in Piglets. Master’s Thesis, Henan University of Science and Technology, Zhengzhou, China, 2021. [Google Scholar]
  50. Li, J. Effects of glycyrrhiza polysaccharides on Growth Performance and Intestinal Health of Weaned Piglets. Ph.D. Thesis, Yangzhou University, Yangzhou, China, 2022. [Google Scholar]
  51. Jianfang, L.; Rudu, W.; Pengli, Z. Effects of Glycyrrhiza polysaccharides on growth performance, blood routine, serum biochemical indexes and antioxidant properties of weaned piglets. Feed. Ind. 2022, 43, 32–37. [Google Scholar]
Jmse 12 01036 g001
Figure 1. Effects of licorice on survival rate and growth of Asian seabass. (A) survival, (B) weight gain (WG), (C) feed intake (FI), (D) specific growth rate (SGR); means within rows with the same superscript are not significantly different (p > 0.05), while the different letters mean significant differences (p < 0.05).
Figure 1. Effects of licorice on survival rate and growth of Asian seabass. (A) survival, (B) weight gain (WG), (C) feed intake (FI), (D) specific growth rate (SGR); means within rows with the same superscript are not significantly different (p > 0.05), while the different letters mean significant differences (p < 0.05).
Jmse 12 01036 g001
Jmse 12 01036 g002
Figure 2. The relative effect of licorice on the level of growth-related genes in the liver tissue. Note: Different letters indicate significant differences. Subscripts 1, 2, and 3 represent GHR, IGF1, and IGF2, respectively.
Figure 2. The relative effect of licorice on the level of growth-related genes in the liver tissue. Note: Different letters indicate significant differences. Subscripts 1, 2, and 3 represent GHR, IGF1, and IGF2, respectively.
Jmse 12 01036 g002
Jmse 12 01036 g003
Figure 3. The relative effect of Glycyrrhiza uralensis on the level of growth-associated genes in the muscle tissue. Note: Different letters indicate significant differences. Subscripts 1, 2, and 3 represent IGF2R, MSTN1, and MSTN2, respectively.
Figure 3. The relative effect of Glycyrrhiza uralensis on the level of growth-associated genes in the muscle tissue. Note: Different letters indicate significant differences. Subscripts 1, 2, and 3 represent IGF2R, MSTN1, and MSTN2, respectively.
Jmse 12 01036 g003
Jmse 12 01036 g004
Figure 4. The relative effect of Glycyrrhiza uralensis on the level of growth-associated genes in the brain tissue. Note: The letters indicate significant differences. Subscripts 1 and 2 represent GH, and GHRH, respectively.
Figure 4. The relative effect of Glycyrrhiza uralensis on the level of growth-associated genes in the brain tissue. Note: The letters indicate significant differences. Subscripts 1 and 2 represent GH, and GHRH, respectively.
Jmse 12 01036 g004
Table 1. Feed formula and the list of ingredients.
Table 1. Feed formula and the list of ingredients.
Ingredients Diets
Control Group
(0% G.)		Test Group
(1% G.)		Test Group
(3% G.)		Test Group
(5% G.)
Fish meal (Fm)50505050
Wheat flour (Wf)23222018
Soybean meal (Sm)12.912.912.912.9
Vitamin premix (Vp) (1)0.50.50.50.5
Mineral premix (Mp) (2)0.50.50.50.5
Fish oil (Fo)13131313
Glycyrrhiza meal (G. m)0135
Choline chloride (Cc)0.10.10.10.1
Dry ingredients (%)
Crude protein (Cp)41.4441.3141.0640.81
Crude lipid (Cl)17.5317.5117.4617.41
Crude ash (Ca)9.269.229.139.05
Total energy (Te)20.2820.1219.7919.46
