Two New Pseudochromadora Species (Nematoda: Desmodorida) from South Korea Based on Morphological and Molecular Evidence ^†

Abstract

During a survey of the west coast of South Korea, two new Pseudochromadora species were recorded from Yeongjongdo Island. Descriptions of two new species, an updated list of valid species within the genus, a tabular key, partial sequences of mtCOI, near full-length SSU, and the D2–D3 region of LSU rDNA, together with phylogenetic analyses are provided. The two new species are classified as Pseudochromadora based on having a two-portioned cephalic capsule, unispiral amphidial fovea, lateral alae extending from the posterior end of the pharynx as far as the tail, and presence of copulatory thorns, as well as a short conical tail. The two species are distinguished from each other by their different types of labial regions of the cephalic capsule (round-shaped vs. hat-shaped). The two species, despite being found in the same locality, are morphologically and molecularly distinct from one another. Pairwise Kimura 2-parameter (K2P) distances between the two new species were 10.6% (18S) and 27.2% (28S), values consistent with interspecific divergence observed among congeners. Phylogenetic analyses showed both species as distinct lineages within Pseudochromadora. In the 28S rDNA tree, each was retrieved as a well-supported monophyletic clade with congeners, whereas in the 18S tree, all congeners including the two new species formed a single clade, except for P. plurichela, which branched outside the main group. These results highlight potential paraphyly within Pseudochromadora and suggest that overlooked morphological traits may hold phylogenetic significance, warranting further investigation.

1. Introduction

The genus Pseudochromadora Daday, 1899 was established by Daday in 1899 with P. quadripapillata Daday, 1899 as the type species [1]. Pseudochromadora is classified within the family Desmodoridae Filipjev, 1922, which is a largely heterogeneous group of mostly marine nematodes [2]. Desmodoridae currently includes six subfamilies (Desmodorinae Filipjev, 1922; Molgolaiminae Jensen, 1978; Prodesmodorinae Lorenzen, 1981; Pseudonchinae Gerlach & Riemann, 1973; Spiriniinae Chitwood, 1936; Stilbonematinae Chitwood, 1936), to which Pseudochromadora belongs within the subfamily Desmodorinae. Importantly, the family Desmodoridae lacks a defining synapomorphy and is differentiated from the neighboring families Draconematidae Filipjev, 1918 and Epsilonematidae Steiner, 1927, primarily through exclusionary criteria [3].

According to Lorenzen’s taxonomy (1981; 1994 English adaptation), Pseudochromadora was originally one of six subgenera included within Desmodora de Man, 1889 [4]. However, Lorenzen’s broad concept of Desmodora, which included Bolbonema Cobb, 1920, Croconema Cobb, 1920, Desmodorella Cobb, 1933, Pseudochromadora, and Zalonema Cobb, 1920, resulted in a highly heterogeneous genus with considerable taxonomic disorder. Subsequent revisions demonstrated that several subgenera were in fact distinct entities, and Croconema, Pseudochromadora, and Zalonema were reinstated at the genus level [3,5]. Pseudochromadora species are found in diverse sediment types and habitats, including estuaries, mangroves, and intertidal shores, from tropical to cold seas. They are regarded as cosmopolitan, occurring even in brackish or freshwater environments [6]. Currently, 15 valid species are reported worldwide [7].

Molecular analyses of SSU sequences have shown that the family Desmodoridae is highly polyphyletic [8], while the subfamilies Desmodorinae and Spiriniinae are likewise non-monophyletic [9,10], and the status Stilbonematinae varies among sources [8,11,12,13], emphasizing the necessity of additional data. Much like the case of its parent family, molecular data for Pseudochromadora has been limited. The first sequences (D2–D3 region of the LSU rDNA) were provided by Mordukhovich et al. (2015) when reporting Pseudochromadora rossica Mordukhovich, Fadeeva, Semenchenko & Zograf, 2015 [14]. Since then, SSU and LSU sequences of Pseudochromadora thinaiica Zograf, Skripova, Semenchenko, Vu, Nguyen, Phan & Mordukhovich, 2021, and Pseudochromadora plurichela Leduc & Zhao, 2023 have become available [14,15,16]. However, several uncertain entries exist, such as the SSU sequence of Pseudochromadora obsesa (MK626770), which does not represent a valid species of Pseudochromadora, as well as sequences lacking species-level identification. Nonetheless, the most recent phylogenetic work on the genus by Zograf et al. (2021) confirmed the monophyly of Pseudochromadora using 18S and 28S rDNA [16].

In this study, we describe two new species of Pseudochromadora from Yeongjongdo Island, South Korea, combining detailed morphology with molecular evidence. Their placement was evaluated against the phylogeny of Zograf et al. (2021) [16], with our trees largely consistent but showing some discrepancies that may suggest a possible paraphyletic state of Pseudochromadora. These findings highlight the need for continued combination of morphological and molecular approaches to refine the taxonomy and phylogeny of the genus.

2. Materials and Methods

2.1. Sample Collection and Morphological Analysis

Sampling was conducted in March 2025 at Seonnyeobawi Beach, a rocky intertidal site on Yeongjongdo Island, Incheon, located along the west coast of South Korea. The shore consists of extensive rock formations interspersed with coarse shell gravel, with areas of sandy and silty deposits. Sediments were collected during low tide by scraping the uppermost layer with a hand shovel. Scraped sediment was washed by repeated decantation in a bucket filled with filtered freshwater, and the supernatant containing organisms was retained. This procedure was repeated multiple times until sufficient qualitative material had been obtained. The concentrated supernatant was divided into two subsamples: one fixed on-site in 5% neutralized formalin for morphological examination, and the other preserved in 99% ethanol for molecular analyses. Fixed samples were brought back to the laboratory and ethanol-preserved samples were kept at −24 °C, while formalin-fixed material was stored at room temperature.

For morphological study, formalin-fixed samples were transferred to Petri dishes and sorted under a dissecting microscope Olympus SZX7 (Olympus, Tokyo, Japan). Individual nematodes were hand-picked and placed in a 10% glycerol-distilled water solution. The dishes were kept in a dry oven at 40 °C for two to three days, allowing gradual evaporation and transfer of specimens into pure glycerin without damaging the specimens.

Permanent mounts were prepared on glass slides using the wax-ring method [17]. Selected specimens were examined and photographed with a Nikon Eclipse 80i compound microscope (Nikon, Tokyo, Japan) equipped with a KOPTIC HK-XCAM2160 digital camera (KOPTIC, Gyeonggi-do, Republic of Korea). Measurements were taken using Fiji software v. 1.54 [18]. Line drawings were first sketched in pencil with the aid of a drawing tube attached to the same microscope and subsequently finalized as digital illustrations.

2.2. DNA Extraction and Amplification

Individual nematodes were hand-picked from ethanol-preserved material and placed on temporary glass slide mounts for rapid examination under a compound microscope. This step ensured accurate species-level identification prior to molecular processing. Each specimen was photographed to generate a digital voucher and permanent record. Specimen of interest were then rinsed in ultrapure water for 20 min in separate wells of a 12-well plate.

Genomic DNA was extracted using the HotSHOT protocol of Meeker et al. (2007) [19], yielding 110 µL of template solution. For each nematode, 95 µL ultrapure water and 5 µL of 1 M NaOH were added to a microcentrifuge tube containing the specimen. The mixture was incubated at 95 °C for 20 min in a thermocycler, cooled to 4 °C for 5 min, and centrifuged. Neutralization was achieved by adding 10 µL of 1 M Tris-HCl, producing DNA templates suitable for PCR. Extracts were either used immediately or stored at −24 °C for later use.

PCR amplification was carried out with IP-Taq premix (COSMOgenetech, Seoul, Republic of Korea). Each 20 µL reaction contained 6 µL of DNA template, 2 µL ultrapure water, and 1 µL of each primer. Primer sequences, thermal cycling conditions, and references are listed in

Table 1. Details of primer sequences, PCR conditions, and corresponding references.

Gene	Primer (f/r)	Sequence (5′–3′)	PCR Condition	Reference
mtCOI	JB3 (f)	TTTTTTGGGCATCCTGAGGTTTAT	Initial denaturation: 94 °C for 5 min; 5 cycles of 94 °C for 30 s, 54 °C for 30 s, 72 °C for 30 s; 35 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s; Final extension: 72 °C for 10 min.	[20]
	JB5 (r)	AGCACCTAAACTTAAAACATAATGAAAATG
18S	988F (f)	CTCAAAGATTAAGCCATGC	Initial denaturation: 94 °C for 5 min; 5 cycles of 94 °C for 30 s, 45 °C for 30 s, 72 °C for 70 s; 35 cycles of 94 °C for 30 s, 54 °C for 30 s, 72 °C for 70 s; Final extension: 72 °C for 5 min.	[21]
	1912R (r)	TTTACGGTCAGAACTAGGG
	1813F (f)	CTGCGTGAGAGGTGAAAT
	2646R (r)	GCTACCTTGTTACGACTTTT
28S	D2A (f)	ACAAGTACCGTGAGGGAAAGTTG	Initial denaturation: 95 °C for 5 min; 37 cycles of 95 °C for 30 s, 56 °C for 1 min, 72 °C for 90 s; Final extension: 72 °C for 5 min.	[22]
	D3B (r)	TCGGAAGGAACCAGCTACTA

. Amplicons were verified on a 1% agarose gel, and successful products were purified and sequenced at Bioneer (Bioneer, Daejeon, Republic of Korea).

2.3. Phylogenetic Analysis

Chromatograms were initially processed in FinchTV v.1.4.0 (Geospiza, Inc., Seattle, WA, USA; https://digitalworldbiology.com/FinchTV, accessed on 1 June 2025), where sequence quality was checked by comparing complementary strands. Forward and reverse reads were subsequently aligned in MEGA v.11.0.13 using the ClustalW algorithm [23,24]. For SSU rDNA, which was amplified in two separate fragments, the sequences were combined with the online tool EMBOSS Merger (https://www.bioinformatics.nl/cgi-bin/emboss/merger, accessed on 1 June 2025) to obtain nearly complete 18S rRNA sequence. The resulting assemblies were then compared with GenBank entries using BLAST+ v.2.15.0 (NCBI webserver, accessed on 1 June 2025) to confirm sequence identity and rule out potential contamination. For phylogenetic analysis, all publicly available SSU and LSU sequences of Pseudochromadora, along with representatives of closely related genera within the family Desmodoridae and Draconematidae, as well as members of Monoposthiidae as outgroups, were retrieved. The sequences used in phylogenetic analysis are listed in Supplementary Table S1. Although mtCOI was successfully amplified, it was excluded from phylogenetic analysis due to the absence of comparable sequences from congeners (

Table 2. GenBank accession number of sequences obtained in this study. (“–” indicates unsuccessful amplification).

Specimen	Species Name	Voucher Number	Genbank Accession Number
			mtCOI	18S	D2-D3
			JB3	988F, 1813F	D2A
			/JB5	/1912R, 2646R	/D3B
			(~390 bp)	(~1600 bp)	(~730 bp)
1	Pseudochromadora typica sp. nov.	1E	–	PX314175	PX331588
2	Pseudochromadora typica sp. nov.	1F	–	PX314176	–
3	Pseudochromadora typica sp. nov.	1K	–	PX314177	PX331589
4	Pseudochromadora microacantha sp. nov.	1H	–	PX314178	–
5	Pseudochromadora microacantha sp. nov.	1I	–	PX314179	PX331586
6	Pseudochromadora microacantha sp. nov.	1J	PX314183	PX314180	PX331587

).

Pairwise genetic distances for the SSU and LSU rDNA sequences of Pseudochromadora species were calculated using the Kimura 2-parameter (K2P) model implemented in MEGA 11 [25]. Congeneric sequences retrieved from GenBank were aligned in MEGA 11 for subsequent phylogenetic analysis of ribosomal markers.

Bayesian inference (BI) analyses were performed using MrBayes v.3.2.6 [26], with the best-fit substitution models selected via jModelTest v.2.1.7 [27]. For the SSU rDNA dataset, model parameters were as follows: Lset base = (0.2565, 0.2121, 0.2621, 0.2693), nst = 6, rmat = (0.9045, 2.6587, 1.4597, 0.8017, 4.6343, 1.0000), rates = invgamma, shape = 0.4740, ncat = 4, pinvar = 0.3650. Markov Chain Monte Carlo (MCMC) analyses were run with ngen = 1,000,000, nchains = 4, samplefreq = 100, savebrlens = yes, printfreq = 1000, sump burnin = 250, and sumt burnin = 250.

For the LSU rDNA dataset, model parameters were as follows: Lset base = (0.2271, 0.2191, 0.2989, 0.2549), nst = 6, rmat = (0.5108, 2.1511, 1.0000, 0.5108, 4.7101, 1.0000), rates = invgamma, shape = 0.6810, ncat = 4, pinvar = 0.1790. Markov Chain Monte Carlo (MCMC) analyses were run with ngen = 1,000,000, nchains = 4, samplefreq = 100, savebrlens = yes, printfreq = 1000, sump burnin = 250, and sumt burnin = 250.

Maximum Likelihood (ML) analyses were conducted in IQ-TREE (v.2.0.3, multicore) [28] with model selection performed by ModelFinder [29] using the Akaike Information Criterion. For both the 18S and 28S datasets, the GTR + F + I + G4 model was identified as the best-fitting substitution model and was applied in subsequent IQ-TREE analyses using the ultrafast bootstrap approach with 1000 replicates. All resulting consensus trees were visualized and edited using FigTree v.1.4.4 [30].

3. Results

3.1. Morphological Analysis

• Systematics

Class Chromadorea Inglis, 1983.

Order Desmodorida De Coninck, 1965.

Family Desmodoridae Filipjev, 1922.

Subfamily Desmodorinae Filipjev, 1922.

Genus Pseudochromadora Daday, 1899.

• Diagnosis (updated from Leduc & Zhao 2023) [15].

Short cylindrical body with short cephalic capsule and short conical tail. Lateral alae usually extending from posterior to the pharynx (except in P. plurichela) where it extends from about mid-pharynx) to the tail region. Short somatic setae arranged in six or eight longitudinal rows. Cephalic capsule usually consisting of slender labial portion, either round- or hat-shaped, followed by thickened cuticle; a sutura sometimes present between the two portions. Four cephalic setae located on labial portion of cephalic capsule on anterior rim of the main portion. Unispiral amphidial fovea, sometimes with sexual dimorphism in shape or size, located on the main portion of cephalic capsule. Short cylindrical pharynx with posterior bulb. Males of most species with copulatory and post-cloacal thorns (with exception to few species without), arched spicules and gubernaculum with capitulum.

Type species: Pseudochromadora quadripapillata Daday, 1899

• List of valid species

• Pseudochromadora benepapillata (Timm, 1961) Datta, Ganguly & Chakraborty, 2018 (Datta, Ganguly & Chakraborty, 2018: 167–172, Figures 2–4, Table 1; Jharkhali, South 24 Parganas, West Bengal, India, Estuarine mudflat near a water vessel jetty) [31].
• Pseudochromadora buccobulbosa Verschelde & Vincx, 1995 (Verschelde & Vincx, 1995: 24–32, Figures 5–8, Tables 5 and 6; Gazi, Kenya, flood-tide zone among mangrove bushes) [32].
• Pseudochromadora cazca Gerlach, 1956 (as Desmodora cazca, Gerlach, 1956: 16–17, Abb. 10a–c; Porto Novo (São Sebastião) and Cananéia, Brazil, tidal flats and mangrove sediments) [33].
• Pseudochromadora coomansi Verschelde & Vincx, 1995 (Verschelde & Vincx, 1995: 19–24, Figures 3 and 4, Plate 4, 5, Tables 3 and 4; Gazi, Kenya, sandy coarse sandy sediments from sandbank of mangrove bushes) [32].
• Pseudochromadora galeata Verschelde, Nicholas & Vincx, 2006 (Verschelde, Nicholas & Vincx, 2006: 27–33, Figures 3–6, Tables 3 and 4; Waterfall Creek on the Clyde River estuary at Batemans Bay, S.E. New South Wales, Australia, Avicennia mudflats) [6].
• Pseudochromadora gomoi Muresan, Motoc, Menabit, Teaca & Begun, 2022 (Muresan, Motoc, Menabit, Teaca & Begun, 2022: 5–11, Figures 1–4, Table 1; Circalittoral zone of the Romanian Black Sea, depth 59 m) [34].
• Pseudochromadora incubans Gourbault & Vincx, 1990 (Gourbault & Vincx, 1990: 137–141, Figures 4, 5A–G and 6A–C; Grand Cul-de-Sac Marin, Guadeloupe, French Antilles, littoral meiobenthos) [35].
• Pseudochromadora interdigitata Muthumbi, Verschelde & Vincx, 1995 (Muthumbi, Verschelde & Vincx, 1995: 186–190, Figures 4A–J and 5A–F, Table 2; Guadeloupe, Grand Cul-de-Sac Marin, Lagune de Belle Plaine, Marine mangrove on muddy banks) [36].
• Pseudochromadora parva Gagarin & Thanh, 2008 (Gagarin & Thanh, 2008: 8–11, Figure 3, Table 3; Thaibinh, Red river estuary, Vietnam, mangrove forest from fine silt, depth 1–2 m) [37].
• Pseudochromadora plurichela Leduc & Zhao, 2023 (Leduc & Zhao, 2023: 98–101, Figures 56 and 57, Table 16; Pāuatahanui Inlet, Wellington region, lower North Island, New Zealand) [15].
• Pseudochromadora quadripapillata Daday, 1899 (Daday, 1899: 562–563, Berlinhafen, Seleu Island, New Guinea. Coomans, Vincx & Decraemer, 1985: 268–272, Figures 3 and 4; Uipi Island, Marovo Lagoon, Solomon Islands, deep pool in a coral rock, as Desmodora (Pseudochromadora) quadripapillata) [1,38].
• Pseudochromadora reathae Leduc & Wharton, 2010 (Leduc & Wharton, 2010: 52–56, Figures 1–4, Table 1; Harwood (upper intertidal), Otago Harbour, southern New Zealand, unvegetated sandy sediment) [39].
• Pseudochromadora rossica Mordukhovich, Fadeeva, Semenchenko & Zograf, 2015 (Mordukhovich, Fadeeva, Semenchenko & Zograf, 2015: 128–133, Figures 1–4, Table 1; Sea of Japan, Peter the Great Bay, Russky Island, depth ~0.3 m muddy sediment) [14].
• Pseudochromadora securis Verschelde, Nicholas & Vincx, 2006 (Verschelde, Nicholas & Vincx, 2006: 37–39, Figures 7–10, Table 5; Waterfall Creek, Clyde River estuary, Batemans Bay, southern New South Wales, Australia; Avicennia mudflats) [6].
• Pseudochromadora thinaiica Zograf, Skripova, Semenchenko, Vu, Nguyen, Phan & Mordukhovich, 2021 (Zograf, Skripova, Semenchenko, Vu, Nguyen, Phan & Mordukhovich, 2021: 175–178, Figures 1–5, Table 1; Thi Nai Lagoon, Vietnam, intertidal flat with muddy sediment) [16].

• Description

Pseudochromadora microacantha sp. nov. (Figure 1 and Figure 2 and

Table 3. Measurement of Pseudochromadora microacantha sp. nov. (All measurements in µm; “N/V” indicating not visible; counts including holotype and allotype, otherwise paratypes; “–” indicating not applicable).

Characters	Male		Female
	Holotype ♂	Paratype Male (Male Mean)	Allotype ♀	Females (n = 3) Mean ± sd (Range)
L	750	990 (870)	1055	969 ± 61.3 (915–1055)
hd	22	22 (22)	23	23 ± 0.2 (22.5–23)
LSL	4	4 (4)	4	4 ± 0.2 (3.5–4)
CSL	4	3.5 (4)	4	4 ± 0.2 (3.5–4)
Anterior end to anterior of alae	141	170 (156)	152	158 ± 5.3 (152–165)
Posterior end to posterior end of alae	57	67.5 (62)	76	65 ± 8.6 (55.5–76)
Distance of annulation from anterior end	18	17 (18)	17.5	18 ± 0.8 (17–19)
Distance of annulation from posterior end	22	25 (24)	26	25 ± 2.2 (22–27)
Anterior end to amp	9.3	7.5 (8.4)	10	9 ± 0.8 (8.2–10)
amp	8	8.2 (8.1)	8.4	8 ± 0.6 (7–8.4)
amp cbd	25.5	24 (24.7)	26.5	26 ± 0.6 (25–26.5)
hcd (cap diameter)	25.5	25.5 (25.5)	26	27 ± 0.5 (26–27)
NL	57	65 (61)	62.5	N/V
ncbd	41	47 (44)	48	N/V
Cardia length	16	19 (17.5)	19.5	N/V
PL	124.5	150 (137)	146	147 ± 4.9 (141–153)
pcbd	47.5	59 (53)	55	54 ± 1.1 (52.5–55)
mbd	54.5	60 (57)	77	69 ± 5.6 (64–77)
VL	–	–	550	520 ± 24.5 (490–550)
anterior ovary	–	–	197.5	205 ± 23.4 (180–236)
posterior ovary	–	–	234	216 ± 14 (200–234)
abd	29.5	33 (31)	30	29 ± 1.2 (27.5–30)
spia	49	49 (49)	–	–
gub	27.5	29 (28)	–	–
TL	71	84 (78)	83	78 ± 3.7 (74–83)
a	13.8	16.5 (15)	13.7	14 ± 0.2 (13.7–14.3)
b	6.0	6.6 (6.3)	7.2	7 ± 0.5 (6.1–7.2)
c	10.6	11.8 (11.2)	12.7	12 ± 0.2 (12.2–12.7)
c′	2.4	2.5 (2.4)	2.8	3 ± 0.1 (2.5–2.8)
V	–	–	0.52	0.54 ± 0.01 (0.52–0.55)
amp′	0.31	0.34 (0.32)	0.32	0.3 ± 0.02 (0.27–0.32)
s′	1.7	1.48 (1.6)	–	–

).

• Etymology

The species name is derived from the Greek roots ‘mikros’ (“small”) and ‘akantha’ (“thorn, spine”), Latinized as micro- and -acantha, referring to the presence of minute spine/thorn-like ventral somatic setae embedded in the precloacal region of the species.

Zoobank registration: urn:lsid:zoobank.org:act:5B599170-F57E-44A4-93A0-4013F77B5FA4.

Locality: collected from a sandy subtidal zone of Sunnyeobawi Beach (37.439457, 126.378285), Jung-gu, Incheon, Korea.

Materials examined: holotype (NIBRIV0000927427), allotype (NIBRIV0000927427; on same slide as holotype), one paratype males (NIBRIV0000927428) and two paratype females (NIBRIV0000927429; two specimens on one slide); deposited to National Institute of Biological Resources (Incheon, Korea). All specimens were collected on 28 March 2025.

• Description:

Males: Body short, stout, and cylindrical with a slight brownish hue. Cuticle distinctly annulated without lateral differentiation (Figure 1A,C). Lateral alae extending from near the posterior end of pharynx, about 141 μm from the anterior end, and terminating slightly beyond the cloacal opening, at a point 57 μm anterior to the tail tip. Body annuli interdigitate at level of lateral alae, split up into two or three narrow annules. Six longitudinal rows of strong somatic setae running from cephalic capsule to tail. Cephalic capsule distinctly set off from the rest of body, consisting of two regions: a short anterior lip region and a posterior main region, each region clearly distinguished by suture. Lip region helmet- or hat-shaped (Figure 2C), containing lips with six tiny inner labial sensillae followed by a ring of six outer labial sensillae and four cephalic setae. Main head region wider than the lip region, with amphidial fovea, unispiral in males 31% of the body diameter, situated anterior to the posterior edge of the cephalic capsule (Figure 2A). Buccal cavity small with large dorsal tooth in pharyngostome supported by ventral plug (Figure 2C). Pharynx cylindrical leading up to swollen, oval pharyngeal bulb, nerve ring located slightly anterior to middle of pharynx. Cardia triangular in shape, anteriorly encased in pharyngeal tissue, posteriorly surrounded by intestine (Figure 1A,C). Reproductive system monorchic with one outstretched testis, situated left of the intestine (Figure 1C). Spicules narrow and arcuate with distinct capitula, 1.5–1.7 cloacal body diameters long. Gubernaculum also slightly arcuate at proximal end, curving anteriorly. Ventral precloacal setae 10–12 in number, arranged in a longitudinal row immediately anterior to cloacal opening, minute thorn-like in form, seemingly embedded within cuticle layer (Figure 1F and Figure 2F). Copulatory thorns in two groups: first two pairs around cloacal opening, and an additional single pair situated ventrally at mid-tail (Figure 1F). Caudal glands inflated and extended anteriorly beyond cloacal opening, pushing terminal portion of intestine ventrally (Figure 1F and Figure 2F). Tail conical with non-annulated tail tip.

Females: Similar to males but with slightly smaller amphidial fovea (amp’ = 0.3–0.27 vs. 0.31–0.34 in males), and cryptospiral amphidial fovea shaped like a comma (as opposed to unispiral in males, Figure 1B and Figure 2B). Reproductive organs with two opposed and reflexed ovaries. Vulva located at 53–55% of body length from anterior end (Figure 1D,E).

• Diagnosis and relationships:

Pseudochromadora microacantha sp. nov. can be distinguished primarily by its hat- or helmet-shaped lip region of the cephalic capsule. Among the 15 valid species of the genus, only six (P. securis, P. galeata, P. benepapillata, P. parva, P. thinaiica, and P. microacantha sp. nov.) possess this trait (

Table 4. Morphometric comparison of measurements between all valid species of Pseudochromadora (updated and modified from Muresan et al., 2022 [34]. All measurements from male specimens, all measurements in µm, “N/A” indicating not available, “calc” indicating calculated from provided measurements or measured directly from figure).

Species	Labial Region Shape	L (µm)	mbd (µm)	TL (µm)	amp (µm)	a	b	c	c′	amp′ (%)	spia (µm)	gub (µm)
P. benepapillata	hat-shaped	567–671	33–37	63–69	7–8	16.6–19.5	5.2–5.5	8.2–10.6	2.4–2.8	N/A	48–53	13–15
P. buccobulbosa	rounded	617–756	31–36	94–106	6–8	19–22.1	5.2–5.6	6.5–7.3	4.1–4.4 (calc)	23–28	31–43	13–18
P. cazca	rounded	668	45	88	7	14.8	5.1	7.6	3.5 (calc)	N/A	40	Present (not measured)
P. coomansi	rounded	787–933	38–46	108–134	8	17.9–22.3	6.3–8.3	6.7–8.2	4.6–4.9 (calc)	29–33	38–47	23–26
P. galeata	hat-shaped	569–726	32–42	60–76	7–8	13.9–19.4	4.9–6.5	8.1–11.6	N/A	N/A	51–56	14–19
P. gomoi	rounded	1479–1852	65–85	93–125	12–13	20.6–27.9	7.0–8.1	12.7–15.8	N/A	27–34	51–66	21.5–36.8
P. incubans	rounded	615–810	40	85	N/A	17.3–24.6	5.4–6.3	8.2–9.9	N/A	33	N/A	18–20
P. interdigitata	rounded	735–938	40–44	88–94	5–7	18–21.5	5.9–7	8–10	N/A	20–30	44–46	18–20
P. parva	hat-shaped	400–531	N/A	71–87	N/A	14–18	4.4–5.5	4.8–6.6	3.4–4.9	38–40	28–31	13–14
P. plurichela	rounded	802–830	45	80–85	13	18	6	10	2.2–2.4	45–50	53–55	20–21
P. quadripapillata	rounded	990–992	27–29	59–118	7	34.1	9.2–9.3	N/A	2.2–3.3	40	31–34	17–21
P. reathae	rounded	550–665	32–33	51–62	6–7	17–20	6	10–11	N/A	30–35	32	13–15
P. rossica	rounded	712–782	35–40	87–108	18–27	17.8–22	6.1–6.8	7.1–8.2	N/A	5–6	38–50	15–17
P. securis	hat-shaped	587–811	37–50	81–90	9–11	15.9–16.5	4.7–5.5	7.3–10	N/A	31–37	59–61	14–16
P. thinaiica	hat-shaped	412–605	30–37	61–85	6.5–7	11–19	4.9–6.6	6.7–7.1	N/A	N/A	39–48	16–19
P. microacantha sp. nov. (current study)	hat-shaped	750–990	54.5–60	71–84	8.0–8.2	13.8–16.5	6.0–6.6	10.6–11.8	2.4–2.5	31.4–34.1	49.0–49.0	27.5–29.0
P. typica sp. nov. (current study)	rounded	881–937	43–49	106–110	7–7	19.1–20.5	6.6–7.3	8.3–8.5	3.3–3.7	29–32	39–46	17.5–18

), while the others have a rounded cephalic capsule. Within this subset, P. microacantha sp. nov. most closely resembles P. securis, as both exhibit sexual dimorphism in the amphidial fovea (unispiral in males and cryptospiral in females), the presence of post-cloacal copulatory thorns, and a dorsal tooth supported by a ventral plate (Figure 2C), a feature unique to these two species.

Morphometric differences between P. microacantha sp. nov. and P. securis include the b ratio (6.0–6.6 vs. 4.7–5.5, indicating a shorter pharynx relative to body length), the c ratio (10.6–11.8 vs. 7.3–10, indicating a shorter tail relative to body length), spicule length (49.0 µm vs. 59–61 µm, shorter in the new species), and gubernaculum length (27.5–29.0 µm vs. 14–16 µm, longer in the new species) (Table 4).

Morphological distinctions are also evident. P. microacantha sp. nov. bears far fewer somatic setae, giving the body a comparatively smooth appearance (vs. abundant somatic setae throughout the body in P. securis). The first group of copulatory thorns is positioned at the cloacal opening behind the spicules (vs. a ventral group anterior to the cloaca in P. securis). The ventral somatic setae of the new species are represented by a row of approximately 12 micro-thorn-like setae irregularly embedded in place of precloacal supplements (vs. about 16 broad-based ventral setae situated between the first group of copulatory thorns and the cloaca in P. securis) (

Table 5. Tabular key of Pseudochromadora species with hat-shaped labial region cephalic capsule.

Species	Amphidial Shape (Male/Female; Sexual Dimorphism)	Dorsal Tooth with Ventral Plate	Number of Somatic Setae in Longitudinal Rows	Interdigitate/Split of Body Annuli at Lateral Alae	Lateral Alae	Copulatory Thorns	Supplements/Ventral Somatic Setae (VSS)
P. galeata	loop-shaped (open)/unispiral; sexual dimorphism	no	6	yes (2, 3)	from behind posterior edge of cardia extending to level of the post-cloacal thorns on the tail	Two groups: a subventral group of 10–14 copulatory thorns; a ventral group of 4–5 post-cloacal thorns on the tail, flanked by a pair of short, broad somatic setae	VSS: A row of broad ventral somatic setae located between the ventral group of copulatory thorns and the cloaca
P. parva	loop-shaped (open); no mention of sexual dimorphism	no	n/a	n/a	from anterior end of intestine to tail base	Two groups: 8 ventral hillocks armed with thorns, distributed from the end of the pharynx to the cloaca; 3 thorns present on each of the ventral tail hillocks	VSS: Numerous subventrally positioned somatic setae, each 7–10 µm long, distributed along the cuticle
P. thinaiica	crytospiral/cryptospiral; no sexual dimorphism	no	6	yes (2, depicted in SEM)	from posterior to pharyngeal bulb extending to the level of cloaca	Two groups: a group of ventral and subventral thorns located 97–139 µm anterior to the cloaca; a medioventral group of post-cloacal thorns located 22–28 µm posterior to the cloaca	VSS: A ventral row of broad somatic setae present between the precloacal group of copulatory thorns and the cloaca
P. benepapillata	unispiral/cryptispiral; sexual dimorphism	no	n/a	yes	from posterior to cardia and extending to tail region, posterior to the anal opening	Two groups: subventral groups of copulatory thorns located anterior to the cloaca, consisting of four pairs of stout, spicate thorns; a cluster of four smaller thorns in the post-cloacal region	VSS: A series of 18–19 ventral somatic setae located between the copulatory thorns and the cloacal opening
P. securis	unispiral/unispiral; slight sexual dimorphism in size (smaller in females)	yes	6	yes (2)	from posterior to cardia to level of post-cloacal thorns on the tail	Two groups: a ventral and lateroventral group of slightly bent copulatory thorns; post-cloacal thorns arranged ventrally on the tail, with the first few paired and the last ones single	VSS: Sixteen distinct ventral somatic setae with broad bases situated between the ventral group of copulatory thorns and the cloaca
P. microacantha sp. nov. (current study)	unispiral/cryptispiral; sexual dimorphism	yes	6	yes (2)	from posterior to pharyngeal bulb extending to slightly posterior to cloacal opening	Two group: 2 pairs of copulatory thorns at the cloacal opening below spicule; a single pair of post-cloacal thorns located near the midpoint of the tail	VSS: ventral row of 12 micro-thorn-like somatic setae seemingly embedded irregularly in place of precloacal supplements

).

• Description

Pseudochromadora typica sp. nov. (Figure 3 and Figure 4,

Table 6. Measurement of Pseudochromadora typica sp. nov. (All measurements in µm; “N/V” indicating not visible; counts including holotype and allotype, otherwise paratypes; “–” indicating not applicable).

Characters	Male		Female
	Holotype ♂	Paratype Male (Male Mean)	Allotype ♀	Females (n = 3) Mean ± sd (Range)
L	881	937 (909)	876	839 ± 31 (800–876)
hd	22	20 (21)	21	20 ± 0.9 (19–21)
LSL	3.5	4 (5.7)	3.5	4 ± 0.2 (3.5–4)
CSL	5.5	6 (5.7)	5.5	6 ± 0.2 (5.5–6)
Anterior end to anterior of alae	174	175 (174)	166	162 ± 6.1 (153–166)
Posterior end to posterior end of alae	88	95 (92)	91	89 ± 1.7 (87–91)
Distance of annulation from anterior end	17.5	15 (16.2)	18.5	18 ± 0.2 (18–18.5)
Distance of annulation from posterior end	28	32 (30)	26	24 ± 1.6 (22–26)
Anterior end to amp	10	8 (9)	9.5	9 ± 0.1 (9.3–9.5)
amp	7	7 (7)	6.7	7 ± 0.1 (6.5–6.7)
amp cbd	24	22 (23)	24	23 ± 1.2 (21–24)
hcd (cap diameter)	24	23 (23.5)	24	23 ± 0.5 (23–24)
NL	62	54 (58)	58	N/V
ncbd	34	31 (32.5)	34	N/V
Cardia length	14	12 (13)	12.5	N/V
PL	134	128 (131)	118	119 ± 1.9 (116.5–121)
pcbd	39	37.5 (38.2)	41	39 ± 1.2 (38–41)
mbd	43	49 (46)	48	46 ± 2.3 (42.5–48)
VL	–	–	522	498 ± 19.2 (475–522)
anterior ovary	–	–	142	139 ± 14.1 (120–154)
posterior ovary	–	–	137	143 ± 12.2 (132–160)
abd	29	33 (31)	23.5	24 ± 1.2 (23.5–26)
spia	39	46 (42.5)	–	–
gub	17.5	18 (17.7)	–	–
TL	106	110 (108)	101.5	101 ± 2.9 (97–104)
a	20.5	19.1 (19.8)	18.25	18 ± 0.3 (18.1–18.8)
b	6.6	7.3 (6.9)	7.42	7 ± 0.2 (6.9–7.4)
c	8.3	8.5 (8.4)	8.63	8 ± 0.2 (8.1–8.6)
c′	3.7	3.3 (3.5)	4.32	4 ± 0.1 (4–4.3)
V	–	–	0.60	0.59 ± 0 (0.59–0.6)
amp′	0.29	0.32 (0.3)	0.28	0.29 ± 0.01 (0.28–0.31)
s′	1.34	1.39 (1.36)	–	–

).

• Etymology

The species name is derived from the Latin ‘typicus’ (“typical”), in reference to the combination of morphological features that are characteristic of the genus, such as a two-part cephalic capsule, unispiral amphidial fovea, presence of interdigitating lateral alae, copulatory thorns, and arched spicules and gubernaculum with a capitulum.

Zoobank registration: urn:lsid:zoobank.org:act:93F7FD60-C1FB-4A82-B6EE-BFB7905D3516.

Locality: collected from a sandy subtidal zone of Sunnyeobawi Beach (37.439457, 126.378285), Jung-gu, Incheon, Korea.

Materials examined: Holotype (NIBRIV0000927430), allotype (NIBRIV0000927431), one paratype males and two paratype females (NIBRIV0000927431; all on the same slide as allotype) deposited to National Institute of Biological Resources (Incheon, Korea). All specimens were collected on 28 March 2025.

• Description:

Males: Body short, stout, cylindrical, and gradually widening from anterior end to pharyngeal bulb, running cylindrical until rapidly tapering from cloaca towards tail (Figure 3G). Cuticle with distinct transverse annulations, lacking lateral differentiation. Lateral alae extending from 174 µm behind anterior end to region just above post-cloacal thorns; annuli at level of alae interdigitating, splitting into two narrow subannules (Figure 3G). Six longitudinal rows of strong somatic setae densely distributed from cephalic capsule to tail. Cephalic capsule distinctly developed, consisting of an anterior lip region, round-shaped, slightly shorter than the main cephalic region and an enlarged posterior main region reinforced with thickened cuticle; main region broader than lip region, ornamented with numerous minute spots (Figure 3A,D,G). Six inner labial sensilla present, with six outer labial sensilla situated midway between anterior tip and the sutura, and four cephalic setae inserted just above the sutura (Figure 3C,G). Amphidial fovea located at lower margin of capsule, unispiral in male, 7 µm wide, corresponding to 29% of cephalic body diameter (Figure 4B). Buccal cavity small, armed with one large dorsal tooth and two small subventral teeth (Figure 3C,D). Pharynx cylindrical, 134 µm long, terminating in swollen, oval pharyngeal bulb; nerve ring located slightly anterior to middle of pharynx. Cardia triangular in shape, anteriorly encased in pharyngeal tissue, posteriorly surrounded by intestine (Figure 3A). Reproductive system monorchic, with one anterior outstretched testis (Figure 3G). Spicules narrow and arcuate with distinct capitula, 1.3–1.4 anal body diameters long. Gubernaculum also slightly arcuate at proximal end, curving anteriorly. Precloacal copulatory thorns 8–10 in number, situated on a ventral hump anterior to the cloacal opening (Figure 3E). A ventral row of about 20 broad thorn-like setae densely arranged between copulatory thorns and cloaca. Post-cloacal thorns (~5) present between cloaca and tail tip near the level of the terminal point of the lateral alae (Figure 3E and Figure 4E,F). Caudal glands inflated and extended anteriorly beyond cloacal opening, pushing terminal portion of intestine ventrally. Tail conical to elongated conical, with non-annulated tail tip (Figure 3E,G).

Females: Similar to males, but with cryptospiral amphidial fovea shaped like a comma (Figure 4A). Reproductive organs with two opposed and reflexed ovaries (Figure 3A,B). Vulva located at 59–60% of body length from anterior end.

• Diagnosis and relationships:

Pseudochromadora typica sp. nov., as the name suggests, exhibits a combination of morphological features that represent the typical condition of the genus, including a two-part cephalic capsule (round type), unispiral amphidial fovea (with sexual dimorphism, cryptospiral in females), interdigitating lateral alae (body annuli splitting into two), two groups of copulatory thorns (an anterior group situated at some distance from the cloaca and a posterior group near the mid-tail), ventral somatic setae with broad bases extending anteriorly from the cloaca, and arched spicules and gubernaculum with a capitulum.

Among congeners with a rounded cephalic capsule, P. typica sp. nov. most closely resembles P. interdigitatum, with which it shares the presence of body annuli interdigitating at the lateral alae, the arrangement of copulatory thorns anterior to the cloaca, and the presence of post-cloacal thorns (

Table 7. Tabular key of Pseudochromadora species with rounded labial region cephalic capsule.

Species	Amphidial Position	Interdigitate/Split of Body Annuli at Lateral Alae	Amphid Shape (Male/Female; Sexual Dimorphism)	Buccal Cavity of Dorsal Plug Followed by Dorsal Tooth	Number of Longitudinal Rows of Somatic Setae	Suture Between lip Region and Main Region of Cephalic Capsule	Position of Cephalic Setae	Female with Protruded Vulva Lip	Lateral Alae	Copulatory Thorns	Supplements/Ventral Somatic Setae (VSS)
P. incubans	dorsolateral	N/A	described as loop shape for male and female (but cryptospiral depicted); no sexual dimorphism (not mentioned)	no	8	set off (not described, but illustrated)	at amphidial level below first cephalic annule	yes	from 60 μm behind pharyngeal end to cloacal level	Two groups: anterior group of one small and three large horns; posterior group of three small horns, located ventrally in front of the cloacal opening	VSS: pre-anal area somatic setae of subventral rows become more numerous, ventral row of thick setae present
P. buccobulbosa	lateral	yes (2,3)	Unispiral (closed loop-shape)/unispiral (cryptospiral); sexual dimorphism	yes	6	set off (faintly)	in front of (or at) the transition between anterior and posterior region of the cephalic capsule	no	from the fifteenth to twentieth body annule posterior to the pharyngeal endbulb as far as the tail	Two groups: a ventral to ventroventral group of >20 copulatory thorns located anterior to the spicule; a ventral group of smaller post-cloacal thorns	VSS: most of the ventral somatic setae between copulatory thorns and cloaca have a thorn-like shape; on tail two pairs of lateral somatic setae
P. coomansi	lateral	yes	unispiral/unispiral; no sexual dimorphism	no	6	set off (more distinct in females/juveniles than males)	level of transition (suture) between anterior and posterior part of the cephalic capsule	no	from about 83rd body annuli, starting posterior to the pharynx, as far as level of the first post-cloacal thorns	Two groups: 9–14 copulatory thorns of different sizes arranged in a group; on the tail there is a ventral group of post-cloacal thorns (>6)	VSS: ventral setae between copulatory thorns and cloaca are somewhat thorn-shaped; next to post-cloacal thorns, latero-ventral pair of short, firm broad setae
P. cazca	lateral	N/A	Unispiral (closed loop)/unispiral (closed loop); no sexual dimorphism	no	N/A	set off	at anterior ring of cephalic capsule	no	from end of pharyngeal bulb to post-cloacal thorn (depicted)	Two groups: pre-anal hump 130 μm anterior to anus densely covered with thorns; at one-third tail length, armed with blunt thorns	VSS: ventral row of bristles (~7 μm long) between subventral thorns
P. interdigitatum	lateral	yes (4)	unispiral/unispiral; no sexual dimorphism	no	8	set off	labial region of cephalic capsule	no	from approx. 30 μm posterior of the terminal bulb until the tail region	Three groups: group of ventral copulatory thorns found anterior to thorn-like setae at around ~130 μm anterior to cloaca; anterior to copulatory thorns, ventral row of short single thorns extending till tip of testes; post-cloacal thorns at about one fifth of the tail	VSS: 15–17 ventral precloacal thorn-like setae extending from cloaca to about 125 μm anteriorly
P. typica sp. nov. (current study)	lateral	yes (2)	unispiral/cryptospiral; sexual dimorphism	no	6	set off	labial region of the cephalic capsule	no	from 174 μm behind anterior tip to level of post-cloacal thorns of the tail	Two groups: anterior group of 8–10 thorns on a hump anterior to cloacal opening; posterior group of ~5 post-cloacal thorns at midlevel of tail	VSS: >20 ventral precloacal thorn-like setae extending from first hump to cloaca
P. plurichela	lateral	yes	unispiral/cryptospiral; sexual dimorphism	no	8	not set off (smooth)	at level of anterior edge of amphidial fovea	no	from about mid-pharynx to beyond anus	absent	Supplements: 10 claw-like precloacal supplements
P. reathae	lateral	no	loop-shaped (open)/unispiral; sexual dimorphism	no	8	set off (by fine sutura)	labial region of cephalic capsule	no	from posterior to pharyngeal bulb to level of cloaca, extending to tail region in some specimens	absent	Supplements: 8–9 conspicuous precloacal supplements consisting of central star-shaped projections flanked by two cuticularized pieces
P. rossica	lateral	yes (2,3)	loop-shaped (open)/unispiral; sexual dimorphism	no	6	not set off (not described, but illustrated)	labial region of cephalic capsule	no	from posterior to pharyngeal bulb to level of post-cloacal thorns of the tail	Three groups: anterior group of 8–10 ventral and subventral thorns at 91–134 μm anterior to cloaca; anterior to this, a ventral row of 9–12 thorns extending to the beginning of the alae; posterior group of 4–5 medioventral thorns ~12–23 μm posterior to cloaca, flanked by a pair of broad setae	VSS: described as ventral row of thorns

). However, P. typica sp. nov. can be distinguished from P. interdigitatum by the number of body annuli that split/interdigitate at the lateral alae (2 vs. 4), the number of longitudinal rows of somatic setae (6 vs. 8), the condition of the amphidial fovea (unispiral/cryptosprial with sexual dimorphism vs. unispiral without sexual dimorphism), precloacal copulatory thorns (8–10 on a ventral hump vs. group, ~130 μm away from cloaca), and the unusually large caudal glands that extend beyond the cloacal opening.

3.2. Molecular Analysis

Six specimens were sequenced in total, comprising three individuals of P. microacantha sp. nov. and three of P. typica sp. nov. Near complete 18S rDNA sequences and partial 28S rDNA (D2–D3 domain) were successfully obtained, along with the mtCOI region for both new species (Table 2). Genetic divergence between congeners (Pseudochromadora) was evaluated using pairwise Kimura 2-parameter (K2P) distances based on all publicly available sequences of SSU and LSU in NCBI. Pseudochromadora obesa (MK626770), regarded as a dubious species lacking a valid name, together with unidentified Pseudochromadora sequences, were incorporated solely as references and were excluded from comparative interpretation.

