The Emergence of Klebsiella pneumoniae with Reduced Susceptibility against Third Generation Cephalosporins and Carbapenems in Lagos Hospitals, Nigeria
by
, , and
Kabiru O. Akinyemi
1,*
,
Rebecca O. Abegunrin
1,
Bamidele A. Iwalokun
2,
Christopher O. Fakorede
1,
Oliwia Makarewicz
3,
Heinrich Neubauer
4,
Mathias W. Pletz
3 and
Gamal Wareth
3,4,5,*
1
Department of Microbiology, Lagos State University, Km 15, Badagry Expressway, P.O. Box 0001 Lasu Post Office, Ojo, Lagos 102101, Nigeria
2
Molecular Biology & Biotechnology Department, Nigerian Institute of Medical Research, Yaba, Lagos 100001, Nigeria
3
Institute for Infectious Diseases and Infection Control, Jena University Hospital, Am Klinikum 1, 07747 Jena, Germany
4
Friedrich-Loeffler-Institut, Institute of Bacterial Infections and Zoonoses, Naumburger Str. 96a, 07743 Jena, Germany
5
Faculty of Veterinary Medicine, Benha University, Moshtohor, Toukh 13736, Egypt
*
Authors to whom correspondence should be addressed.
Antibiotics 2021, 10(2), 142; https://doi.org/10.3390/antibiotics10020142
Submission received: 14 January 2021
/
Revised: 27 January 2021
/
Accepted: 29 January 2021
/
Published: 1 February 2021
Abstract
:This study investigated the prevalence of Klebsiella (K.) pneumoniae isolates among clinical samples of patients in four medical centers in Lagos, Nigeria and the burden of extended-spectrum beta-lactamases (ESBL) and carbapenem-resistant K. pneumoniae (CRKP) strains. Different samples (stool, blood, urine, wound swabs and nasal swabs) from 127 patients with suspected Gram-negative infections based on on-site performed Gram-stain from four public hospitals between March and September 2015 were analyzed. K. pneumoniae was identified in 43 (34%) patients. Resistance rates of these 43 strains according to the CLSI breakpoints were as followed: cotrimoxazole (90.7%), cefuroxime (74.4%), ofloxacin (55.8%), ceftazidime (46.5%), and cefixime (35%). Three isolates (7%) were resistant to imipenem. All isolates were susceptible to amoxicillin/clavulanic acid and nitrofurantoin. The prevalence of ESBL-producing, MDR and CRKP strains was 69.8%, 62.8%, and 7.0%, respectively. Of the ESBL-producing isolates, two K. pneumoniae isolates obtained from urine harbored both blaSHV and blaCTX-M-1, and a third isolate from urine harbored only the blaCTX-M-1. This study revealed the emergence of CRKP isolates and blaCTX-M-1 and blaSHV co-harboring K. pneumoniae strains in Lagos hospitals. The emergence of CRKP strains is an early warning signal for carbapenem antibiotics’ prudent use with concern for their efficacies.
1. Introduction
Klebsiella (K.) pneumoniae is a Gram-negative opportunistic nosocomial bacterial pathogen. It is involved in several localized and disseminated hospital-acquired infections such as burns infections, sepsis, respiratory and gastrointestinal tract infections, urinary tract infections, pyogenic liver abscesses, and soft tissue and wound infection [1]. The emergence of carbapenem-resistant K. pneumoniae (CRKP) strains has become an ultimate challenge for public health globally due to their ability to disseminate rapidly in the hospital environment and their extended antibiotic resistance phenotypes [2]. In 2001, the first K. pneumoniae isolate with KPC-2 production was identified in the USA [3]. There are many mechanisms in K. pneumoniae that can drive carbapenem resistance; KPC-2 production is just one. A few years later, outbreaks began to appear in several countries. Nowadays, it is the most common carbapenemase-producing Enterobacterales (CPE), and is considered one of the most rapidly growing global threats due to the high mortality in hospital-associated infections [4]. In 2017, CRKP was classified among those global critical pathogens listed by WHO concerning discovering and developing new antibiotics.
In Nigeria, K. pneumoniae was among the most common causes of lower respiratory tract infections [5], neonatal septicemia, and bacteremia in children [6,7]. Antimicrobial susceptibility testing of 306 Gram-negative isolates from patients admitted to three teaching hospitals in South Western Nigeria in 2011 and 2013 revealed resistance to third-generation cephalosporins in 92.2% and carbapenems in 52.6% of isolates [8]. Examination of 108 K. pneumoniae and 140 E.coli isolates from two tertiary hospitals in northwest Nigeria showed that 58% of the isolates were ESBL producers, while resistance to meropenem was observed in 40.3% of the isolate, and resistance to imipenem was observed in 36.6% [9]. However, the prescription and use of carbapenem antibiotics are still low, and there is a lack of recent information on multidrug resistance (MDR)-associated K. pneumoniae. The present study was conducted to investigate the prevalence of K. pneumoniae among clinical samples of patients in four medical centers in Lagos, Nigeria, and determine the burden of extended-spectrum beta-lactamase- (ESBL) and carbapenemase-producing strains.