Notes: (1) Vp: VA 900,000 IU, VB1 320 mg, VB2 1090 mg, VB5 2000 mg, VB6 500 mg, VB12 116 mg, VC 5000 mg, VD 250,000 IU, VE 50 IU, VK3 60 IU, niacin 40 mg, folic acid 5 mg, phaseomannite 150 mg, calcium pantothenate 20 mg, biotin 0.2 mg. (2) Mp: MgSO4·7H2O 3.0 g·100 g−1, KCl 0.7 g·100 g−1, KI 0.015 g·100 g−1, ZnSO4·7H2O 0.14 g·100 g−1, MnSO4·4H2O 0.03 g·100 g−1, CuCl2 0.05 g·100 g−1, CoCl·6H2O 0.005 g·100 g−1, FeSO4·7H2O 0.15 g·100 g−1, KH2PO4·H2O 45.0 g·100 g−1, CaCl2 28.0 g·100 g−1. The dietary energy was calculated as protein (23.64 MJ·kg−1), carbohydrate (17.15 MJ·kg−1), and lipid (39.54 MJ·kg−1). Source of materials: fish meal (Changsheng fishmeal factory, Cangzhou, China), wheat flour (Shandong developed face industry Co., Ltd., Dezhou, China), soybean meal (China Textile grain and oil Co., Ltd., Rizhao, China), vitamin premix (Henan Fangmu Shanze biological technology Co., Ltd., Nanyang, China), mineral premix (Henan Fangmu Shanze biological technology Co., Ltd., Nanyang, China), fish oil (Rongcheng City sea source fish oil aquatic products Co., Ltd., Rongcheng, China), glycyrrhiza meal (Longzhilin Medicine Store, Lingshui, China), Choline chloride (Taian Havay Group Co., Ltd., Tai’an, China).
Table 2. Primer of growth-related genes in barramundi were used in qPCR.
Table 2. Primer of growth-related genes in barramundi were used in qPCR.
Gene ClassificationGeneSampleSequence (5′-3′)Amplicon Size (bp)Accession No.
Growth-related geneGHRHbrainF: GCGTGTTGTTGCACAGGCC121XM018681526
R: CTACAGGCCGGTGTTGTTTA
GHF: AGGTGTTGTTGACAGGCAC86X59378
R: AACTCCCAGGTGTTGTTCAA
GHRliverF: AAGGTGTTGTTAACAGGCAGC206XM_018702498
R: GCACGTGTTGTTGACAGGCGC
IGF1F: TGACAGGCGGTGTGTTGTTCT144EU136176
R: TGGTGTTGTTTACTAACCT
IGF2F: AGACAGGCAAGTGTTGTTGTG131XM_018664155
R: GAAGATAACCTGCTCCTGTG
IGF2RmuscleF: AGCTGGAAACCCCGAATT150XM_018687313.1
R: GAGCGAGACAGGCTGGATA
MSTN1F: AACTGCGAATGAAAGAAGCTC204XM_018696695
R: CTTGGACGATGGACTCAGGT
MSTN2F: GTCTGTTCAGCCTCAGTCCA145XM_018661271
R: CGGGTGTTGTTTCCCTCTTT
R: GACGTCCAATGGGCTTTCT
R: CAAACAGGGTGATGGGGTA
β-actin F: AACCAAACGCCCAACAACT112XM_018667666
R: ATAACTGAAGCCATGCCAATG
Notes: Hormone–releasing hormone (GHRH), growth hormone (GH), growth hormone receptor (GHR), insulin-like growth factor 1 (IGF1), insulin-like growth factor 2 (IGF2), IGF2 receptor (IGF2R), myostatin 1 (MSTN1), and myostatin 2 (MSTN2). The PCR efficiency of the primers listed in the table has been verified to be 90–110%.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, R.; Zhao, W.; Wang, Y.; Fu, Z.; Hu, J.; Zhou, S.; Li, M.; Ma, Z. Effect of Licorice on Gene Expression Related to the Growth of Asian Seabass Lates calcarifer. J. Mar. Sci. Eng. 2024, 12, 1036. https://doi.org/10.3390/jmse12071036

AMA Style

Yang R, Zhao W, Wang Y, Fu Z, Hu J, Zhou S, Li M, Ma Z. Effect of Licorice on Gene Expression Related to the Growth of Asian Seabass Lates calcarifer. Journal of Marine Science and Engineering. 2024; 12(7):1036. https://doi.org/10.3390/jmse12071036

Chicago/Turabian Style

Yang, Rui, Wang Zhao, Yifu Wang, Zhengyi Fu, Jing Hu, Shengjie Zhou, Minghao Li, and Zhenhua Ma. 2024. "Effect of Licorice on Gene Expression Related to the Growth of Asian Seabass Lates calcarifer" Journal of Marine Science and Engineering 12, no. 7: 1036. https://doi.org/10.3390/jmse12071036

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop