A Novel High-Throughput Sample-in-Result-Out Device for the Rapid Detection of Viral Nucleic Acids
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Device Design and Detection Process
2.3. ASFV DNA and SARS-CoV-2 RNA Extraction
2.4. qPCR Assay
2.5. RPA and CRISPR-Cas12a Reactions
2.6. RT-RPA and CRISPR-Cas12a/Cas13a Reactions
2.7. Lyophilization of Reagents
2.8. ASFV Clinical Samples
3. Results and Discussion
3.1. Nucleic Acid Extraction-Free Technology and Lyophilization of Reagents
3.2. High-Throughput Sample-in-Results-Out Viral Nucleic Acid Detection Device
3.3. Detection Limit and Specificity Analysis of CRISPR Detection Platforms
3.4. Clinical ASFV Sample Detection
3.5. CRISPR-Cas12a/Cas13a Orthogonal Nucleic Acid Assay for SARS-CoV-2
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Downes, K.J.; Shah, S.S. Biomarkers in Infectious Diseases. J. Pediatr. Infect. Dis. Soc. 2012, 1, 343–346. [Google Scholar] [CrossRef] [PubMed]
- Jacob, S.T.; Crozier, I.; Fischer, W.A., 2nd; Hewlett, A.; Kraft, C.S.; Vega, M.A.; Soka, M.J.; Wahl, V.; Griffiths, A.; Bollinger, L.; et al. Ebola virus disease. Nat. Rev. Dis. Primers 2020, 6, 13. [Google Scholar] [CrossRef] [PubMed]
- Kovacs, A.A.Z. Zika, the Newest TORCH Infectious Disease in the Americas. Clin. Infect. Dis. 2020, 70, 2673–2674. [Google Scholar] [CrossRef] [PubMed]
- Velavan, T.P.; Meyer, C.G. The COVID-19 epidemic. Trop. Med. Int. Health 2020, 25, 278–280. [Google Scholar] [CrossRef]
- Land, K.J.; Boeras, D.I.; Chen, X.S.; Ramsay, A.R.; Peeling, R.W. REASSURED diagnostics to inform disease control strategies, strengthen health systems and improve patient outcomes. Nat. Microbiol. 2019, 4, 46–54. [Google Scholar] [CrossRef]
- Radmard, S.; Reid, S.; Ciryam, P.; Boubour, A.; Ho, N.; Zucker, J.; Sayre, D.; Greendyke, W.G.; Miko, B.A.; Pereira, M.R.; et al. Clinical Utilization of the FilmArray Meningitis/Encephalitis (ME) Multiplex Polymerase Chain Reaction (PCR) Assay. Front. Neurol. 2019, 10, 281. [Google Scholar] [CrossRef]
- Kostyusheva, A.; Brezgin, S.; Babin, Y.; Vasilyeva, I.; Glebe, D.; Kostyushev, D.; Chulanov, V. CRISPR-Cas systems for diagnosing infectious diseases. Methods 2022, 203, 431–446. [Google Scholar] [CrossRef]
- Notomi, T.; Mori, Y.; Tomita, N.; Kanda, H. Loop-mediated isothermal amplification (LAMP): Principle, features, and future prospects. J. Microbiol. 2015, 53, 1–5. [Google Scholar] [CrossRef]
- Velasco, A.; Ramilo-Fernández, G.; Denis, F.; Oliveira, L.; Shum, P.; Silva, H.; Sotelo, C.G. A New Rapid Method for the Authentication of Common Octopus (Octopus vulgaris) in Seafood Products Using Recombinase Polymerase Amplification (RPA) and Lateral Flow Assay (LFA). Foods 2021, 10, 1825. [Google Scholar] [CrossRef]
- Yue, S.; Li, Y.; Qiao, Z.; Song, W.; Bi, S. Rolling Circle Replication for Biosensing, Bioimaging, and Biomedicine. Trends Biotechnol. 2021, 39, 1160–1172. [Google Scholar] [CrossRef]
- Wang, H.; La Russa, M.; Qi, L.S. CRISPR/Cas9 in Genome Editing and Beyond. Annu. Rev. Biochem. 2016, 85, 227–264. [Google Scholar] [CrossRef] [PubMed]
