Next Article in Journal
Repurposing Avermectins and Milbemycins against Mycobacteroides abscessus and Other Nontuberculous Mycobacteria
Next Article in Special Issue
Prevalence and Characterization of Quinolone-Resistance Determinants in Escherichia coli Isolated from Food-Producing Animals and Animal-Derived Food in the Philippines
Previous Article in Journal
Can Vitamin B12 Assist the Internalization of Antisense LNA Oligonucleotides into Bacteria?
Previous Article in Special Issue
Antimicrobial Resistance of Escherichia coli and Pseudomonas aeruginosa from Companion Birds
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Trueperella pyogenes Isolates from Livestock and European Bison (Bison bonasus) as a Reservoir of Tetracycline Resistance Determinants

1
Department of Preclinical Sciences, Institute of Veterinary Medicine, Warsaw University of Life Sciences, Ciszewskiego 8 St., 02-786 Warsaw, Poland
2
Division of Veterinary Epidemiology and Economics, Institute of Veterinary Medicine, Warsaw University of Life Sciences, Nowoursynowska 159c St., 02-786 Warsaw, Poland
3
Department of Animal Genetics and Conservation, Institute of Animal Sciences, Warsaw University of Life Sciences, Ciszewskiego 8 St., 02-786 Warsaw, Poland
4
Department of Infectious Diseases and Preventive Medicine, Law and Ethics, University of Agricultural Sciences and Veterinary Medicine, Calea Mănăștur 3-5, 400372 Cluj-Napoca, Romania
*
Authors to whom correspondence should be addressed.
Antibiotics 2021, 10(4), 380; https://doi.org/10.3390/antibiotics10040380
Submission received: 15 February 2021 / Revised: 30 March 2021 / Accepted: 31 March 2021 / Published: 3 April 2021
(This article belongs to the Special Issue Antibiotic Resistance Genes: Spread and Evolution)

Abstract

:
Determinants of tetracycline resistance in Trueperella pyogenes are still poorly known. In this study, resistance to tetracycline was investigated in 114 T. pyogenes isolates from livestock and European bison. Tetracycline minimum inhibitory concentration (MIC) was evaluated by a microdilution method, and tetracycline resistance genes were detected by PCR. To determine variants of tetW and their linkage with mobile elements, sequencing analysis was performed. Among the studied isolates, 43.0% were tetracycline resistant (MIC ≥ 8 µg/mL). The highest MIC90 of tetracycline (32 µg/mL) was noted in bovine and European bison isolates. The most prevalent determinant of tetracycline resistance was tetW (in 40.4% of isolates), while tetA(33) was detected only in 8.8% of isolates. Four variants of tetW (tetW-1, tetW-2, tetW-3, tetW-4) were recognized. The tetW-3 variant was the most frequent and was linked to the ATE-1 transposon. The tetW-2 variant, found in a swine isolate, was not previously reported in T. pyogenes. This is the first report on determinants of tetracycline resistance in T. pyogenes isolates from European bison. These findings highlight that wild animals, including wild ruminants not treated with antimicrobials, can be a reservoir of tetracycline-resistant bacteria carrying resistance determinants, which may be easily spread among pathogenic and environmental microorganisms.

1. Introduction

Trueperella pyogenes, a Gram-positive irregular rod, is a commensal of the mucus membranes of the upper respiratory, gastrointestinal and urogenital tracts of animals, and as well as an opportunistic pathogen [1,2]. This bacterium can cause different infections, such as mastitis, metritis, pneumonia or abscesses in various organs and tissues in a broad range of livestock, including swine, cattle, goats and sheep [3,4,5,6]. Likewise, T. pyogenes purulent infections were reported in dogs and cats [7,8,9]. In addition, infections associated with T. pyogenes were also described in various species of wild mammals [10,11,12,13,14] and reptiles [15]. However, diseases caused by T. pyogenes are economically important in cattle and swine because they lead to serious losses, including significant losses in milk production and reproduction and a reduction in meat quality [6,16]. Similar effects of T. pyogenes infections are also observed in small ruminant breeding [6]. In humans, T. pyogenes infections were rarely reported and were mostly associated with occupational exposure through contact with farm animals and their environment [17,18].
Tetracyclines, broad-spectrum antibiotics, are frequently used as the first-choice drugs to prevent and treat human and animal infections, including T. pyogenes infections [6]. In addition, in some countries, these antimicrobials are still administrated as growth promoters in animal farming, especially poultry, cattle and swine [19,20]. Tetracycline, oxytetracycline, chlortetracycline and doxycycline are tetracyclines commonly applied in veterinary medicine [21,22]. Oxytetracycline is one of the antimicrobials most often used to treat clinical metritis. However, therapy with the long-acting oxytetracycline is not always a good choice for treatment metritis associated with T. pyogenes [23]. Currently, the wide use of tetracyclines is considered to be the main reason for increased antimicrobial resistance among Gram-negative and Gram-positive bacteria [24]. Importantly, the cross-resistance between different tetracyclines is noted. The resistance to tetracyclines is determined by several mechanisms that are supported by tetracycline resistance proteins known as Tet proteins. The most common tetracycline resistance mechanisms include an active efflux of drugs from the bacterial cell, ribosomal protection from drug action, and enzymatic inactivation of drugs [21,24,25]. Until now, 61 different tetracyclines resistance genes (tet) encoding Tet proteins, often associated with transposons or plasmids, have been characterized [24]. Due to the relation of the tet genes with mobile genetic elements, their distribution among strains, also belonging to different bacterial species, may be strongly widespread.
The tetracycline resistance in T. pyogenes was reported in several phenotypic studies, which referred mainly to isolates from cattle and swine [3,5,6,8,16,26,27,28,29,30,31,32,33,34,35]. In the case of isolates from wild animals, only limited data on the tetracycline resistance are available [5,10]. Moreover, genotypes of tetracycline resistance in T. pyogenes isolates of various origins are still poorly understood. Till now, two mechanisms of tetracycline resistance in T. pyogenes have been described, first associated with ribosomal protection proteins (RPPs) encoded by the tetW or tetM genes, and second relied on the activity of efflux pump proteins encoded by the tetK, tetL or tetA(33) genes [33,36,37]. Importantly, different antimicrobial resistance genes in T. pyogenes, including tetracycline resistance genes, may be associated with transposons [37], plasmids [36] or integron gene cassettes [26,38].
Currently, there are no T. pyogenes–specific breakpoints for antimicrobial susceptibility testing available in the Clinical and Laboratory Standards Institute (CLSI) guidelines [39]. Hence, the resistance to antimicrobials commonly used against T. pyogenes infections, including tetracyclines, should be incessantly monitored, as obtained data would be important to define missing breakpoints for this bacterium. Thus, in this study, we investigated the prevalence of tetracycline resistance and the distribution and characterization of tetracycline resistance determinants among a large collection of T. pyogenes, isolates from different host species, including unique isolates from European bison (Bison bonasus).

2. Results

2.1. Susceptibility to Tetracycline

Among 114 tested T. pyogenes isolates from a different origin, 49 (43.0%; CI 95%: 34.3%, 52.2%) were classified as resistant to tetracycline (MIC ≥ 8 µg/mL), and the MIC50 and MIC90 values for all isolates were 4 and 32 µg/mL, respectively. The distribution of tetracycline MIC values obtained for the studied isolates is presented in Table 1. The highest prevalence of tetracycline resistance was noted among the bovine isolates– 89.5% (34/38; CI 95%: 75.9%, 95.8%). The MIC50 and MIC90 of tetracycline for bovine isolates had the same value, 32 µg/mL. The significantly lower prevalence of tetracycline resistance was found in isolates from swine–33.3% (9/27; CI 95%: 18.6%, 52.2%; p < 0.001), European bison–16.7% (5/30; CI 95%: 7.3%, 33.6%; p <0.001) and small ruminants–5.3% (1/19; CI 95%: 0.9%, 24.6%; p < 0.001). There was no significant difference in the prevalence of tetracycline resistance between swine and European bison isolates (p = 0.219), nor between European bison and small ruminant isolates (p = 0.384). However, the prevalence of tetracycline resistance was significantly lower in small ruminants than in swine isolates (p = 0.031). The tetracycline MIC50 and MIC90 values for swine isolates were 4 and 8 µg/mL, respectively. The MIC50 for caprine and European bison isolates was the same, 0.25 µg/mL. However, the MIC90 value was different, 1 µg/mL for caprine isolates and 32 µg/mL for European bison isolates. Among small ruminant, T. pyogenes isolates, only one originated from a goat was resistant to tetracycline, while all ovine isolates were susceptible to the tested antibiotic, and the MIC50 and MIC90 values were ≤ 0.125 µg/mL.

2.2. Prevalence of Tetracycline Resistance Genes

The prevalence of selected tetracycline resistance genes was investigated for all tested T. pyogenes isolates (n = 114). The tetracycline resistance genotypes of T. pyogenes isolates are phenotypically classified as resistant (49/114), and the occurrence of resistance determinants among these isolates are summarized in Table 2. In 46 isolates out of 49 tetracycline-resistant isolates, the results of PCR with universal primer set indicated the presence of tetracycline resistance genes encoding RPPs. The RPPs genes were found in 32 bovines, nine swine and five European bison isolates. Then the presence of tetW, one of the more frequent genes encoding the tetracycline resistance RPPs, was studied by PCR using two different specific primer sets. In PCR with primers tetW_F and tetW_R, previously described [37], the positive result was obtained only for 38 isolates. In the case of 8 remaining isolates, amplicons obtained with universal primers were subjected to sequence analysis. Based on the analysis results, a new primer set for tetW was designed. The use of tetW-all_F and tetW-all_R primers (designed in this study) allowed to detection of tetW in all 46 T. pyogenes isolates, recognized previously as RPPs gene-positive with the universal primer set. Finally, it was confirmed that 46/114 isolates (40.4%; CI 95%: 31.8%, 49.5%) carried the tetW gene, including 32 of 38 bovine isolates (84.2%; CI 95%: 69.6%, 92.6%), nine of 27 swine isolates (33.3%; CI 95%: 18.6%, 52.2%) and five of 30 European bison isolates (16.7%; CI 95%: 7.3%, 33.6%).
Among all T. pyogenes isolates 8.8% (10/114; CI 95%: 4.8%, 15.4%) carried the tetA(33) gene, including nine of 38 bovine isolates (23.7%; CI 95%: 13.0%, 39.2%) and one of 13 caprine isolate (7.7%; CI 95%: 1.4%, 33.3%). The prevalence of the tetA(33) gene did not differ significantly between the bovine and caprine isolates (p = 0.419). Although, eight of the bovine isolates harbored both resistance genes, tetA(33) and tetW. Other tested genes, tetM, tetO, tetK, and tetL, were not detected in the studied isolates.
Generally, genetic tetracycline resistance determinants were found in 48 out of 49 tetracycline-resistant isolates (98.0%; CI 95%: 89.3%, 99.6%) that indicates the high accordance between the tetracycline resistance phenotype and genotype in the studied isolates (Table 2). Only one tetracycline-resistant bovine isolate (16/B), for which MIC was 8 µg/mL, did not carry any of the tested tet genes.

2.3. Sequence and Phylogenetic Analysis of the tet Genes

The sequence analysis of PCR products obtained using the universal primer set for tetracycline resistance RPPs genes was performed for 15 isolates, including 8 isolates in which tetW was not detected by PCR with the tetW primer set previously described [37], and 7 selected tetW-positive isolates confirmed by this reaction, used as controls of PCR specificity. The analysis showed that all amplicons should be identified as the tetW gene. According to the BLASTN analysis, the tetW sequences of six T. pyogenes swine isolates (10/S, 11/S, 12/S, 14/S, 17/S, 49/S) displayed 100% identity to each other, as well as 99.89% identity to the tetW-1 gene of Butyrivibrio fibrisolvens (AJ427421.2). However, the tetW nucleotide sequence of the 2/S isolate indicated 99.89% identity to tetW-2 of Megaspharea elsdenii (AY485124.1). A group of isolates, including two bovines (2/B, 26/B), one swine (8/S) and four isolates from European bison (3/Z, 8/Z, 10/Z, 14/Z), contained tetW displaying 100% identity to the sequence of the tetW-3 gene related to transposon ATE-1 from T. pyogenes (AY049983.2). However, the tetW nucleotide sequence of the 16/S isolate showed 100% identity to the tetW-4 gene associated with transposon ATE-2 from T. pyogenes (DQ517519.1).
The phylogenetic analysis showed that the sequences of tetW differed in the studied T. pyogenes isolates (Figure 1). Thus, based on noticed diversity, those isolates may be divided into four groups carrying variable variants of the tetW gene, such as tetW-1, tetW-2, tetW-3 and tetW-4 (Figure 1). The swine T. pyogenes isolates carried four different variants of tetW, while bovine and European bison isolates possessed only tetW-3 (Figure 1).
Importantly, the nucleotide sequences differed among the reported tetW variants in the studied isolates (Figure S1 of Supplementary Materials). Sequence analysis revealed that the tetW genes from European bison T. pyogenes isolates (8/Z and 14/Z) were 100% identity to each other and to the tetW sequences previously described in this bacterium (NG_048284.1, AY049983.2). Moreover, tetW from these T. pyogenes isolates shared 93.84% identity with tetW from Lawsonia intracellularis (NG_055990.1).
The nucleotide analysis of the tetA(33) sequences from two selected bovine T. pyogenes isolates (2/B and 26/B) revealed 100% identity with the tetA(33) from T. pyogenes (AY255627.1) and Corynebacterium glutamicum (NG_048127.1). In addition, these genes shared 99.59% identity with tetA(33) from Arthrobacter protophormiae (DQ077487.1).

2.4. Occurrence of tetW-3 Linked to the ATE-1 Transposon Among T. pyogenes Isolates

Based on the results of sequence analysis, tetW-3, a variant of the tetW gene, was suspected to be the most prevalent tetracycline resistance determinant among studied T. pyogenes isolates. To confirm this observation, a presence of the 522 bp fragment (tetW-3– orf110) characteristic for the tetW-3 variant linked to the ATE-1 transposon was investigated. The tetW-3 or f110 fragment was detected in 38 out of 46 tetracycline-resistant T. pyogenes isolates harboring tetW. All tetW-positive bovine (n = 32) and European bison (n = 5) isolates carried tetW-3 linked to ATE-1 transposon (Table 2). However, these genetic elements were found only in one swine isolate out of nine carrying tetW. These findings indicate that tetW-3, more important, associated with a mobile element, is the predominant tetracycline resistance determinant in T. pyogenes isolates from ruminants.

3. Discussion

In recent years, increasing antimicrobial resistance in bacteria of animal origin has become an important health and economic issue [40]. One of the well-recognized factors involved in the development of bacterial resistance is the overuse of antimicrobials in veterinary medicine [41]. The use of tetracyclines in food-producing animals in Europe is invariably higher compared to other antimicrobial classes [41]. According to the European Medicines Agency (EMA) tenth European Surveillance of Veterinary Antimicrobial Consumption (ESVAC) report, the sales of tetracyclines for food-producing animals in 2018 was the highest in Cyprus (155.2 mg/PCU) and the lowest in Norway (0.1 mg/PCU), while in Poland it was 47.3 mg/PCU [41]. In Poland, tetracyclines are widely used in livestock, especially in cattle and swine [42]. However, recently, an increase in tetracycline consumption in horses has been observed as well [42]. Moreover, these antimicrobials can also be found in medicinal feeds used for animals [22]. It should be highlighted that widespread use of tetracyclines in animals may lead to significant dissemination of bacteria resistant to these antimicrobials and to environmental accumulation of resistance determinants [43,44]. This problem also concerns the treatment of infections caused by T. pyogenes in livestock, mainly in cattle, for which tetracyclines are often used. Thus, in the present study, we investigated the tetracycline resistance mechanisms among T. pyogenes isolates of different origins, concerning unique isolates from European bison. Importantly, resistance genotypes and phenotypes were compared to obtain data important for further research on establishing tetracycline breakpoints specific for T. pyogenes.
Discussing the results of antimicrobial susceptibility testing should consider methodological differences may cause some interpretation inconsistencies. In the case of many studies, T. pyogenes isolates for which a tetracycline MIC was 8 µg/mL or higher were classified as resistant, like in our work [10,26,27,29,33].
In the present study, the high prevalence of tetracycline resistance (89.5%) in bovine T. pyogenes isolates (MIC90 = 32 µg/mL) was reported. A similar observation was noted by Zastempowska, and Lassa [28] for T. pyogenes isolates from bovine mastitis, also collected in Poland, among which 85.5% were reported as resistant to tetracycline. In Iran, the tetracycline resistance of T. pyogenes isolated from bovine mastitis and metritis ranges from 10.8% to 97.8% [32,34,35]. Similarly, in China, 70.0% of T. pyogenes isolates from bovine mastitis were tetracycline-resistant [31]. In this country, the high-frequency of resistance to tetracycline (68.8%), oxytetracycline (53.1%) and doxycycline (62.5%) was also shown in T. pyogenes isolates from bovine endometritis [26,33]. The high percentage, over the range from 41.7% to 54.2%, of tetracycline, chlortetracycline and oxytetracycline-resistant T. pyogenes isolates of bovine origin was noted in the United States [8,27]. Moreover, Ozturk et al. [30] reported 84.1% of bovine T. pyogenes strains isolated in Turkey as resistant to oxytetracycline. However, the MIC90 values of tetracycline, chlortetracycline, oxytetracycline, doxycycline and metacycline determined for T. pyogenes isolates from bovine endometritis in China, were 32 µg/mL, 16 µg/mL, 32 µg/mL, 16 µg/mL, and 8 µg/mL, respectively [33]. In Europe, the highest tetracycline MIC90 (64 µg/mL) was reported for bovine T. pyogenes isolates in Spain and Germany [6,45].
The tetracycline resistance at a relatively lower level has been noted for swine T. pyogenes isolates. In this study, 33.3% of swine isolates were classified as resistant to tetracycline, and MIC90 was 8 µg/mL. A similar rate of tetracycline-resistant swine T. pyogenes isolates, 41.7%, was found in the United States [8]. Furthermore, MIC90 determined for swine T. pyogenes isolated in Spain was 16 µg/mL [16]. Although, in some cases, higher tetracycline MIC50 values were reported for swine T. pyogenes isolates comparing to bovine ones, e.g., in the study of Yoshimura et al. [3], chlortetracycline MIC50 was 12.5 µg/mL for swine isolates and 6.25 µg/mL for bovine isolates. Differences in the consumption of tetracyclines used for the treatment of infections in swine and cattle seem to be one of the possible reasons for the observed divergence in a level of tetracycline resistance [8].
The resistance to tetracyclines in T. pyogenes isolated from small ruminants has been poorly examined to date. In the present study, we noted a low percentage of tetracycline-resistant caprine T. pyogenes isolates (7.7%), whereas all isolates from sheep were tetracycline-susceptible. These results confirmed the observations of Galán-Relaño et al. [6] that showed a relatively low prevalence of tetracycline-resistant T. pyogenes strains isolated from small ruminants in Spain. However, they demonstrated significantly higher tetracycline MIC90 values (16 µg/mL for caprine isolates and 8 µg/mL for ovine isolates) than that reported in our study (1 µg/mL for caprine isolates and ≤ 0.125 µg/mL for ovine isolates) [6]. Moreover, Fernández et al. [46] also reported the high MICs of tetracycline (16 µg/mL) for all tested T. pyogenes isolates from sheep in Spain.
It might seem that wild animals living in the environment with no antibiotic pressure are not a reservoir of antimicrobial-resistant bacteria. However, in our study, we demonstrated that wild ruminants, such as European bison, might be infected with tetracycline-resistant T. pyogenes strains. Admittedly, the rate of tetracycline-resistant isolates from those wild animals was relatively low (16.7%) but concurrently higher than that for isolates from goats or sheep. Interestingly, MIC90 of tetracycline for European bison isolates was the same as obtained for bovine isolates, although MIC50 was higher for bovine origin isolates. It should be highlighted that T. pyogenes isolates were collected from European bison never treated with any antimicrobials, thus in this case, an effect of selective pressure could be excluded. Our observations suggest a possibility of infection of those wild ruminants by T. pyogenes strains of bovine origin. The fact that European bison may use the agricultural land and the same grassland as cattle strongly indicates that transmission of resistant bacteria may occur among livestock and wild animals [47,48]. On the other hand, the fact that tetracycline resistance determinants can be acquired by T. pyogenes from other bacteria should also be considered. Similar observations concerning the tetracycline resistance in T. pyogenes that occurred in wild herbivores were previously noted for isolates from farmed white-tailed deer (Odocoileus virginianus) [10,49]. The occurrence of T. pyogenes isolates from cases of pneumonia in this animal species, resistant to chlortetracycline (48.3%) and oxytetracycline (31.0%), was reported. Moreover, MIC90 values of these antimicrobials were relatively high, 8 µg/mL and 16 µg/mL for chlortetracycline and oxytetracycline, respectively [10]. Conversely, the lower MIC90 (0.19 µg/mL) of tetracycline was reported for T. pyogenes isolates from cases of necrobacillosis in white-tailed deer [49].
Although the T. pyogenes resistance to tetracyclines has been widely reported, its genetic determinants were not well described. Our study showed that the tetracycline resistance in T. pyogenes was mainly associated with the presence of the tetW gene. This gene encodes TetW, one of the ribosomal protection proteins associated with tetracycline resistance [50]. The tetW gene was previously identified in many microorganisms, among others in anaerobic bacteria isolated from bovine and sheep rumen, swine feces and human fecal biota [51,52,53,54,55]. In the present study, tetW was detected in 40.4% of T. pyogenes isolates, mainly swine and bovine, classified as resistant, for which the tetracycline MIC values ranged from 8 to 32 µg/mL. Interestingly, Zastempowska and Lassa [28] found the tetW gene in all studied bovine T. pyogenes isolates from mastitis with the tetracycline MICs greater or equal 4 µg/mL. Generally, the presence of tetW in tetracycline-susceptible bacteria has been rarely reported [55]. In the study of Billington et al. [56], the tetW gene was the most prevalent in bovine, swine, and macaw T. pyogenes isolates resistant to tetracycline, chlortetracycline and oxytetracycline. The presence of this gene among bovine T. pyogenes isolates resistant to different tetracyclines was also reported in other studies [33,34,35]. Thus, the TetW protein probably determines resistance to various antimicrobials belonging to the class of tetracyclines. Until now, the data on the occurrence of the tetW gene among T. pyogenes isolates from wild animals were limited. Only in the case of three T. pyogenes isolates from gray slender lorises kept at Zoo, the presence of tetW was reported [14]. Moreover, the presence of this gene was also reported in one tetracycline-resistant T. pyogenes to isolate from birds [56]. Surprisingly, in our study, a significant percentage of the European bison T. pyogenes isolates carried the tetW gene as the main tetracycline resistance determinant. To the best of our knowledge, this is the first report on the prevalence of this gene in T. pyogenes isolates from European bison.
The differentiation of the tetW gene sequences was observed in various bacterial species, such as Megasphera elsdenii [53] or Bifidobacterium spp. [55,57]. Although, a detailed analysis of the tetW sequence has been rarely performed, and the variants of this gene the most often were not determined. Billington and Jost [37] described different sequence variants of the tetW gene, including tetW-1, tetW-3, tetW-4 and tetW-5, found in T. pyogenes. Similarly, in the studied T. pyogenes isolates of various origin, we detected tetW-1, tetW-3 and tetW-4 variants of tetW. Importantly, in one swine isolate, we found the tetW-2 variant, which was not previously reported in T. pyogenes. In this study, the tetW-1 and tetW-4 variants were related only to the swine isolates. However, tetW-3 was found in swine, bovine and European bison isolates. In contrast, Billington and Jost [37] identified this variant of tetW only in bovine isolates. Thus, this is the first description of the tetW-3 variant occurring in swine and European bison T. pyogenes isolates.
Importantly, it was showed that the flanking regions of tetW might have different sequences [54,55]. Therefore, a multiple nucleotide sequence alignment analysis was done for selected variants of the tetW gene, and the results are presented in Figure S1 of Supplementary Materials. As we suspected, some differences in the sequences of flanking regions of tetW-1 and tetW-3 were detected. This finding may explain false-negative results obtained for several isolates by PCR using the previously described primer set [37]. Since the reverse primer (tetW_R) sequence corresponds to the variable flanking region of tetW, this gene may not be detected in some tetracycline-resistant T. pyogenes isolates. The same problem was noted by Villedieu et al. [57] in a case of some tetracycline-resistant isolates of oral bacteria tested for the tetW presence by PCR using described primers. Therefore, in this study, we designed new primers specific for tetW, which link to the sequences inside this gene. The proposed primer set allows for the successful detection of all analyzed variants of the tetW gene. Nevertheless, all potential differences between sequences of tetW variants, especially of flanking regions, should be considered during the phylogenetic analysis of tetW relationships. Generally, our observations suggest that the studied T. pyogenes isolates might probably acquire the tetW gene from different bacterial species.
It is known that the tetW gene in T. pyogenes may be carried by different transposons, ATE-1, ATE-2 or ATE-3, usually depending on a variant of tetW [37]. In this study, the ATE-1 transposon was the most prevalent mobile genetic element related to the tetW gene in T. pyogenes. The tetW-3 variant linked to ATE-1 was found mainly in bovine and European bison isolates and in one swine isolate. In a single swine isolate, we found another transposon, ATE-2, carrying tetW-4, which was not previously noted in swine T. pyogenes. It is the first report on the occurrence of ATE-1 and ATE-2 transposons in T. pyogenes of swine origin. The remaining swine isolates in this study contained tetW-1, which is not connected to any known transposons in T. pyogenes. Interestingly, the tetW-3 gene found in European bison T. pyogenes isolates were linked to ATE-1 like in the bovine isolates. This observation also indicates the potential relationship between T. pyogenes isolates from cattle and European bison. Moreover, it seems that ATE-1 is a crucial genetic element involved in the widespread distribution of tetracycline resistance determinants among T. pyogenes strains that occurred in ruminants. However, the ATE-3 transposon was not detected in our study. The absence of ATE-3, which is frequently associated with the streptomycin resistance aadE gene [37], was not surprising as this gene was not found in the collection of T. pyogenes isolates in our previous investigation [38].
In the present study, we also tested the presence of two genes, tetM and tetO, encoding tetracycline resistance RPPs, TetM and TetO, respectively. Nevertheless, any of those genes were not found in the tested T. pyogenes isolates. On the contrary, tetM was detected in T. pyogenes isolates from bovine endometritis by Zhang et al. [33], while the absence of tetO was consistent with our results.
Another tetracycline resistance determinant revealed in the studied T. pyogenes isolates was tetA(33). This gene encodes the tetracycline-specific efflux pump protein–TetA(33), a member of the major facilitator superfamily (MFS) of efflux pumps [36]. TetA(33) was previously described in Corynebacterium glutamicum as one of two repressor-regulated tetracycline resistance determinants of efflux systems in Gram-positive bacteria [58]. The presence of the tetA(33) gene was demonstrated in T. pyogenes for the first time by Jost et al. [36]. Additionally, this gene can be found in some whole-genome sequences of T. pyogenes deposited in the GenBank database (CP033904.1, CP029004.1, CP029001.1). Our results indicated the relatively low prevalence (8.8%) of the tetA(33) gene among the studied T. pyogenes isolates. This gene was detected in tetracycline-resistant, mainly bovine and single caprine isolates. To the best of our knowledge, this gene was not previously reported in T. pyogenes isolated from goat. It is worth noting that in the case of two isolates, in which tetA(33) was the only gene related to the tetracycline resistance phenotype, the MIC of tetracycline was 8 µg/mL. However, for T. pyogenes isolates harboring two tetracycline resistance genes, tetW and tetA(33), the MIC of tetracycline ranged from 16 to 32 µg/mL. The tetA(33) gene in C. glutamicum and T. pyogenes is associated with the insertion sequence IS6100 located in a plasmid, pTET3 or pAP2, respectively [36,58]. Additionally, the pAP2 plasmid of T. pyogenes may also contain, except tetA(33), a macrolide resistance determinant–ermX, whereas a presence of both those genes is not closely related [36]. Surprisingly, tetA(33) associated with IS6100 located in the T. pyogenes chromosomal DNA was also reported [59].
Moreover, in our study, we investigated the presence of two other genes, tetK and tetL, encoding proteins associated with the efflux pump mechanism in T. pyogenes. The presence of both these genes in bovine T. pyogenes isolates was previously reported by Zhang et al. [33], but they were not detected in this study.
There are still limited data concerning antimicrobials’ destiny in the environment and their effect on the development and emergence of antimicrobial resistance in bacteria. It is well-known that the overuse of antimicrobials in agriculture may lead to an increased selection of resistant strains [60]. However, it seems that one of the essential reasons for a high prevalence of antimicrobial resistance genes in the environment may be the horizontal transfer of these genes from fecal microbiota of livestock to environmental bacteria [61,62]. The tetW gene, the most widespread tetracycline resistance determinant in bacteria of different origins, may be a good example of disseminating resistance genes among clinical and environmental strains. The occurrence of tetW in soil and water samples nearby of swine and cattle farms is evidence of the persistence of resistance genes in the various environment, including wildlife [52,61,63,64,65]. Our findings obtained for T. pyogenes isolated from European bison also confirmed the easy spread of tetW among strains that occurred in wild ruminants.

4. Materials and Methods

4.1. Bacterial Isolates and Culture Conditions

A total of 114 T. pyogenes isolates from livestock (38 from cattle, 27 from swine, 13 from goats, six from sheep) and free-living or captive European bison (n = 30) in Poland were studied. Clinical specimens were obtained from animals with different types of infections: purulent lesions or abscesses in various tissues (two from cattle, 13 from goats, seven from swine, six from sheep, 12 from European bison), pneumonia (20 from swine, three from European bison), mastitis (26 from cattle), metritis (10 from cattle) and balanoposthitis (15 from European bison). Bacteria were cultured on Columbia Agar supplemented with 5% sheep blood (CAB) (Graso Biotech, Starogard Gdański, Poland) at 37 °C in 5% CO2 atmosphere for 48 h. T. pyogenes isolates were identified based on the phenotypic properties [5,11]. Additionally, the species-specific pyolysin gene (plo) was detected. The sequence of primers and PCR cycling conditions used for plo detection are presented in Table 3. The majority of isolates used in this study (n = 95) were identified previously [5,11]. The remaining isolates characterized in this investigation (n = 19) are described in Table S1 of Supplementary Materials.
Four reference strains, T. pyogenes ATCC®19411, T. pyogenes ATCC®49698, Escherichia coli ATCC®25922 and Staphylococcus aureus ATCC®25923, were included as controls for antimicrobial susceptibility testing.

4.2. Tetracycline Susceptibility Testing

Antimicrobial susceptibility for 95 of the studied isolates was previously carried out by the strip diffusion method using Etest® strips [5]. In this study, tetracycline susceptibility testing for all 114 T. pyogenes isolates was performed by the standard microdilution method according to the CLSI guidelines [71]. The bacterial inoculum (approximately 4 × 105 CFU/mL) was prepared in Mueller–Hinton broth (Difco, Franklin Lakes, NJ, USA) containing 5% (v/v) fetal calf serum (Graso Biotech, Starogard Gdański, Poland), and 100 µL of the inoculum was added into 96 wells of a microtiter plate. Double serial dilutions of tetracycline (Sigma-Aldrich, Steinheim, Germany) were performed in Mueller–Hinton broth (Difco, Franklin Lakes, New Jersey, USA) containing 5% (v/v) fetal calf serum (Graso Biotech, Starogard Gdański, Poland) and then 100 µL of each dilution was added into the respective well, to receive a final tetracycline concentration over the range 128 µg/mL to 0.125 µg/mL. Microtiter plates were incubated at 37 °C in a 5% CO2 atmosphere for 24 h. A MIC value was recorded as the lowest concentration of tetracycline that visibly inhibited bacterial growth. In addition, tetracycline concentrations required to inhibit the growth of 50% and 90% of isolates (MIC50 and MIC90, respectively) were also determined. In the current CLSI guidelines, VET06 and VET08, there are no available tetracycline breakpoints specific for T. pyogenes [39,72]. Thus, MIC breakpoints used in this study to classify isolates as susceptible (≤4 µg/mL) or resistant (≥16 µg/mL, also included intermediate, 8 µg/mL) to tetracycline were based on the interpretative criteria recommended for Corynebacterium spp. and coryneforms according to the CLSI guidelines [39].

4.3. DNA Extraction

A simple boiling method was used for DNA extraction from the tested T. pyogenes isolates. Briefly, several colonies from a 48 h culture of an isolate on CAB were suspended in 500 µL of nuclease-free water. The suspension was heated at 99 °C for 10 min, cooled on ice and centrifuged (6 min, 10,500× g). The supernatant was collected and stored at -20 °C until further use.

4.4. Detection of Tetracycline Resistance Genes

The presence of genes associated with the tetracycline resistance was examined by standard PCR using universal primers for different tet genes encoding RPPs, primers specific for both the tetK and tetL genes, and the primer sets for detecting genes encoding particular tetracycline resistance determinants, such as tetW, tetM, tetO, tetA(33), tetK, and tetL (Table 3). The tetW, tetM and tetO genes are associated with the ribosomal protection mechanism, while tetK, tetL and tetA(33) with the efflux pump mechanism. Two various pairs of primers were used for tetW detection (Table 3). All PCR reactions were performed in a 25 μL reaction mixture containing DreamTaq master mix (2X) (Thermo Fisher Scientific, Waltham, MA, USA), nuclease-free water (Thermo Fisher Scientific, Waltham, MA, USA), 10 pmol of each primer (Genomed, Warsaw, Poland) and 70–90 ng of a template DNA. The thermal cycling conditions are presented in Table 3. Reaction products were recognized by electrophoresis (85 V by 45 min) in 1% (w/v) agarose gel in TAE buffer with Midori green DNA stain (Nippon Genetics, Düren, Germany), visualized and analyzed using a VersaDoc Model 1000 imaging system and Quantity One software (version 4.4.0) (Bio-Rad, Hercules, CA, USA). DNA obtained from the clinical isolates, Enterococcus faecium TR2 and Lactobacillus acidophilus 2499, was used as a positive control in the PCR reactions for tetM and tetK, respectively. DNA from T. pyogenes 2/B and 26/B isolates, after sequencing of PCR products, was applied as a positive control for tetW and tetA(33) PCR, respectively. The pVir plasmid of Campylobacter jejuni was a positive control for the tetO detection.

4.5. Sequencing and Phylogenetic Analysis

The selected amplicons obtained with universal primers for tet genes encoding RPPs, as well as with primers specific for the tetW and tetA(33) genes, were sequenced (Genomed, Warsaw, Poland) in order to confirm the specificity of reactions. In cases of T. pyogenes isolates positive in PCR with universal DI_F and DII_R primers, but negative in PCR with primers tetW_F and tetW_R as well with primers specific for other tested genes, the amplicons obtained with the universal primer set were sequenced in order to establish a type of the tet gene. All sequencing files were evaluated using the Chromas 2.6.5 software (http://www.technelysium.com.au/chromas.html, accessed on 15 February 2021). Subsequently, the obtained nucleotide sequences were compared with the sequences available in the GenBank database using the nucleotide BLAST program carried out on the National Center for Biotechnology Information (NCBI) website (http://blast.ncbi.nlm.nih.gov, accessed on 15 February 2021) [73]. The alignment was performed using the multiple sequence alignment program Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/, accessed on 15 February 2021). A phylogenetic analysis was performed for selected isolates based on the sequences of the tetW gene obtained by PCR with universal primers. The phylogenetic tree was constructed using the neighbor-joining method [74,75] in MEGA X [76]. The reliability of the tree was evaluated by the bootstrap method with 1000 replications [77].

4.6. Detection of tetW-3 Linkage with the ATE-1 T. pyogenes Transposon

A linkage of tetW-3, one of the variants of the tetW gene, with the ATE-1 transposon was studied by amplification of the 522 bp DNA fragment extending from downstream of tetW-3 (covered region: 260–281 bp of tetW-3) into orf110 (covered region: 97–118 bp of orf110) of the ATE-1 transposon, according to Billington and Jost [37]. The PCR using ATE-1_F and ATE-1_R primers, in conditions presented in Table 3, was performed for all tetracycline-resistant T. pyogenes isolates.

4.7. Developing of New Primers for tetW Detection

A new primer set was developed to detect the tetW gene regardless of its variant. The primers tetW-all_F and tetW-all_R were designed using the Primer-Blast (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 15 February 2021) and checked using an Oligo Analysis Tool (https://www.eurofinsgenomics.eu/en/ecom/tools/oligo-analysis/, accessed on 15 February 2021).

4.8. Nucleotide Sequence Accession Numbers

The nucleotide sequence of the tetW gene from T. pyogenes European bison isolate (8/Z) from this study was deposited in GenBank under accession number MT798857. Furthermore, the sequence of the tetA(33) gene from the bovine T. pyogenes isolate (26/B) was also deposited in GenBank under accession number MT798858.

4.9. Statistical Analysis

Categorical variables were presented as a count and frequency in a group and compared between groups using the two-tailed Fisher’s exact test. The Wilson score method was used to calculate 95% confidence intervals (CI 95%) for percentages. A significance level (α) was set at 0.05. Statistical analysis was performed in TIBCO Statistica 13.3.0 (TIBCO Software Inc., Palo Alto, CA, USA).

5. Conclusions

The present study provides significant data about the tetracycline resistance mechanisms among T. pyogenes isolates from livestock and European bison. Our findings suggest that not only bovine and swine T. pyogenes isolates, but also strains prevalent in wildlife may be a source of the tetracycline resistance genes. Moreover, it was confirmed that two main resistance mechanisms: one associated with ribosomal protection proteins encoded by different variants of the tetW gene linked to the ATE-1 or ATE-2 transposons, and another related to active efflux pump proteins encoded by the tetA(33) gene, determine resistance to tetracycline in T. pyogenes. Both mentioned genes may be acquired. However, the tetW gene is the most prevalent tetracycline resistance determinant in this bacterium. Most importantly, the presence of tetW among T. pyogenes isolates from European bison was reported in our study for the first time. Thus, these wild ruminants should be considered as a potential reservoir of tetracycline-resistant T. pyogenes strains. Nevertheless, further investigation on determinants of tetracycline resistance and their association with mobile genetic elements in T. pyogenes are needed, especially to improve interpretive criteria important for susceptibility testing, and consequently to use the most appropriate antibiotic treatment of infections caused by this pathogen.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/antibiotics10040380/s1, Figure S1: Figure S1. Multiple nucleotide sequence alignment of different variants of the tetW gene., Table S1: Table S1. Origin and characteristics of Trueperella pyogenes isolates (n=19) identified in this study, which have not been previously described.

Author Contributions

Conceptualization, E.K., I.S. and M.R.; funding acquisition, W.O., M.R.; methodology, E.K., I.S., D.C.-C., M.K.-Ś., A.M. and M.R.; resources, E.K., D.C.-C., M.K.-Ś., A.M. and M.R.; investigation, E.K., I.S.; formal analysis, E.K., I.S., M.S. and M.R.; writing—original draft preparation, E.K.; writing—review and editing, I.S., W.O., M.S., M.B. and M.R.; supervision, M.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the project “Complex project of European bison conservation by State Forests”, which is financed by the Forest Found (Poland), contract no. OR.271.3.10.2017.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article or supplementary material.

Acknowledgments

The authors thank Barbara Chojnacka, Alicja Grzechnik and Małgorzata Murawska for excellent technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jost, B.H.; Billington, S.J. Arcanobacterium pyogenes: Molecular pathogenesis of an animal opportunist. Antonie Leeuwenhoek 2005, 88, 87–102. [Google Scholar] [CrossRef]
  2. Rzewuska, M.; Kwiecień, E.; Chrobak-Chmiel, D.; Kizerwetter-Świda, M.; Stefańska, I.; Gieryńska, M. Pathogenicity and Virulence of Trueperella pyogenes: A Review. Int. J. Mol. Sci. 2019, 20, 2737. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Yoshimura, H.; Kojima, A.; Ishimaru, M. Antimicrobial susceptibility of Arcanobacterium pyogenes isolated from cattle and pigs. J. Vet. Med. B Infect. Dis. Vet. Public Health 2000, 47, 139–143. [Google Scholar] [CrossRef] [PubMed]
  4. Ribeiro, M.G.; Risset, R.M.; Bolaños, C.A.; Caffaro, K.A.; de Morais, A.C.; Lara, G.H.; Zamprogna, T.O.; Paes, A.C.; Listoni, F.J.; Franco, M.M. Trueperella pyogenes multispecies infections in domestic animals: A retrospective study of 144 cases (2002 to 2012). Vet. Q. 2015, 35, 82–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Rzewuska, M.; Czopowicz, M.; Gawryś, M.; Markowska-Daniel, I.; Bielecki, W. Relationships between antimicrobial resistance, distribution of virulence factor genes and the origin of Trueperella pyogenes isolated from domestic animals and European bison (Bison bonasus). Microb. Pathog. 2016, 96, 35–41. [Google Scholar] [CrossRef]
  6. Galán-Relaño, Á.; Gómez-Gascón, L.; Barrero-Domínguez, B.; Luque, I.; Jurado-Martos, F.; Vela, A.I.; Sanz-Tejero, C.; Tarradas, C. Antimicrobial susceptibility of Trueperella pyogenes isolated from food-producing ruminants. Vet. Microbiol. 2020, 242, 108593. [Google Scholar] [CrossRef]
  7. Billington, S.J.; Post, K.W.; Jost, B.H. Isolation of Arcanobacterium (Actinomyces) pyogenes from cases of feline otitis externa and canine cystitis. J. Vet. Diagn. Investig. 2002, 14, 159–162. [Google Scholar] [CrossRef] [Green Version]
  8. Trinh, H.T.; Billington, S.J.; Field, A.C.; Songer, J.G.; Jost, B.H. Susceptibility of Arcanobacterium pyogenes from different sources to tetracycline, macrolide and lincosamide antimicrobial agents. Vet. Microbiol. 2002, 85, 353–359. [Google Scholar] [CrossRef]
  9. Wareth, G.; El-Diasty, M.; Melzer, F.; Murugaiyan, J.; Abdulmawjood, A.; Sprague, L.D.; Neubauer, H. Trueperella pyogenes and Brucella abortus coinfection in a dog and a cat on a dairy farm in Egypt with recurrent cases of mastitis and abortion. Vet. Med. Int. 2018, 2056436. [Google Scholar] [CrossRef] [Green Version]
  10. Tell, L.A.; Brooks, J.W.; Lintner, V.; Matthews, T.; Kariyawasam, S. Antimicrobial susceptibility of Arcanobacterium pyogenes isolated from the lungs of white-tailed deer (Odocoileus virginianus) with pneumonia. J. Vet. Diagn. Investig. 2011, 23, 1009–1013. [Google Scholar] [CrossRef] [Green Version]
  11. Rzewuska, M.; Stefańska, I.; Osińska, B.; Kizerwetter-Świda, M.; Chrobak, D.; Kaba, J.; Bielecki, W. Phenotypic characteristics and virulence genotypes of Trueperella (Arcanobacterium) pyogenes strains isolated from European bison (Bison bonasus). Vet. Microbiol. 2012, 160, 69–76. [Google Scholar] [CrossRef]
  12. Salleng, K.J.; Burton, B.J.; Apple, T.M.; Sanchez, S. Isolation of Trueperella pyogenes in a case of thoracic and abdominal abscess in a galago (Otolemur garnettii). J. Med. Primatol. 2016, 45, 198–201. [Google Scholar] [CrossRef]
  13. Tarazi, Y.H.; Al-Ani, F.K. An Outbreak of dermatophilosis and caseous lymphadenitis mixed infection in camels (Camelus dromedaries) in Jordan. J. Infect. Dev. Ctries. 2016, 10, 506–511. [Google Scholar] [CrossRef] [Green Version]
  14. Nagib, S.; Glaeser, S.P.; Eisenberg, T.; Sammra, O.; Lämmler, C.; Kämpfer, P.; Schauerte, N.; Geiger, C.; Kaim, U.; Prenger-Berninghoff, E.; et al. Fatal infection in three Grey Slender Lorises (Loris lydekkerianus nordicus) caused by clonally related Trueperella pyogenes. BMC Vet. Res. 2017, 13, 273. [Google Scholar] [CrossRef] [Green Version]
  15. Ülbegi-Mohyla, H.; Hijazin, M.; Alber, J.; Lämmler, C.; Hassan, A.A.; Abdulmawjood, A.; Prenger-Berninghoff, E.; Weiß, R.; Zschöck, M. Identification of Arcanobacterium pyogenes isolated by post mortem examinations of a bearded dragon and a gecko by phenotypic and genotypic properties. J. Vet. Sci. 2010, 11, 265–267. [Google Scholar] [CrossRef] [Green Version]
  16. Galán-Relaño, Á.; Gómez-Gascón, L.; Luque, I.; Barrero-Domínguez, B.; Casamayor, A.; Cardoso-Toset, F.; Vela, A.I.; Fernández-Garayzábal, J.F.; Tarradas, C. Antimicrobial susceptibility and genetic characterization of Trueperella pyogenes isolates from pigs reared under intensive and extensive farming practices. Vet. Microbiol. 2019, 232, 89–95. [Google Scholar] [CrossRef] [PubMed]
  17. Plamondon, M.; Martinez, G.; Raynal, L.; Touchette, M.; Valiquette, L. A fatal case of Arcanobacterium pyogenes endocarditis in a man with no identified animal contact: Case report and review of the literature. Eur. J. Clin. Microbiol. Infect. Dis. 2007, 26, 663–666. [Google Scholar] [CrossRef] [PubMed]
  18. Kavitha, K.; Latha, R.; Udayashankar, C.; Jayanthi, K.; Oudeacoumar, P. Three Cases of Arcanobacterium Pyogenes-Associated Soft Tissue Infection. J. Med. Microbiol. 2010, 59, 736–739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. di Cerbo, A.; Pezzuto, F.; Guidetti, G.; Canello, S.; Corsi, L. Tetracyclines: Insights and updates of their use in human and animal pathology and their potential toxicity. Open Biochem. J. 2019, 13, 1–12. [Google Scholar] [CrossRef] [Green Version]
  20. Lees, P.; Pelligand, L.; Giraud, E.; Toutain, P.L. A history of antimicrobial drugs in animals: Evolution and revolution. J. Vet. Pharmacol. Therap. 2020, 1–35. [Google Scholar] [CrossRef] [PubMed]
  21. Michalova, E.; Novotna, P.; Schlegelova, J. Tetracyclines in veterinary medicine and bacterial resistance to them. Vet. Med. Czech 2004, 49, 79–100. [Google Scholar] [CrossRef] [Green Version]
  22. Patyra, E.; Przeniosło-Siwczyńska, M.; Grelik, A.; Kwiatek, K. Występowanie tetracyklin w paszach—Przyczyny i skutki. Med. Weter. 2019, 75, 280–286. [Google Scholar] [CrossRef]
  23. Mileva, R.; Karadaev, M.; Fasulkov, I.; Petkova, T.; Rusenova, N.; Vasilev, N.; Milanova, A. Oxytetracycline Pharmacokinetics after Intramuscular Administration in Cows with Clinical Metritis Associated with Trueperella pyogenes Infection. Antibiotics 2020, 9, 392. [Google Scholar] [CrossRef]
  24. Roberts, M.C. Tetracyclines: Mode of Action and their Bacterial Mechanisms of Resistance. In Bacterial Resistance to Antibiotics—From Molecules to Man; Bonev, B.B., Brown, N.M., Eds.; Wiley–Blackwell: Hoboken, NJ, USA, 2019; pp. 101–124. [Google Scholar]
  25. Sheykhsaran, E.; Baghi, H.B.; Soroush, M.H.; Ghotaslou, R. An overview of tetracyclines and related resistance mechanisms. Rev. Med. Microbiol. 2019, 30, 69–75. [Google Scholar] [CrossRef]
  26. Liu, M.C.; Wu, C.M.; Liu, Y.C.; Zhao, J.C.; Yang, Y.L.; Shen, J.Z. Identification, susceptibility, and detection of integron-gene cassettes of Arcanobacterium pyogenes in bovine endometritis. J. Dairy Sci. 2009, 92, 3659–3666. [Google Scholar] [CrossRef] [PubMed]
  27. Santos, T.M.; Caixeta, L.S.; Machado, V.S.; Rauf, A.K.; Gilbert, R.O.; Bicalho, R.C. Antimicrobial resistance and presence of virulence factor genes in Arcanobacterium pyogenes isolated from the uterus of postpartum dairy cows. Vet. Microbiol. 2010, 145, 84–89. [Google Scholar] [CrossRef]
  28. Zastempowska, E.; Lassa, H. Genotypic characterization and evaluation of an antibiotic resistance of Trueperella pyogenes (Arcanobacterium pyogenes) isolated from milk of dairy cows with clinical mastitis. Vet. Microbiol. 2012, 161, 153–159. [Google Scholar] [CrossRef] [PubMed]
  29. de Boer, M.; Heuer, C.; Hussein, H.; McDougall, S. Minimum inhibitory concentrations of selected antimicrobials against Escherichia coli and Trueperella pyogenes of bovine uterine origin. J. Dairy Sci. 2015, 98, 4427–4438. [Google Scholar] [CrossRef] [Green Version]
