Cytotoxicity Induced by Black Phosphorus Nanosheets in Vascular Endothelial Cells via Oxidative Stress and Apoptosis Activation
Abstract
1. Introduction
2. Materials and Methods
2.1. The Synthesis of BPNSs
2.2. Characterizations of BPNSs
2.3. Cell Culture
2.4. Cell Uptake
2.5. Cell Morphology and Metabolic Activity
2.6. Cell Migration Ability
2.7. Cytoskeleton Staining
2.8. Reactive Oxygen Species Test
2.9. Mitochondrial Membrane Potential Detection
2.10. Cell Apoptosis Test
2.11. Apoptosis-Related Gene Expression
2.12. Statistical Analysis
3. Results
3.1. BPNSs Characterization
3.2. Cell Uptake
3.3. Cell Morphology and Metabolic Activity
3.4. Cell Migration Ability
3.5. Cytoskeleton Staining
3.6. ROS and Mitochondrial Membrane Potential Test
3.7. Cell Apoptosis Test
3.8. Apoptosis-Related Gene Expression
4. Discussion
5. Conclusions
- BPNSs exhibited significant cytotoxicity towards HUVECs at concentrations exceeding 2.5 μg/mL, characterized by inhibited cell metabolic activity, disrupted cytoskeleton, and suppressed cell migration.
- The cytotoxicity mechanism of BPNSs on HUVECs involves the generation of excessive ROS and mitochondrial dysfunction, ultimately leading to apoptosis.
- The cytotoxic effect of BPNSs on HUVECs was associated with apoptosis-associated genes, including P53 and the BCL-2 family.
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Francisco, I.; Basílio, Â.; Ribeiro, M.P.; Nunes, C.; Travassos, R.; Marques, F.; Pereira, F.; Paula, A.B.; Carrilho, E.; Marto, C.M.; et al. Three-Dimensional Impression of Biomaterials for Alveolar Graft: Scoping Review. J. Funct. Biomater. 2023, 14, 76. [Google Scholar] [CrossRef] [PubMed]
- Romasco, T.; Tumedei, M.; Inchingolo, F.; Pignatelli, P.; Montesani, L.; Iezzi, G.; Petrini, M.; Piattelli, A.; Di Pietro, N. A Narrative Review on the Effectiveness of Bone Regeneration Procedures with Osteobiol (R) Collagenated Porcine Grafts: The Translational Research Experience over 20 Years. J. Funct. Biomater. 2022, 13, 121. [Google Scholar] [CrossRef]
- Qing, Y.A.; Li, R.Y.; Li, S.H.; Li, Y.H.; Wang, X.Y.; Qin, Y.G. Advanced Black Phosphorus Nanomaterials for Bone Regeneration. Int. J. Nanomed. 2020, 15, 2045–2058. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Zhang, X.; Ouyang, J.; Chu, D.; Han, F.; Shi, L.; Liu, R.; Guo, Z.; Gu, G.X.; Tao, W.; et al. Ca2+-Supplying Black Phosphorus-Based Scaffolds Fabricated with Microfluidic Technology for Osteogenesis. Bioact. Mater. 2021, 6, 4053–4064. [Google Scholar] [CrossRef]
- Xu, H.; Liu, X.; Park, S.; Terzic, A.; Lu, L. Size-Dependent Osteogenesis of Black Phosphorus in Nanocomposite Hydrogel Scaffolds. J. Biomed. Mater. Res. A 2022, 110, 1488–1498. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Yu, Y.; Ye, G.J.; Ge, Q.; Ou, X.; Wu, H.; Feng, D.; Chen, X.H.; Zhang, Y. Black Phosphorus Field-Effect Transistors. Nat. Nanotechnol. 2014, 9, 372–377. [Google Scholar] [CrossRef]
- Qu, G.; Xia, T.; Zhou, W.; Zhang, X.; Zhang, H.; Hu, L.; Shi, J.; Yu, X.F.; Jiang, G. Property-Activity Relationship of Black Phosphorus at the Nano-Bio Interface: From Molecules to Organisms. Chem. Rev. 2020, 120, 2288–2346. [Google Scholar] [CrossRef]
- Tao, W.; Zhu, X.; Yu, X.; Zeng, X.; Xiao, Q.; Zhang, X.; Ji, X.; Wang, X.; Shi, J.; Zhang, H.; et al. Black Phosphorus Nanosheets as a Robust Delivery Platform for Cancer Theranostics. Adv. Mater. 2017, 29, 1603276. [Google Scholar] [CrossRef]
- Liu, W.X.; Dong, A.; Wang, B.; Zhang, H. Current Advances in Black Phosphorus-Based Drug Delivery Systems for Cancer Therapy. Adv. Sci. 2021, 8, 2003033. [Google Scholar] [CrossRef]
- Zhou, W.; Cui, H.; Ying, L.; Yu, X.F. Enhanced Cytosolic Delivery and Release of Crispr/Cas9 by Black Phosphorus Nanosheets for Genome Editing. Angew. Chem. Int. Ed. Engl. 2018, 57, 10268–10272. [Google Scholar] [CrossRef]
- Qian, Y.; Yuan, W.E.; Cheng, Y.; Yang, Y.Q.; Qu, X.H.; Fan, C.Y. Concentrically Integrative Bioassembly of a Three-Dimensional Black Phosphorus Nanoscaffold for Restoring Neurogenesis, Angiogenesis, and Immune Homeostasis. Nano Lett. 2019, 19, 8990–9001. [Google Scholar] [CrossRef] [PubMed]
- Huang, K.; Wu, J.; Gu, Z. Black Phosphorus Hydrogel Scaffolds Enhance Bone Regeneration Via a Sustained Supply of Calcium-Free Phosphorus. ACS Appl. Mater. Interfaces 2019, 11, 2908–2916. [Google Scholar] [CrossRef] [PubMed]
- Luo, M.M.; Cheng, W.; Zeng, X.W.; Mei, L.; Liu, G.; Deng, W.B. Folic Acid-Functionalized Black Phosphorus Quantum Dots for Targeted Chemo-Photothermal Combination Cancer Therapy. Pharmaceutics 2019, 11, 242. [Google Scholar] [CrossRef]
- Sutrisno, L.; Chen, H.; Chen, Y.; Yoshitomi, T.; Kawazoe, N.; Yang, Y.; Chen, G. Composite Scaffolds of Black Phosphorus Nanosheets and Gelatin with Controlled Pore Structures for Photothermal Cancer Therapy and Adipose Tissue Engineering. Biomaterials 2021, 275, 120923. [Google Scholar] [CrossRef] [PubMed]
- Zhang, F.; Peng, F.F.; Qin, L.; Yang, D.D.; Li, R.R.; Jiang, S.S.; He, H.Y.; Zhang, P. Ph/near Infrared Dual-Triggered Drug Delivery System Based Black Phosphorus Nanosheets for Targeted Cancer Chemo-Photothermal Therapy. Colloids Surf. B Biointerfaces 2019, 180, 353–361. [Google Scholar] [CrossRef]
- Zhu, Y.; Xie, Z.; Li, J.; Liu, Y.; Li, C.; Liang, W.; Huang, W.; Kang, J.; Cheng, F.; Kang, L.; et al. From Phosphorus to Phosphorene: Applications in Disease Theranostics. Coord. Chem. Rev. 2021, 446, 214110. [Google Scholar] [CrossRef]
- Zhang, S.; Zhang, X.; Lei, L.; Yu, X.F.; Chen, J.; Ma, C.; Wu, F.; Zhao, Q.; Xing, B. Ph-Dependent Degradation of Layered Black Phosphorus: Essential Role of Hydroxide Ions. Angew. Chem. Int. Ed. Engl. 2019, 58, 467–471. [Google Scholar] [CrossRef]
- Zhang, T.; Wan, Y.; Xie, H.; Mu, Y.; Du, P.; Wang, D.; Wu, X.; Ji, H.; Wan, L. Degradation Chemistry and Stabilization of Exfoliated Few-Layer Black Phosphorus in Water. J. Am. Chem. Soc. 2018, 140, 7561–7567. [Google Scholar] [CrossRef]
- Song, S.J.; Shin, Y.C.; Lee, H.U.; Kim, B.; Han, D.W.; Lim, D. Dose- and Time-Dependent Cytotoxicity of Layered Black Phosphorus in Fibroblastic Cells. Nanomaterials 2018, 8, 408. [Google Scholar] [CrossRef]
- Ruan, F.; Liu, R.; Wang, K.; Zeng, J.; Zuo, Z.; He, C.; Zhang, Y. Cytotoxicity of Black Phosphorus Quantum Dots on Lung-Derived Cells and the Underlying Mechanisms. J. Hazard. Mater. 2021, 402, 122875. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, Z.; Zhang, S.; Li, D.; Ma, W.; Ma, C.; Wu, F.; Zhao, Q.; Yan, Q.; Xing, B. Size Effect on the Cytotoxicity of Layered Black Phosphorus and Underlying Mechanisms. Small 2017, 13. [Google Scholar] [CrossRef] [PubMed]
- Chen, D.; Tong, Z.F.; Xiong, Z.; Zhang, X.; Zhao, Q.; Zhang, S. Environmental Stability and Cytotoxicity of Layered Black Phosphorus Modified with Polyvinylpyrrolidone and Zeolitic Imidazolate Framework-67. Sci. Total Environ. 2021, 790, 148105. [Google Scholar] [CrossRef] [PubMed]
- Du, Z.; Zhao, D.; Jing, L.; Cui, G.; Jin, M.; Li, Y.; Liu, X.; Liu, Y.; Du, H.; Guo, C.; et al. Cardiovascular Toxicity of Different Sizes Amorphous Silica Nanoparticles in Rats after Intratracheal Instillation. Cardiovasc. Toxicol. 2013, 13, 194–207. [Google Scholar] [CrossRef] [PubMed]
- Shineh, G.; Patel, K.; Mobaraki, M.; Tayebi, L. Functional Approaches in Promoting Vascularization and Angiogenesis in Bone Critical-Sized Defects Via Delivery of Cells, Growth Factors, Drugs, and Particles. J. Funct. Biomater. 2023, 14, 99. [Google Scholar] [CrossRef]
- Cao, Y.; Gong, Y.; Liu, L.; Zhou, Y.; Fang, X.; Zhang, C.; Li, Y.; Li, J. The Use of Human Umbilical Vein Endothelial Cells (Huvecs) as an in Vitro Model to Assess the Toxicity of Nanoparticles to Endothelium: A Review. J. Appl. Toxicol. 2017, 37, 1359–1369. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Schille, C.; Schweizer, E.; Kimmerle-Müller, E.; Rupp, F.; Heiss, A.; Legner, C.; Klotz, U.E.; Geis-Gerstorfer, J.; Scheideler, L. Selection of Extraction Medium Influences Cytotoxicity of Zinc and Its Alloys. Acta Biomater. 2019, 98, 235–245. [Google Scholar] [CrossRef] [PubMed]
- Xia, F.; Wang, H.; Jia, Y. Rediscovering Black Phosphorus as an Anisotropic Layered Material for Optoelectronics and Electronics. Nat. Commun. 2014, 5, 4458. [Google Scholar] [CrossRef] [PubMed]
- Ling, X.; Wang, H.; Huang, S.; Xia, F.; Dresselhaus, M.S. The Renaissance of Black Phosphorus. Proc. Natl. Acad. Sci. USA 2015, 112, 4523–4530. [Google Scholar] [CrossRef]
- Huang, S.; Ling, X. Black Phosphorus: Optical Characterization, Properties and Applications. Small 2017, 13, 1700823. [Google Scholar] [CrossRef]
- Liu, X.; Xie, J.; Yang, L.; Li, Y.; He, Y.; Liu, Z.; Zhang, Y.; Su, G. Bone Marrow Mesenchymal Stem Cells Enhance Autophagy and Help Protect Cells under Hypoxic and Retinal Detachment Conditions. J. Cell. Mol. Med. 2020, 24, 3346–3358. [Google Scholar] [CrossRef]
- Jiang, H.; Xia, Q.; Liu, D.; Ling, K. Calcium-Cation-Doped Polydopamine-Modified 2d Black Phosphorus Nanosheets as a Robust Platform for Sensitive and Specific Biomolecule Sensing. Anal. Chim. Acta 2020, 1121, 1–10. [Google Scholar] [CrossRef]
- Zhang, X.; Donskyi, I.S.; Tang, W.; Deng, S.; Liu, D.; Zhang, S.; Zhao, Q.; Xing, B. Biological Effects of Black Phosphorus Nanomaterials on Mammalian Cells and Animals. Angew. Chem. Int. Ed. 2022, 62, e202213336. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Ali, S.F.; Dervishi, E.; Xu, Y.; Li, Z.; Casciano, D.; Biris, A.S. Cytotoxicity Effects of Graphene and Single-Wall Carbon Nanotubes in Neural Phaeochromocytoma-Derived Pc12 Cells. ACS Nano 2010, 4, 3181–3186. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Zhu, X.; Huang, C.; Li, Z.; Fan, J. Molecular Mechanisms Underlying the Role of the Puckered Surface in the Biocompatibility of Black Phosphorus. Nanoscale 2021, 13, 3790–3799. [Google Scholar] [CrossRef]
- Snyder, R.J.; Hussain, S.; Rice, A.B.; Garantziotis, S. Multiwalled Carbon Nanotubes Induce Altered Morphology and Loss of Barrier Function in Human Bronchial Epithelium at Noncytotoxic Doses. Int. J. Nanomed. 2014, 9, 4093–4105. [Google Scholar] [CrossRef]
- Wu, J.; Zhu, Z.; Liu, W.; Zhang, Y.; Kang, Y.; Liu, J.; Hu, C.; Wang, R.; Zhang, M.; Chen, L.; et al. How Nanoparticles Open the Paracellular Route of Biological Barriers: Mechanisms, Applications, and Prospects. ACS Nano 2022, 16, 15627–15652. [Google Scholar] [CrossRef] [PubMed]
- Fojtu, M.; Balvan, J.; Raudenska, M.; Vicar, T.; Bousa, D.; Sofer, Z.; Masarik, M.; Pumera, M. Black Phosphorus Cytotoxicity Assessments Pitfalls: Advantages and Disadvantages of Metabolic and Morphological Assays. Chemistry 2019, 25, 349–360. [Google Scholar] [CrossRef] [PubMed]
- Mu, X.; Wang, J.-Y.; Bai, X.; Xu, F.; Liu, H.; Yang, J.; Jing, Y.; Liu, L.; Xue, X.; Dai, H.; et al. Black Phosphorus Quantum Dot Induced Oxidative Stress and Toxicity in Living Cells and Mice. ACS Appl. Mater. Interfaces 2017, 9, 20399–20409. [Google Scholar] [CrossRef]
- Schieber, M.; Chandel, N.S. Ros Function in Redox Signaling and Oxidative Stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Fu, X.; Shi, J.; Li, L.; Sun, J.; Zhang, X.; Han, Q.; Deng, Y.; Gan, X. Nutrient Element Decorated Polyetheretherketone Implants Steer Mitochondrial Dynamics for Boosted Diabetic Osseointegration. Adv. Sci. 2021, 8, e2101778. [Google Scholar] [CrossRef]
- Song, W.; Zhang, J.; Guo, J.; Zhang, J.; Ding, F.; Li, L.; Sun, Z. Role of the Dissolved Zinc Ion and Reactive Oxygen Species in Cytotoxicity of Zno Nanoparticles. Toxicol. Lett. 2010, 199, 389–397. [Google Scholar] [CrossRef] [PubMed]
- Lv, R.; Yang, D.; Yang, P.; Xu, J.; He, F.; Gai, S.; Li, C.; Dai, Y.; Yang, G.; Lin, J. Integration of Upconversion Nanoparticles and Ultrathin Black Phosphorus for Efficient Photodynamic Theranostics under 808 Nm near-Infrared Light Irradiation. Chem. Mater. 2016, 28, 4724–4734. [Google Scholar] [CrossRef]
- Scheibye-Knudsen, M.; Fang, E.F.; Croteau, D.L.; Wilson, D.M., 3rd; Bohr, V.A. Protecting the Mitochondrial Powerhouse. Trends Cell. Biol. 2015, 25, 158–170. [Google Scholar] [CrossRef] [PubMed]
- Gupta, S.; Silveira, D.A.; Mombach, J.C.M. Towards DNA-Damage Induced Autophagy: A Boolean Model of P53-Induced Cell Fate Mechanisms. DNA Repair 2020, 96, 102971. [Google Scholar] [CrossRef] [PubMed]
- Moallem, S.A.; Hales, B.F. The Role of P53 and Cell Death by Apoptosis and Necrosis in 4-Hydroperoxycyclophosphamide-Induced Limb Malformations. Development 1998, 125, 3225–3234. [Google Scholar] [CrossRef]
- Kang, R.; Kroemer, G.; Tang, D. The Tumor Suppressor Protein P53 and the Ferroptosis Network. Free Radic. Biol. Med. 2019, 133, 162–168. [Google Scholar] [CrossRef]
- Liu, J.; Wang, X.; Zheng, M.; Luan, Q. Oxidative Stress in Human Gingival Fibroblasts from Periodontitis Versus Healthy Counterparts. Oral Dis. 2021, 29, 1214–1225. [Google Scholar] [CrossRef]
- Peña-Blanco, A.; García-Sáez, A.J. Bax, Bak and Beyond—Mitochondrial Performance in Apoptosis. FEBS J. 2018, 285, 416–431. [Google Scholar] [CrossRef]
- Spitz, A.Z.; Gavathiotis, E. Physiological and Pharmacological Modulation of Bax. Trends Pharmacol. Sci. 2022, 43, 206–220. [Google Scholar] [CrossRef]











| Gene | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (3′-5′) |
|---|---|---|
| P53 | TGTGACTTGCACGTACTCCC | ACCATCGCTATCTGAGCAGC |
| BCL-2 | GAACTGGGGGAGGATTGTGG | CATCCCAGCCTCCGTTATCC |
| BAX | GAGCAGCCCAGAGGCG | GGAAAAAGACCTCTCGGGGG |
| 18s rRNA | CAGCCACCCGAGATTGAGCA | TAGTAGCGACGGGCGGTGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, H.; Wen, Y.; Lin, J.; Zhuang, X.; Xian, R.; Li, P.; Li, S. Cytotoxicity Induced by Black Phosphorus Nanosheets in Vascular Endothelial Cells via Oxidative Stress and Apoptosis Activation. J. Funct. Biomater. 2023, 14, 284. https://doi.org/10.3390/jfb14050284
Dong H, Wen Y, Lin J, Zhuang X, Xian R, Li P, Li S. Cytotoxicity Induced by Black Phosphorus Nanosheets in Vascular Endothelial Cells via Oxidative Stress and Apoptosis Activation. Journal of Functional Biomaterials. 2023; 14(5):284. https://doi.org/10.3390/jfb14050284
Chicago/Turabian StyleDong, Hao, Yin Wen, Jiating Lin, Xianxian Zhuang, Ruoting Xian, Ping Li, and Shaobing Li. 2023. "Cytotoxicity Induced by Black Phosphorus Nanosheets in Vascular Endothelial Cells via Oxidative Stress and Apoptosis Activation" Journal of Functional Biomaterials 14, no. 5: 284. https://doi.org/10.3390/jfb14050284
APA StyleDong, H., Wen, Y., Lin, J., Zhuang, X., Xian, R., Li, P., & Li, S. (2023). Cytotoxicity Induced by Black Phosphorus Nanosheets in Vascular Endothelial Cells via Oxidative Stress and Apoptosis Activation. Journal of Functional Biomaterials, 14(5), 284. https://doi.org/10.3390/jfb14050284