- Sorek, R.; Lawrence, C.M.; Wiedenheft, B. CRISPR-mediated adaptive immune systems in bacteria and archaea. Annu. Rev. Biochem. 2013, 82, 237–266. [Google Scholar] [CrossRef] [PubMed]
- Gootenberg, J.S.; Abudayyeh, O.O.; Lee, J.W.; Essletzbichler, P.; Dy, A.J.; Joung, J.; Verdine, V.; Donghia, N.; Daringer, N.M.; Freije, C.A.; et al. Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 2017, 356, 438–442. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.S.; Ma, E.B.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [PubMed]
- Li, S.-Y.; Cheng, Q.-X.; Wang, J.-M.; Li, X.-Y.; Zhang, Z.-L.; Gao, S.; Cao, R.-B.; Zhao, G.-P. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018, 4, 20. [Google Scholar] [CrossRef]
- Wang, X.; Zhong, M.; Liu, Y.; Ma, P.; Dang, L.; Meng, Q.; Wan, W.; Ma, X.; Liu, J.; Yang, G.; et al. Rapid and sensitive detection of COVID-19 using CRISPR/Cas12a-based detection with naked eye readout, CRISPR/Cas12a-NER. Sci. Bull. 2020, 65, 1436–1439. [Google Scholar] [CrossRef]
- Lin, C.; Chen, F.; Huang, D.; Li, W.; He, C.; Tang, Y.; Li, X.; Liu, C.; Han, L.; Yang, Y.; et al. A universal all-in-one RPA-Cas12a strategy with de novo autodesigner and its application in on-site ultrasensitive detection of DNA and RNA viruses. Biosens. Bioelectron. 2023, 239, 115609. [Google Scholar] [CrossRef]
- Lu, S.; Tong, X.; Han, Y.; Zhang, K.; Zhang, Y.; Chen, Q.; Duan, J.; Lei, X.; Huang, M.; Qiu, Y.; et al. Fast and sensitive detection of SARS-CoV-2 RNA using suboptimal protospacer adjacent motifs for Cas12a. Nat. Biomed. Eng. 2022, 6, 286–297. [Google Scholar] [CrossRef]
- Allicock, O.M.; Yolda-Carr, D.; Todd, J.A.; Wyllie, A.L. Pooled RNA-extraction-free testing of saliva for the detection of SARS-CoV-2. Sci. Rep. 2023, 13, 7426. [Google Scholar] [CrossRef]
- Bengtson, M.; Bharadwaj, M.; Franch, O.; van der Torre, J.; Meerdink, V.; Schallig, H.; Dekker, C. CRISPR-dCas9 based DNA detection scheme for diagnostics in resource-limited settings. Nanoscale 2022, 14, 1885–1895. [Google Scholar] [CrossRef]
- Arizti-Sanz, J.; Bradley, A.D.; Zhang, Y.B.; Boehm, C.K.; Freije, C.A.; Grunberg, M.E.; Kosoko-Thoroddsen, T.F.; Welch, N.L.; Pillai, P.P.; Mantena, S.; et al. Simplified Cas13-based assays for the fast identification of SARS-CoV-2 and its variants. Nat. Biomed. Eng. 2022, 6, 932–943. [Google Scholar] [CrossRef]
- Myhrvold, C.; Freije, C.A.; Gootenberg, J.S.; Abudayyeh, O.O.; Metsky, H.C.; Durbin, A.F.; Kellner, M.J.; Tan, A.L.; Paul, L.M.; Parham, L.A.; et al. Field-deployable viral diagnostics using CRISPR-Cas13. Science 2018, 360, 444–448. [Google Scholar] [CrossRef] [PubMed]
- Lei, R.; Li, L.; Wu, P.; Fei, X.; Zhang, Y.; Wang, J.; Zhang, D.; Zhang, Q.; Yang, N.; Wang, X. RPA/CRISPR/Cas12a-Based On-Site and Rapid Nucleic Acid Detection of Toxoplasma gondii in the Environment. ACS Synth. Biol. 2022, 11, 1772–1781. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, L.T.; Macaluso, N.C.; Pizzano, B.L.M.; Cash, M.N.; Spacek, J.; Karasek, J.; Miller, M.R.; Lednicky, J.A.; Dinglasan, R.R.; Salemi, M.; et al. A thermostable Cas12b from Brevibacillus leverages one-pot discrimination of SARS-CoV-2 variants of concern. Ebiomedicine 2022, 77, 103926. [Google Scholar] [CrossRef]
- Curti, L.A.; Primost, I.; Valla, S.; Alegre, D.I.; Perglione, C.O.; Repizo, G.D.; Lara, J.; Parcerisa, I.; Palacios, A.; Llases, M.E.; et al. Evaluation of a Lyophilized CRISPR-Cas12 Assay for a Sensitive, Specific, and Rapid Detection of SARS-CoV-2. Viruses 2021, 13, 420. [Google Scholar] [CrossRef] [PubMed]
- Yin, K.; Ding, X.; Li, Z.; Zhao, H.; Cooper, K.; Liu, C. Dynamic Aqueous Multiphase Reaction System for One-Pot CRISPR-Cas12a-Based Ultrasensitive and Quantitative Molecular Diagnosis. Anal. Chem. 2020, 92, 8561–8568. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Wang, R.; Wang, D.; Wu, J.; Li, J.; Wang, J.; Liu, H.; Wang, Y. Cas12aVDet: A CRISPR/Cas12a-Based Platform for Rapid and Visual Nucleic Acid Detection. Anal. Chem. 2019, 91, 12156–12161. [Google Scholar] [CrossRef]
- Hu, F.; Liu, Y.; Zhao, S.; Zhang, Z.; Li, X.; Peng, N.; Jiang, Z. A one-pot CRISPR/Cas13a-based contamination-free biosensor for low-cost and rapid nucleic acid diagnostics. Biosens. Bioelectron. 2022, 202, 113994. [Google Scholar] [CrossRef]
- Wu, H.; Chen, Y.; Shi, Y.; Wang, L.; Zhang, M.; Wu, J.; Chen, H. Carrying out pseudo dual nucleic acid detection from sample to visual result in a polypropylene bag with CRISPR/Cas12a. Biosens. Bioelectron. 2021, 178, 113001. [Google Scholar] [CrossRef]
- Hu, M.; Qiu, Z.; Bi, Z.; Tian, T.; Jiang, Y.; Zhou, X. Photocontrolled crRNA activation enables robust CRISPR-Cas12a diagnostics. Proc. Natl. Acad. Sci. USA 2022, 119, 10. [Google Scholar] [CrossRef]
- Pang, B.; Xu, J.; Liu, Y.; Peng, H.; Feng, W.; Cao, Y.; Wu, J.; Xiao, H.; Pabbaraju, K.; Tipples, G.; et al. Isothermal Amplification and Ambient Visualization in a Single Tube for the Detection of SARS-CoV-2 Using Loop-Mediated Amplification and CRISPR Technology. Anal. Chem. 2020, 92, 16204–16212. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Lyon, C.J.; Wang, J.; Lu, S.; Hu, T.Y. CRISPR Assays for Disease Diagnosis: Progress to and Barriers Remaining for Clinical Applications. Adv. Sci. 2023, 10, e2301697. [Google Scholar] [CrossRef] [PubMed]
- Tong, X.; Zhang, K.; Han, Y.; Li, T.; Duan, M.; Ji, R.; Wang, X.; Zhou, X.; Zhang, Y.; Yin, H. Fast and sensitive CRISPR detection by minimized interference of target amplification. Nat. Chem. Biol. 2024, 20, 885–893. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Zhang, K.; Lin, G.; Li, J. CRISPR-Cas system: A promising tool for rapid detection of SARS-CoV-2 variants. J. Med. Virol. 2024, 96, e29356. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Zhang, Y.; Teng, X.C.; Hou, H.; Deng, R.; Li, J. CRISPR-based nucleic acid diagnostics for pathogens. Trac Trends Anal. Chem. 2023, 160, 116980. [Google Scholar] [CrossRef]
- Yan, Y.; Zhang, X. Nucleic Acid Extraction-Free Reagent Used e.g., As Nucleic Acid Detection Reagent, Comprises Trehalose, Polyethylene Glycol 8000, Tris(hydroxymethyl)aminomethane Hydrochloride, EDTA, Triton X-100 and Nucleic Acid Release Agent Mixed Liquid. CN112522370-A; CN112522370-B. Available online: https://webofscience.clarivate.cn/wos/alldb/full-record/DIIDW:202131827M (accessed on 21 August 2024).