The Kimura 2-parameter (K2P) analysis based on all available Pseudochromadora 18S sequences (Table S2) revealed no intraspecific variation within either Pseudochromadora typica sp. nov. (PX314178–PX314180) or P. microacantha sp. nov. (PX314175–PX314177), with all pairwise distances equaling 0.0000. The interspecific divergence between the two new species was 0.106 (10.6%). Pseudochromadora typica sp. nov. showed genetic distances of 0.071 from P. plurichela, and 0.098 from P. thinaiica. In comparison, P. microacantha sp. nov. was closest to P. thinaiica (0.040), while its divergences from P. plurichela was higher (0.133). Again, no intraspecific divergence was observed within either Pseudochromadora microacantha sp. nov. (PX331586–PX331587) or P. typica sp. nov. (PX331588–PX331589) using all available Pseudochromadora 28S rRNA sequences with all pairwise distances equaling 0.0000 (Table S3). The interspecific distance between the two new species was 0.272 (27.2%). Pseudochromadora microacantha sp. nov. exhibited genetic distances of 0.251 from P. rossica and 0.306 from P. thinaiica. In contrast, P. typica sp. nov. showed its closest affinity to P. rossica with a divergence of 0.054, while distances to P. thinaiica were higher (0.205).

The Bayesian inference tree based on 18S rRNA sequences (Figure 5) recovered Pseudochromadora microacantha sp. nov. (PX314178–PX314180) and P. typica sp. nov. (PX314175–PX314177) each as monophyletic lineages with full support (posterior probability = 1.00). P. microacantha sp. nov. clustered together with unidentified Pseudochromadora sequences (OQ065291, OQ065185), whereas P. typica sp. nov. was placed as the sister lineage to P. thinaiica (MZ958843–MZ958846), also with full support. All congeners formed a well-supported monophyletic assemblage, except for P. plurichela (OK317204), which branched separately from the main Pseudochromadora clade and instead formed a clade with species belonging to the subfamily Spiriniinae Chitwood, 1936 with posterior probability of 100%. The Bayesian inference tree based on 28S rRNA sequences (Figure 6) recovered Pseudochromadora microacantha sp. nov. (PX331586–PX331587) and P. typica sp. nov. (PX331588–PX331589) each as monophyletic with full support (PP = 1.00). Pseudochromadora microacantha sp. nov. formed a strongly supported clade with P. thinaiica (PP = 1.00), whereas P. typica sp. nov. was resolved as sister to P. rossica within a clade supported by PP = 1.00. All congeners (blue) together formed a well-supported monophyletic group in the 28S dataset. The Maximum Likelihood (ML) tree based on both 18S rRNA and 28S rRNA sequences, exhibited a topology identical to that recovered in the BI tree, with moderate bootstrap support (Figures S1 and S2). The congruence between ML and BI analyses further reinforces the robustness of the inferred relationships.

4. Discussion

Upon comparative analysis of morphological characters, three species stand out as outliers within the genus, namely P. quadripapillata, P. gomoi, and P. reathae. These species are the only congeners that lack both the splitting/interdigitation of body annuli at lateral alae and copulatory thorns. P. plurichela also lacks copulatory thorns, but in contrast retains the interdigitating body annuli at lateral alae. Among these outliers, P. gomoi is especially distinctive: it possesses the largest body size in the genus (being the only species exceeding 1 mm in length) and shows characters otherwise typical of genera such as Desmodora and Echinodesmodora, including a male precloacal ventral ala and eight subcephalic setae. Notably, P. quadripapillata, P. reathae, and P. plurichela are the only species of Pseudochromadora with precloacal supplementary organ (small cup-shaped in P. quadripapillata; central star-shaped in P. reathae; claw-shaped in P. plurichela; ventral somatic setae in other congeneric species; completely lacking in P. gomoi). The remaining congeners can generally be distinguished by the shape of the labial region of the cephalic capsule (rounded versus hat-shaped), with further separation based on amphidial morphology and sexual dimorphism, number of longitudinal rows of somatic setae (six versus eight), interdigitation of body annuli at the lateral alae, and the arrangement of copulatory thorns (Table 3).

The phylogenetic analyses of 18S and 28S rRNA sequences largely support the monophyly of Pseudochromadora, consistent with previous study [16], but with one exception. In the 18S tree, newly added P. plurichela sequence did not cluster with the main Pseudochromadora clade, instead grouping with Metachromadoroides obscura and Metachromadora spp. (PP = 1.00). Morphologically, P. plurichela possesses the diagnostic features of Pseudochromadora, including a unispiral amphidial fovea, a distinct cephalic capsule, and interdigitating body annuli at the lateral alae, but differs by lacking copulatory thorns and bearing a supplementary organ in place of ventral somatic setae. Absence of copulatory thorns and presence of supplementary organ in Pseudochromadora has so far been reported only in P. plurichela and P. reathae (Table 7). Absence of copulatory thorns is currently an exception that is apparent within diagnosis of the genus.

This phylogenetic exclusion of P. plurichela contrasts with the K2P distance analysis, in which P. typica sp. nov. showed the lowest divergence from P. plurichela (7.1%; Table S2). Discrepancies between distance-based measures and tree topology are not uncommon. Such cases underscore the importance of combining multiple molecular approaches, including distance estimation and tree-based inference, to clarify interspecific relationships. Despite its importance, no sequences are currently available for congeners that completely lack copulatory thorns or bear supplementary organs, leaving the question of whether these characters (individually or in combination) carry phylogenetic significance. Molecular sequences of P. quadripapillata, P. reathae, P. gomoi, or future species lacking copulatory thorns and/or bearing precloacal supplementary organs will be necessary to evaluate the phylogenetic importance of these traits. Our results do indicate, however, that the shape of the labial portion of the cephalic capsule is not phylogenetically informative. In the 18S tree, P. thinaiica (hat-shaped) clustered with P. typica sp. nov. (rounded) rather than P. microacantha sp. nov. (hat-shaped) (Figure 5). Thus, while labial capsule shape remains a useful morphological marker for distinguishing species, it does not reflect evolutionary relationships within the genus.

Due to limited sequence data, the phylogenetic status of Pseudochromadora, and whether species without copulatory thorns or with a precloacal supplementary organs merit transfer to a new genus, remains unresolved. However, this study demonstrates that combining morphological comparisons with molecular evidence provides an essential foundation for resolving the systematics of the family. With the continued accumulation of molecular data, it should become possible to identify phylogenetically informative morphological traits and thereby clarify relationships within this non-synapomorphic family, Desmodoridae.