2. Results and Discussion
Klebsiella pneumoniae was isolated from 34% (43/127) of clinical samples analyzed in this study. K. pneumoniae was present in about half (55.8%) of urine samples screened, an indication of etiological diagnosis in urinary tract infections, as no other bacterial pathogens were isolated. K. pneumoniae was detected in a quarter (23.3%) of nasal swabs. In these cases, the link between K. pneumoniae isolation and infection cannot be considered sufficiently strong for an etiologic diagnosis because other Gram-positive bacterial agents could not be ruled. Three strains of K. pneumoniae (6.98%) were isolated from three patients with soft tissue infection. Three strains (6.98%) were isolated from three gastroenteritis cases, of which no other bacterial agents were detected (Table 1). K. pneumoniae was detected in samples of all the age groups studied, with young adults (15–30) being the age group most at the risk of K. pneumoniae-associated infections, occurring in 27.9% (12/43) followed by 25.6% (11/43) of patients in the age group 5–14 years (Table 1). The prevalence of K. pneumoniae among patients suffered from urinary tract infections (UTIs) [10], suppurative otitis [11], and gut infection [12] is increasing worldwide.
In Nigeria, malaria is endemic. Three K. pneumoniae strains (6.98%) were isolated from patients with concomitant Plasmodium falciparum infection. Co-infections of Enterobacterales with P. falciparum have been reported in some malaria-endemic African countries, including Nigeria, and were associated with increased severity [13]. Thus, such cases were also expected in this study, as it can be suggested that K. pneumoniae-associated bacteremia caused exacerbation of asymptomatic or silent malaria. Hence, this is the first report on K. pneumoniae-Plasmodium spp. co-infections in patients within Lagos hospitals in recent times.
Most isolates were resistant to cotrimoxazole (90.7%), followed by cefuroxime (74.4%), ofloxacin (55.8%), ceftazidime (46.5%), and cefixime (35%). Three isolates (7%) obtained from urine showed resistance to imipenem with a minimum inhibitory concentration (MIC) > 8 mg/L. Resistance rates were lowest for gentamicin (4.7%), imipenem (7%), followed by ciprofloxacin (28%) and no resistance (0.0%) was recorded for amoxicillin/clavulanic acid and nitrofurantoin (Table 2). K. pneumoniae was among the predominant Gram-negative bacteria isolated in Sokoto, Northwest Nigeria, in 2019. It represented 14% of isolated bacteria, and most of the isolates were MDR and exhibited ESBL and carbapenemase activities [14]. Examination of 48 K. pneumoniae strains isolated from Medical Institution in Oyo State, Nigeria, showed resistance in 88% of isolates to streptomycin and in 92% to cloxacillin, oxacillin, and colistin [15].
In this study, 27 (62.8%) and 30 (69.8%) K. pneumoniae were MDR and ESBL producing strains, respectively (Table 3). Previous epidemiological investigations have shown that MDR K. pneumoniae strains harboring ESBL genes exist in environmental sources [16] and are usually associated with nosocomial infections in Nigerian hospitals [17,18]. However, there are still few data available on the prevalence of K. pneumoniae in Nigerian hospitals. The published data are limited to regional studies and/or a limited number of samples [19]. Our results are comparable to Olalekan and colleagues’ findings, who identified K. pneumoniae in 35.4% of samples collected from four hospitals in Lagos between 2016–2018 [17], and Raji and co-workers, who found that K. pneumoniae represented 31.4% of strains collected during an assessment of the prevalence of drug resistance and ESBL among members of the family Enterobacterales at Lagos teaching hospital [18].
In these MDR K. pneumoniae isolates, eleven resistance patterns were identified. The pattern ceftazidime/cefuroxime/ofloxacin/ciprofloxacin/cotrimoxazole (CAZ-CRX-OFL-CIP-COT) was the most frequent one (Table 4). Two K. pneumoniae isolates from urine (U3 and U11) harbored both blaCTX-M-1 and blaSHV, and one isolate (U19) harbored only blaCTX-M-1. None of the tested strains contained the blaTEM. The emergence of resistance to imipenem is a new phenomenon, and the explanation is inconclusive because this drug is rarely used and relatively expensive. The prevalence of carbapenem resistance among clinical isolates of Enterobacterales was between 2.8% and 53.6% in a tertiary hospital in Lagos, Nigeria [20]. In 2019, most of K. pneumoniae strains isolated in Sokoto, Northwest Nigeria, exhibited ESBL and carbapenemase activities [14]. None of the three ESBL genes were detected in any of the three carbapenem-resistant K. pneumoniae isolates in our study. However, this may not ultimately rule out that these strains are non-carbapenemase producers, as they might be harboring other carbapenemase gene markers not screened in this study.
Only three genes were checked by PCR due to limited resources, which is a limitation of this study. Interestingly, the three CRKP strains were found in two different hospitals at a close distance of 20 km, an indication of the emergence and circulation of CRKP in Lagos, Nigeria. The prevalence of carbapenem-resistance in 177 isolates of Enterobacterales was 22% in South-West Nigeria in 2018; of them, 35.9% (n = 14) were K. pneumoniae [21]. The emergence of ESBL due to blaCTX and blaSHV genes in K. pneumoniae has also been reported in other recent African studies. A high distribution of ESBL with the dominant blaCTX-M-1 gene marker was reported in Accra and Kumasi, Ghana [22]. A high prevalence of ESBL-producing K. pneumoniae in clinical isolates was reported in Côte d’Ivoire [23]. Strains harboring blaCTX-M-15 and blaSHV-134 were isolated from pig and abattoir workers in Cameroon [24]. Carbapenem resistance is emerging in Africa, despite its not being routinely used due to high cost [25]. New antibiotics and new strategies are required to mitigate this increasing threat.
3. Materials and Methods
3.1. Study Population, Case Definition, Sample Collection and Bacteriology
The prevalence and burden of ESBL and CRKP strains were investigated, involving 127 patients with various types of infections admitted to four public Lagos hospitals between March and September 2015. The Central Public Health Laboratory (CPHL), Lagos State University Teaching Hospital (LSUTH), National Institute of Medical Research (NIMR), and Iba Primary Health Centre (IPHC) contributed 42, 33, 32, and 20 samples, respectively. The institutional review boards of Lagos State University and the Nigerian Institute of Medical Research approved the study and the ethical approval with a code [Ref. No. LREC 06/10/1071] was obtained. Moreover, the consent of the patients was sought. Data of the patients, including age and sex, were noted. In total, 37 urine samples, 30 nasal swabs, and 20 wound swabs were aseptically collected from patients diagnosed with urinary tract infections, otitis media and pneumonia, and soft tissue abscesses. Additionally, 20 fresh feces samples were collected from patients with gastroenteritis, and 4 mL blood was collected from another 20 patients suffering from pyrexia of unknown origin (PUO). All blood samples from PUO patients were subjected to the thick-blood smear technique to detect the malaria parasite (Plasmodium spp.). Bacterial culture of all samples was done on brain heart infusion (BHI) and Macconkey agar (Oxoid, UK), and plates were incubated at 37 °C overnight under aerobic conditions. The lactose fermenting discrete colonies were subjected to biochemical identification, according to Crown and Steel 1993 [26]. Colonies biochemically confirmed as Klebsiella spp. were subjected to the MICROBACT 24E identification system (Oxoid, UK).
3.2. Antimicrobial Susceptibility Testing (AST)
All confirmed K. pneumoniae strains were tested against ten antibiotics by both disc diffusion and microdilution methods according to the CLSI guidelines [27]. The following antibiotic discs were used: cotrimoxazole (COT) (25 μg), ciprofloxacin (CIP) (5 μg), ofloxacin (OFL) (5 μg), gentamicin (GEN) (10 μg), cefixime (CXM) (5 μg), amoxicillin/clavulanic acid (AMC) (30 μg), cefuroxime (CRX) (30 μg), ceftazidime (CAZ) (30 µg), imipenem (IMP) (30 μg), and nitrofurantoin (NIT) (300 μg) (Oxoid, UK). The inhibition zones’ diameters were measured with a ruler and compared with a zone-interpretation chart. The microdilution test was performed with the same set of antibiotics for consistency (Sigma, Deisenhofen, Germany) following the manufacturer‘s instructions. In this study, resistance was defined for isolates exhibiting intermediate resistance and resistance. The multidrug-resistant (MDR) phenotype was defined as acquired non-susceptibility to at least one agent in three or more antimicrobial categories [28].
3.3. Screening of Extended-Spectrum Beta-Lactamase (ESBL)
All isolates that exhibited reduced susceptibility and resistance to third-generation cephalosporin were screened for ESBL production using the double disc synergy test (DDST). This was done by placing the 3GC antibiotics, i.e., ceftazidime (30 µg) and ceftriaxone (30 µg), at a distance of 15 mm (center to center) from 30 µg amoxicillin/clavulanic acid (20 µg amoxicillin and 10 µg clavulanic acid) using CLSI interpretation guidelines [27]. Detection of carbapenemase enzyme activity was done following the modified Hodge test (MHT) as described by Landman and colleagues [29]. For three ESBL gene makers, the blaCTX-M-1 group, blaSHV, and blaTEM, PCR-based screening was conducted [30,31]. Briefly, genomic DNA was extracted by the Tris-EDTA boiling extraction method [32], and the concentration and purity of DNA were determined spectrophotometrically (BIO-RAD Smart Spec 3000; Hercules, CA, USA). The detection of β-lactamase-encoding genes carried out using multiplex polymerase chain reaction (PCR) with primers that correspond to conserved regions of blaTEM, blaSHV, and blaCTX-M-type genes. The primers were synthesized and supplied by Promega Corp, Germany. Each PCR reaction was done in a 20 µL volume, comprising 1 × PCR buffer (pH 8.3), 1.5 mM of MgCl2, 200 nM each of the deoxynucleotide triphosphates (dNTPs), 40 picomoles each of the forward primer and reverse primers indicated in Table 5. One microliter (1 µL) each of the genomic DNA templates (~100 ng) and 1.25 U of Taq polymerase (Promega, Germany) were used. The PCR program consisted of an initial denaturation step at 94 °C for 3 min, followed by 25 cycles of DNA denaturation at 94 °C for 30 s, primer annealing at 54 °C for 30 s, and primer extension at 72 °C for 1 min. After the last cycle, a final extension step at 72 °C for 7 min was applied. Five-microliter aliquots of PCR products were analyzed by gel electrophoresis with 2% agarose (Sigma-Aldrich, USA). Gels were stained with ethidium bromide at 0.5 µg/mL and visualized by UV transilluminator. A 100 bp DNA ladder (Fermentas, Burlington, ON, Canada) was used as a marker to extrapolate the 190 bp PCR product. The PCR reaction was done using a TC-312 thermal cycler (Techne, Amsterdam, The Netherlands).
4. Conclusions
In conclusion, this study revealed the emergence and dissemination of carbapenem-resistant K. pneumoniae isolates and blaCTX-M-1 group and blaSHV co-harboring K. pneumoniae strains in Lagos. This study is limited by using a PCR screening tool that could only detect blaCTX-M-1, blaSHV and blaTEM. CRKP is emerging in Nigeria, despite carbapenem compounds not being routinely used in the health care system due to their high cost. New antibiotics and new strategies are needed to mitigate this increasing threat. A comprehensive study on the real situation on carbapenemase-producing K. pneumoniae in Lagos using advanced molecular typing tools to assess the diversity and clonal relatedness of the strains is required to better monitor and understand the spread of MDR K. pneumoniae in this region.
Author Contributions
K.O.A. conceived the study and designed the study protocol; R.O.A. and C.O.F. carried out the literature search and antimicrobial susceptibility testing; K.O.A. and B.A.I. performed molecular analysis, organized, integrated all data and carried out the investigation. K.O.A., R.O.A., and G.W. interpreted data and drafted the manuscript; K.O.A., O.M., M.W.P., H.N., and G.W. critically revised the manuscript for intellectual content. All authors read and approved the final manuscript. K.O.A. is a guarantor of the paper.
Funding
LASU and NIMR supported this work through provisions of consumables and the team’s joint efforts.
Institutional Review Board Statement
The institutional review boards of Lagos State University and the Nigerian Institute of Medical Research approved the study and the ethical code [Ref. No. LREC 06/10/1071] was obtained.
Informed Consent Statement
The consent of the patients was sought.
Data Availability Statement
Not applicable.
Acknowledgments
We are grateful to the Department of Microbiology staff and both the management of Lagos State University (LASU) and the Nigerian Institute of Medical Research (NIMR) for providing consumables and technical support, respectively. Part of this study’s abstract was presented at the American Society for Tropical Medicine and Hygiene. It was published online in the American Journal of Tropical Medicine and Hygiene.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Ranjbar, R.; Fatahian Kelishadrokhi, A.; Chehelgerdi, M. Molecular characterization, serotypes and phenotypic and genotypic evaluation of antibiotic resistance of the Klebsiella pneumoniae strains isolated from different types of hospital-acquired infections. Infect. Drug Resist. 2019, 12, 603–611. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rossolini, G.M. Extensively drug-resistant carbapenemase-producing Enterobacteriaceae: An emerging challenge for clinicians and healthcare systems. J. Intern. Med. 2015, 277, 528–531. [Google Scholar] [CrossRef] [Green Version]
- Yigit, H.; Queenan, A.M.; Anderson, G.J.; Domenech-Sanchez, A.; Biddle, J.W.; Steward, C.D.; Alberti, S.; Bush, K.; Tenover, F.C. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2001, 45, 1151–1161. [Google Scholar] [CrossRef] [Green Version]
- Brink, A.J. Epidemiology of carbapenem-resistant Gram-negative infections globally. Curr. Opin. Infect. Dis. 2019, 32, 609–616. [Google Scholar] [CrossRef]
- Uzoamaka, M.; Ngozi, O.; Johnbull, O.S.; Martin, O. Bacterial Etiology of lower respiratory tract infections and their antimicrobial susceptibility. Am. J. Med. Sci. 2017, 354, 471–475. [Google Scholar] [CrossRef]
- Brown, B.; Dada-Adegbola, H.; Trippe, C.; Olopade, O. Prevalence and etiology of bacteremia in febrile children with sickle cell disease at a Nigeria tertiary hospital. Mediterr. J. Hematol. Infect. Dis. 2017, 9, e2017039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Akindolire, A.E.; Tongo, O.; Dada-Adegbola, H.; Akinyinka, O. Etiology of early-onset septicemia among neonates at the University College Hospital, Ibadan, Nigeria. J. Infect. Dev. Ctries 2016, 10, 1338–1344. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogbolu, D.O.; Piddock, L.J.V.; Webber, M.A. Opening Pandora’s box: High-level resistance to antibiotics of last resort in Gram-negative bacteria from Nigeria. J. Glob. Antimicrob. Resist. 2020, 21, 211–217. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, Y.; Sani, Y.; Saleh, Q.; Saleh, A.; Hakeem, G. Phenotypic detection of extended-spectrum beta-lactamase and carbapenemase co-producing clinical isolates from two tertiary hospitals in Kano, northwest Nigeria. Ethiop. J. Health Sci. 2017, 27, 3–10. [Google Scholar] [CrossRef] [Green Version]
- Vachvanichsanong, P.; McNeil, E.B.; Dissaneewate, P. Extended-spectrum beta-lactamase Escherichia coli and Klebsiella pneumoniae urinary tract infections. Epidemiol. Infect. 2020, 149, e12. [Google Scholar] [CrossRef]
- Sun, R.; Zhang, H.; Xu, Y.; Zhu, H.; Yu, X.; Xu, J. Community-acquired Klebsiella pneumoniae central nervous system infection after acute suppurative otitis. IDCases 2021, 23, e01016. [Google Scholar] [CrossRef]
- Antony, S.; Ravichandran, K.; Kanungo, R. Multidrug-resistant Enterobacteriaceae colonising the gut of adult rural population in South India. Indian J. Med. Microbiol. 2018, 36, 488–493. [Google Scholar] [CrossRef] [PubMed]
- Akinyemi, K.O.; Bamiro, B.S.; Coker, A.O. Salmonellosis in Lagos, Nigeria: Incidence of Plasmodium falciparum-associated co-infection, patterns of antimicrobial resistance, and emergence of reduced susceptibility to fluoroquinolones. J. Health Popul. Nutr. 2007, 25, 351–358. [Google Scholar] [PubMed]
- Olowo-Okere, A.; Ibrahim, Y.K.E.; Nabti, L.Z.; Olayinka, B.O. High prevalence of multidrug-resistant Gram-negative bacterial infections in Northwest Nigeria. Germs 2020, 10, 310–321. [Google Scholar] [CrossRef]
- Ayandele, A.A.; Oladipo, E.K.; Oyebisi, O.; Kaka, M.O. Prevalence of multi-antibiotic resistant Escherichia coli and Klebsiella species obtained from a tertiary medical institution in Oyo State, Nigeria. Qatar Med. J. 2020, 2020, 9. [Google Scholar] [CrossRef]
- Obasi, A.; Nwachukwu, S.; Ugoji, E.; Kohler, C.; Gohler, A.; Balau, V.; Pfeifer, Y.; Steinmetz, I. Extended-spectrum beta-lactamase-producing Klebsiella pneumoniae from pharmaceutical wastewaters in South-Western Nigeria. Microb. Drug Resist. 2017, 23, 1013–1018. [Google Scholar] [CrossRef] [PubMed]
- Olalekan, A.; Onwugamba, F.; Iwalokun, B.; Mellmann, A.; Becker, K.; Schaumburg, F. High proportion of carbapenemase-producing Escherichia coli and Klebsiella pneumoniae among extended-spectrum beta-lactamase producers in Nigerian hospitals. J. Glob. Antimicrob. Resist. 2019. [Google Scholar] [CrossRef]
- Raji, M.A.; Jamal, W.; Ojemhen, O.; Rotimi, V.O. Point-surveillance of antibiotic resistance in Enterobacteriaceae isolates from patients in a Lagos teaching hospital, Nigeria. J. Infect. Public Health 2013, 6, 431–437. [Google Scholar] [CrossRef] [Green Version]
- Hertz, F.B.; Jansaker, F.; Okon, K.O.; Abdulmumin, I.S.; Onah, J.O.; Ladan, J.; Knudsen, J.D. ESBL-production in Escherichia coli and Klebsiella pneumoniae isolates from Nigeria. MicrobiologyOpen 2019, 8, e00816. [Google Scholar] [CrossRef]
- Oduyebo, O.O.; Falayi, O.M.; Oshun, P.; Ettu, A.O. Phenotypic determination of carbapenemase-producing Enterobacteriaceae isolates from clinical specimens at a tertiary hospital in Lagos, Nigeria. Trop. J. Pharm. Res. 2015, 22, 223–227. [Google Scholar] [CrossRef]
- Adesanya, O.A.; Igwe, H.A. Carbapenem-resistant Enterobacteriaceae (CRE) and Gram-negative bacterial infections in south-west Nigeria: A retrospective epidemiological surveillance study. AIMS Public Health 2020, 7, 804–815. [Google Scholar] [CrossRef] [PubMed]
- Falagas, M.E.; Karageorgopoulos, D.E.; Nordmann, P. Therapeutic options for infections with Enterobacteriaceae producing carbapenem-hydrolyzing enzymes. Future Microbiol. 2011, 6, 653–666. [Google Scholar] [CrossRef] [PubMed]
- Muller-Schulte, E.; Tuo, M.N.; Akoua-Koffi, C.; Schaumburg, F.; Becker, S.L. High prevalence of ESBL-producing Klebsiella pneumoniae in clinical samples from central Cote d’Ivoire. Int. J. Infect. Dis. 2019, 91, 207–209. [Google Scholar] [CrossRef] [Green Version]
- Founou, L.L.; Founou, R.C.; Allam, M.; Ismail, A.; Djoko, C.F.; Essack, S.Y. Genome sequencing of extended-spectrum beta-lactamase (ESBL)-producing Klebsiella pneumoniae isolated from pigs and abattoir workers in Cameroon. Front. Microbiol. 2018, 9, 188. [Google Scholar] [CrossRef]
- Njeru, J. Emerging carbapenem resistance in ESKAPE organisms in sub-Saharan Africa (SSA) and the way forward. Ger. J. Microbiol. 2021, 1. [Google Scholar] [CrossRef]
- Phillips, I. Cowan and Steel’s manual for the identification of medical bacteria. J. Clin. Pathol. 1993, 46, 975. [Google Scholar] [CrossRef] [Green Version]
- CLSI (Clinical and Laboratory Standards Institute). Performance Standards for Antimicrobial Susceptibility Testing; Nineteenth Informational Supplement; CLSI: Annapolis Junction, MD, USA, 2011. [Google Scholar]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pan drug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Landman, D.; Salvani, J.K.; Bratu, S.; Quale, J. Evaluation of techniques for detection of carbapenem-resistant Klebsiella pneumoniae in stool surveillance cultures. J. Clin. Microbiol. 2005, 43, 5639–5641. [Google Scholar] [CrossRef] [Green Version]
- Sturenburg, E.; Kuhn, A.; Mack, D.; Laufs, R. A novel extended-spectrum beta-lactamase CTX-M-23 with a P167T substitution in the active-site omega loop associated with ceftazidime resistance. J. Antimicrob. Chemother. 2004, 54, 406–409. [Google Scholar] [CrossRef] [Green Version]
- Pai, H.; Lyu, S.; Lee, J.H.; Kim, J.; Kwon, Y.; Kim, J.W.; Choe, K.W. Survey of extended-spectrum beta-lactamases in clinical isolates of Escherichia coli and Klebsiella pneumoniae: Prevalence of TEM-52 in Korea. J. Clin. Microbiol. 1999, 37, 1758–1763. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, J.L.; Wang, M.S.; Cheng, A.C.; Pan, K.C.; Li, C.F.; Deng, S.X. A simple and rapid method for extracting bacterial DNA from intestinal microflora for ERIC-PCR detection. World J. Gastroenterol. 2008, 14, 2872–2876. [Google Scholar] [CrossRef] [PubMed]
Table 1.
Number and types of collected samples and K. pneumoniae positive isolates distributed across the subjects’ age and sex used in the current study sampling hospitals.
Table 1.
Number and types of collected samples and K. pneumoniae positive isolates distributed across the subjects’ age and sex used in the current study sampling hospitals.
| Parameters | Types and Number of Collected Samples (Positive Sample) | ||||||
|---|---|---|---|---|---|---|---|
| Urine | Nasal Swab | Wound Swab | Feces | Blood | Total | ||
| Hospitals | CPHL | 9 (6) | 11 (4) | 7 (1) | 9 (1) | 6 (1) | 42 (13) |
| LASUTH | 10 (5) | 9 (3) | 5 (1) | 2 (0) | 7 (2) | 33 (11) | |
| NIMR | 12 (8) | 7 (2) | 3 (1) | 6 (2) | 4 (0) | 32 (13) | |
| IPHC | 6 (5) | 3 (1) | 5 (0) | 3 (0) | 3 (0) | 20 (6) | |
| Total | 37 (24) | 30 (10) | 20 (3) | 20 (3) | 20 (3) | 127 (43) | |
| Age in Year | 0–4 | 6 (3) | 3 (1) | 2 (0) | 3 (0) | 1 (0) | 15 (4) |
| 5–14 | 11 (7) | 7 (2) | 5 (1) | 2 (0) | 6 (1) | 31 (11) | |
| 15–30 | 9 (5) | 6 (1) | 7 (2) | 7 (2) | 5 (2) | 34 (12) | |
| 31–49 | 5(4) | 8 (3) | 4 (0) | 5 (1) | 5 (0) | 27 (8) | |
| ≥ 50 | 6(5) | 6 (3) | 2 (0) | 3 (0) | 3 (0) | 20 (8) | |
| Total | 37 (24) | 30 (10) | 20 (3) | 20 (3) | 20 (3) | 127 (43) | |
| Sex | Male | 21 (11) | 13 (7) | 9 (1) | 12 (2) | 11 (2) | 66 (23) |
| Female | 16 (13) | 17 (3) | 11 (2) | 8 (1) | 9 (1) | 61 (20) | |
| Total | 37 (24) | 30 (10) | 20 (3) | 20 (3) | 20 (3) | 127 (43) | |
The Central Public Health Laboratory (CPHL), Lagos State University Teaching Hospital (LSUTH), National Institute of Medical Research (NIMR), and Iba Primary Health Centre (IPHC).
Table 2.
Antimicrobial susceptibility data and MIC values of 43 K. pneumoniae strains collected from hospitals in Lagos.
Table 2.
Antimicrobial susceptibility data and MIC values of 43 K. pneumoniae strains collected from hospitals in Lagos.
| Antimicrobial Agent | Standard Range | Test Results | ||||
|---|---|---|---|---|---|---|
| S ≤ (mg/L) | R ≥ (mg/L) | S (%) | R (%) | MIC50 (mg/L) | MIC90 (mg/L) | |
| Ciprofloxacin | 0.25 | 0.5 | 72.1 | 27.9 | 0.25 | 1.5 |
| Ofloxacin | 0.25 | 0.5 | 44.2 | 55.8 | 0.25 | 0.5 |
| Gentamicin | 2 | 4 | 95.3 | 4.7 | 1.5 | 2.0 |
| Cefixime | 1 | 2 | 65.1 | 34.9 | 1.0 | 1.5 |
| Ceftazidime | 1 | 2 | 53.5 | 46.5 | 1.0 | 1.5 |
| Cefuroxime | 8 | 16 | 25.6 | 74.4 | 16 | 16 |
| Imipenem | 2 | 8 | 93.0 | 7.0 | 1.0 | 1.5 |
| Cotrimozaxole | 2 | 4 | 9.3 | 90.7 | 4.0 | 16 |
| Amoxicillin/Clavulanic Acid | 8 | 16 | 100 | 0.0 | 16 | 16 |
| Nitrofurantoin | 8 | 16 | 100 | 0.0 | 16 | 16 |
S: sensitive; R: resistance, MIC: minimum inhibitory concentration.
Table 3.
Distribution of K. pneumoniae ESBL, MDR, and CAB in relation to clinical samples.
| Samples | Samples No. (%) | Positive No. (%) | ESBL+ No. (%) | MDR+ No. (%) | CAB+ No. (%) |
|---|---|---|---|---|---|
| Urine | 37 (29.2) | 24 (55.8) | 16 (66.7) | 17 (70.8) | 3 (12.5) |
| Nasal swab | 30 (23.7) | 10 (23.3) | 7 (70.0) | 4 (40.0) | 0 (0.00) |
| Wound swab | 20 (15.7) | 3 (6.98) | 2 (66.7) | 1 (33.3) | 0 (0.00) |
| Feces | 20 (15.7) | 3 (6.98) | 2 (66.7) | 2 (66.7) | 0 (0.00) |
| Blood | 20 (15.7) | 3 (6.98) | 3 (100) | 3 (100) | 0 (0.00) |
| TOTAL | 127 (100) | 43 (34%) | 30 (69.8) | 27 (62.8) | 3 (6.98) |
ESBL: Extended Spectrum ß-lactamase; MDR: multidrug-resistant; CAB: carbapenem; (+): positive resistance.
Table 4.
Patterns of MDR to K. pneumoniae isolates recovered from clinical samples at hospitals in Lagos.
Table 4.
Patterns of MDR to K. pneumoniae isolates recovered from clinical samples at hospitals in Lagos.
| Sample Types | No. of Isolates | Strains ID | Resistance Pattern |
|---|---|---|---|
| Urine and Blood | 5 | U12, U36, B37, U38, U42 | CRX-OFL-COT |
| Urine | 4 | U10, U23, U30, U43 | CAZ-CRX-OFL-COT |
| Feces | 1 | F31 | CXM-OFL-CIP-COT |
| Urine | 1 | U7 | CRX-CXM-GEN-OFL-COT |
| Urine | 2 | U3, U11 | CAZ-CRX-CXM-OFL-COT |
| Urine | 2 | U13, U35 | CAZ-CRX-CXM-IPM-COT |
| Blood | 1 | B40 | CRX-CXM-OFL-CIP-COT |
| Urine, Wound, and Nasal Swab | 3 | W17, U19, N26 | CAZ-CRX-OFL-CIP-COT-CXM |
| Urine | 1 | U18 | CAZ-CRX-OFL-CIP-COT-CXM-IPM |
| Urine and Nasal Swab | 2 | U39, N4 | CAZ-OFL-CIP-COT |
| Urine, Nasal Swab, Feces, and Blood | 5 | B33, N9, N16, F32, U41 | CAZ-CRX-OFL-CIP-COT |
| Total | 27 |
CAZ: ceftazidime (30 μg); CRX: cefuroxine (30 μg); GEN; gentamicin (10 μg); CXM: cefixime (5 μg); OFL: ofloxacin (5 μg); AUG: amoxicillin/clavulanic acid (30 μg); NIT: nitrofurantoin (300 μg); CIP: ciprofloxacin (5 μg); IPM: imipenem (30 μg); COT: cotrimoxazole (25 μg); U (urine), B (blood), F (feces), W (wound swab), N (nasal swab).
Table 5.
The primer sequences used for amplification of bla genes.
| Target | Primer | Primer Sequence (5′-3′) | Product Size (bp) | Ref. |
|---|---|---|---|---|
| blaTEM | TEM-F | TCCGCTCATGAGACAATAACC | 931 | [30] |
| TEM-R | TTGGTCTGACAGTTACCAATGC | |||
| blaSHV | SHV-F | TGGTTATGCGTTATATTCGCC | 868 | [31] |
| SHV-R | GGTTAGCGTTGCCAGTGCT | |||
| blaCTX-M | CTX-F | TCTTCCAGAATAAGGAATCCC | 909 | [30] |
| CTX-R | CCGTTTCCGCTATTACAAAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Akinyemi, K.O.; Abegunrin, R.O.; Iwalokun, B.A.; Fakorede, C.O.; Makarewicz, O.; Neubauer, H.; Pletz, M.W.; Wareth, G. The Emergence of Klebsiella pneumoniae with Reduced Susceptibility against Third Generation Cephalosporins and Carbapenems in Lagos Hospitals, Nigeria. Antibiotics 2021, 10, 142. https://doi.org/10.3390/antibiotics10020142
AMA Style
Akinyemi KO, Abegunrin RO, Iwalokun BA, Fakorede CO, Makarewicz O, Neubauer H, Pletz MW, Wareth G. The Emergence of Klebsiella pneumoniae with Reduced Susceptibility against Third Generation Cephalosporins and Carbapenems in Lagos Hospitals, Nigeria. Antibiotics. 2021; 10(2):142. https://doi.org/10.3390/antibiotics10020142
Chicago/Turabian StyleAkinyemi, Kabiru O., Rebecca O. Abegunrin, Bamidele A. Iwalokun, Christopher O. Fakorede, Oliwia Makarewicz, Heinrich Neubauer, Mathias W. Pletz, and Gamal Wareth. 2021. "The Emergence of Klebsiella pneumoniae with Reduced Susceptibility against Third Generation Cephalosporins and Carbapenems in Lagos Hospitals, Nigeria" Antibiotics 10, no. 2: 142. https://doi.org/10.3390/antibiotics10020142
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