- Tao, J.L.; Bauer, D.E.; Chiarle, R. Assessing and advancing the safety of CRISPR-Cas tools: From DNA to RNA editing. Nat. Commun. 2023, 14, 212. [Google Scholar] [CrossRef]
- Gootenberg, J.S.; Abudayyeh, O.O.; Kellner, M.J.; Joung, J.; Collins, J.J.; Zhang, F. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 2018, 360, 439–444. [Google Scholar] [CrossRef]
- Welch, N.L.; Zhu, M.L.; Hua, C.; Weller, J.; Mirhashemi, M.E.; Nguyen, T.G.; Mantena, S.; Bauer, M.R.; Shaw, B.M.; Ackerman, C.M.; et al. Multiplexed CRISPR-based microfluidic platform for clinical testing of respiratory viruses and identification of SARS-CoV-2 variants. Nat. Med. 2022, 28, 1083–1094. [Google Scholar] [CrossRef]
- Xu, Z.C.; Chen, D.J.; Li, T.; Yan, J.; Zhu, J.; He, T.; Hu, R.; Li, Y.; Yang, Y.; Liu, M. Microfluidic space coding for multiplexed nucleic acid detection via CRISPR-Cas12a and recombinase polymerase amplification. Nat. Commun. 2022, 13, 6480. [Google Scholar] [CrossRef]
- Ghouneimy, A.; Ali, Z.; Aman, R.; Jiang, W.; Aouida, M.; Mahfouz, M. CRISPR-Based Multiplex Detection of Human Papillomaviruses for One-Pot Point-of-Care Diagnostics. ACS Synth. Biol. 2024, 13, 837–850. [Google Scholar] [CrossRef]
- Tian, T.; Qiu, Z.; Jiang, Y.; Zhu, D.; Zhou, X. Exploiting the orthogonal CRISPR-Cas12a/Cas13a trans-cleavage for dual-gene virus detection using a handheld device. Biosens. Bioelectron. 2022, 196, 113701. [Google Scholar] [CrossRef] [PubMed]
- Kubina, R.; Dziedzic, A. Molecular and Serological Tests for COVID-19. A Comparative Review of Sars-Cov-2 Coronavirus Laboratory and Point-of-Care Diagnostics. Diagnostics 2020, 10, 434. [Google Scholar] [CrossRef] [PubMed]






| Name | Sequence (5′-3′) |
|---|---|
| RPA-Forward primer (ASFV) | ATATGACCACTGGGGTTGGTATTCCTCCCGT |
| RPA-Reverse primer (ASFV) | ATCAACACCGAGATTGGCACAAGTTCGGAC |
| crRNA (ASFV) | UAAUUUCUACUAAGUGUAGAUCAUCAAAGUUCUGCAGCUCUUACA |
| ORF1ab-RPA-Forward primer (SARS-CoV-2) | AGATAATCAAGATCTCAATGGGTAACTGGGTA |
| ORF1ab-RPA-Reverse primer (SARS-CoV-2) | CTGCAGTTAAAGCCCTGGGTCAAGGTTAATA |
| N- RPA-Forward primer (SARS-CoV-2) | CCTCTAATACGACTCACTATAGGAGACGTGGTCCAGAACAAACCCAAGGAAATT |
| N- RPA-Reverse primer (SARS-CoV-2) | TGTGTAGGTCAACCACGTTCCCGAAGGTGTGT |
| ORF1ab-LbCas12a-crRNA (SARS-CoV-2) | UAAUUUCUACUAAGUGUAGAUCGGUGAUUUUCAUACAAACCA |
| N-LbuCas13a-crRNA (SARS-CoV-2) | GACCACCCCAAAAAUGAAGGGGACUAAAACAUGCCAAUGCGCGAC AUUCCGAAGA |
| ssDNA | FAM-UUAUU-BHQ |
| ssRNA | ROX-TTATT-BHQ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, F.; Hu, F.; Zhang, Y.; Li, X.; Ma, Q.; Wang, X.; Peng, N. A Novel High-Throughput Sample-in-Result-Out Device for the Rapid Detection of Viral Nucleic Acids. Biosensors 2024, 14, 549. https://doi.org/10.3390/bios14110549
Wang F, Hu F, Zhang Y, Li X, Ma Q, Wang X, Peng N. A Novel High-Throughput Sample-in-Result-Out Device for the Rapid Detection of Viral Nucleic Acids. Biosensors. 2024; 14(11):549. https://doi.org/10.3390/bios14110549
Chicago/Turabian StyleWang, Fangning, Fei Hu, Yunyun Zhang, Xichen Li, Qin Ma, Xincheng Wang, and Niancai Peng. 2024. "A Novel High-Throughput Sample-in-Result-Out Device for the Rapid Detection of Viral Nucleic Acids" Biosensors 14, no. 11: 549. https://doi.org/10.3390/bios14110549
APA StyleWang, F., Hu, F., Zhang, Y., Li, X., Ma, Q., Wang, X., & Peng, N. (2024). A Novel High-Throughput Sample-in-Result-Out Device for the Rapid Detection of Viral Nucleic Acids. Biosensors, 14(11), 549. https://doi.org/10.3390/bios14110549