  30. Ozturk, D.; Turutoglu, H.; Pehlivanoglu, F.; Guler, L. Virulence Genes, Biofilm Production and Antibiotic Susceptibility in Trueperella pyogenes Isolated from Cattle. Isr. J. Vet. Med. 2016, 71, 36–42. [Google Scholar]
  31. Alkasir, R.; Wang, J.; Gao, J.; Ali, T.; Zhang, L.; Szenci, O.; Bajcsy, A.C.; Han, B. Properties and antimicrobial susceptibility of Trueperella pyogenes isolated from bovine mastitis in China. Acta Vet. Hung. 2016, 64, 1–12. [Google Scholar] [CrossRef] [Green Version]
  32. Momtaz, H.; Ghafari, A.; Sheikh-Samani, A.; Jhazayeri, A. Detecting Virulence Factors and Antibiotic Resistance Pattern of Trueperella Pyogenes Isolated from Bovine Mastitic Milk. Int. J. Med. Lab. 2016, 3, 134–141. [Google Scholar]
  33. Zhang, D.; Zhao, J.; Wang, Q.; Liu, Y.; Tian, C.; Zhao, Y.; Yu, L.; Liu, M. Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution. Microb. Pathog. 2017, 105, 51–56. [Google Scholar] [CrossRef] [PubMed]
  34. Ashrafi Tamai, I.; Mohammadzadeh, A.; Zahraei Salehi, T.; Mahmoodi, P. Genomic characterisation, detection of genes encoding virulence factors and evaluation of antibiotic resistance of Trueperella pyogenes isolated from cattle with clinical metritis. Antonie Leeuwenhoek 2018, 111, 2441–2453. [Google Scholar] [CrossRef]
  35. Rezanejad, M.; Karimi, S.; Momtaz, H. Phenotypic and molecular characterization of antimicrobial resistance in Trueperella pyogenes strains isolated from bovine mastitis and metritis. BMC Microbiol. 2019, 19, 305. [Google Scholar] [CrossRef]
  36. Jost, B.H.; Field, A.C.; Trinh, H.T.; Songer, J.G.; Billington, S.J. Tylosin Resistance in Arcanobacterium pyogenes Is Encoded by an Erm X Determinant. Antimicrob. Agents Chemother. 2003, 47, 3519–3524. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  37. Billington, S.J.; Jost, B.H. Multiple Genetic Elements Carry the Tetracycline Resistance Gene tet(W) in the Animal Pathogen Arcanobacterium pyogenes. Antimicrob. Agents Chemother. 2006, 50, 3580–3587. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Kwiecień, E.; Stefańska, I.; Chrobak-Chmiel, D.; Sałamaszyńska-Guz, A.; Rzewuska, M. New Determinants of Aminoglycoside Resistance and Their Association with the Class 1 Integron Gene Cassettes in Trueperella pyogenes. Int. J. Mol. Sci. 2020, 20, 4230. [Google Scholar] [CrossRef] [PubMed]
  39. CLSI. Methods for Antimicrobial Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria Isolated from Animals, 1st ed.; CLSI Supplement VET06; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017. [Google Scholar]
  40. Palma, E.; Tilocca, B.; Roncada, P. Antimicrobial Resistance in Veterinary Medicine: An Overview. Int. J. Mol. Sci. 2020, 21, 1914. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  41. EMA. European Surveillance of Veterinary Antimicrobial Consumption; Sales of Veterinary Antimicrobial Agents in 31 European Countries in 2018; European Medicines Agency: Amsterdam, The Netherlands, 2020; p. 24309. [Google Scholar]
  42. Krasucka, D.; Biernacki, B.; Szumiło, J.; Burmańczuk, A. Monitoring zużycia leków przeciwdrobnoustrojowych u bydła, trzody chlewnej I koni w Polsce w latach 2014–2016 na podstawie Programu Wieloletniego. Życie Weter. 2017, 92, 578–581. [Google Scholar]
  43. European Food Safety Authority and European Centre for Disease Prevention and Control (EFSA and ECDC). The European Union Summary Report on Antimicrobial Resistance in zoonotic and indicator bacteria from humans, animals and food in 2017/2018. EFSA J. 2018, 18, 6007. [Google Scholar] [CrossRef] [Green Version]
  44. Luo, L.; Zhang, C.; Zhang, Z.; Peng, J.; Han, Y.; Wang, P.; Kong, X.; Rizwan, H.M.; Zhang, D.; Su, P.; et al. Differences in Tetracycline Antibiotic Resistance Genes and Microbial Community Structure During Aerobic Composting and Anaerobic Digestion. Front. Microbiol. 2020, 11, 583995. [Google Scholar] [CrossRef] [PubMed]
  45. Pohl, A.; Lübke-Becker, A.; Heuwieser, W. Minimum inhibitory concentrations of frequently used antibiotics against Escherichia coli and Trueperella pyogenes isolated from uteri of postpartum dairy cows. J. Dairy Sci. 2018, 101, 1355–1364. [Google Scholar] [CrossRef] [PubMed]
  46. Fernández, E.P.; Vela, A.I.; Las Heras, A.; Domínguez, L.; Fernández-Garayzábal, J.F.; Moreno, M.A. Antimicrobial susceptibility of corynebacteria isolated from ewe’s mastitis. Int. J. Antimicrob. Agents 2001, 18, 571–574. [Google Scholar] [CrossRef]
  47. Krasińska, M.; Krasiński, Z.A. European Bison—The Nature Monograph; Mammal Research Institute, Polish Academy of Sciences: Białowieża, Poland, 2007; pp. 141–191. [Google Scholar]
  48. Klich, D.; Łopucki, R.; Stachniuk, A.; Sporek, M.; Fornal, E.; Wojciechowska, M.; Olech, W. Pesticides and conservation of large ungulates: Health risk to European bison from plant protection products as a result of crop depredation. PLoS ONE 2020, 15, e0228243. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Chirino-Trejo, M.; Woodbury, M.R.; Huang, F. Antibiotic sensitivity and biochemical characterization of Fusobacterium spp. and Arcanobacterium pyogenes isolated from farmed white-tailed deer (Odocoileus virginianus) with necrobacillosis. J. Zoo Wildl. Med. 2003, 34, 262–268. [Google Scholar] [CrossRef]
  50. Connell, S.R.; Tracz, D.M.; Nierhaus, K.H.; Taylor, D.E. Ribosomal protection proteins and their mechanism of tetracycline resistance. Antimicrob. Agents Chemother. 2003, 47, 3675–3681. [Google Scholar] [CrossRef] [Green Version]
  51. Barbosa, T.M.; Scott, K.P.; Flint, H.J. Evidence for recent intergeneric transfer of a new tetracycline resistance gene, tet(W), isolated from Butyrivibrio fibrisolvens, and the occurrence of tet(O) in ruminal bacteria. Environ. Microbiol. 1999, 1, 53–64. [Google Scholar] [CrossRef] [PubMed]
  52. Melville, C.M.; Brunel, R.; Flint, H.J.; Scott, K.P. The Butyrivibrio fibrisolvens tet(W) Gene Is Carried on the Novel Conjugative Transposon TnB1230, Which Contains Duplicated Nitroreductase Coding Sequences. J. Bacteriol. 2004, 186, 3656–3659. [Google Scholar] [CrossRef] [Green Version]
  53. Stanton, T.B.; McDowall, J.S.; Rasmussen, M.A. Diverse Tetracycline Resistance Genotypes of Megasphaera elsdenii Strains Selectively Cultured from Swine Feces. Appl. Environ. Microbiol. 2004, 70, 3754–3757. [Google Scholar] [CrossRef] [Green Version]
  54. Kazimierczak, K.A.; Flint, H.J.; Scott, K.P. Comparative Analysis of Sequences Flanking tet(W) Resistance Genes in Multiple Species of Gut Bacteria. Antimicrob. Agents Chemother. 2006, 50, 2632–2639. [Google Scholar] [CrossRef] [Green Version]
  55. Ammor, M.S.; Flórez, A.B.; Alvarez-Martín, P.; Margolles, A.; Mayo, B. Analysis of Tetracycline Resistance tet(W) Genes and Their Flanking Sequences in Intestinal Bifidobacterium Species. J. Antimicrob. Chemother. 2008, 62, 688–693. [Google Scholar] [CrossRef] [Green Version]
  56. Billington, S.J.; Songer, J.G.; Jost, B.H. Widespread Distribution of a Tet W Determinant among Tetracycline-Resistant Isolates of the Animal Pathogen Arcanobacterium pyogenes. Antimicrob. Agents Chemother. 2002, 46, 1281–1287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Villedieu, A.; Diaz-Torres, M.L.; Hunt, N.; McNab, R.; Spratt, D.A.; Wilson, M.; Mullany, P. Prevalence of Tetracycline Resistance Genes in Oral Bacteria. Antimicrob. Agents Chemother. 2003, 47, 878–882. [Google Scholar] [CrossRef] [Green Version]
  58. Tauch, A.; Götker, S.; Pühler, P.; Kalinowski, J.; Thierbach, G. The 27.8-kb R-plasmid pTET3 from Corynebacterium glutamicum encodes the aminoglycoside adenyltransferase gene cassette aadA9 and the regulated tetracycline efflux system Tet 33 flanked by active copies of the widespread insertion sequence IS6100. Plasmid 2002, 48, 117–129. [Google Scholar] [CrossRef]
  59. Dong, W.L.; Xu, Q.J.; Atiah, L.A.; Odah, K.A.; Gao, Y.H.; Kong, L.C.; Ma, H.X. Genomic island type IV secretion system and transposons in genomic islands involved in antimicrobial resistance in Trueperella pyogenes. Vet. Microbiol. 2020, 242, 108602. [Google Scholar] [CrossRef] [PubMed]
  60. Doidge, C.; Ruston, A.; Lovatt, F.; Hudson, C.; King, L.; Kaler, J. Farmers’ Perceptions of Preventing Antibiotic Resistance on Sheep and Beef Farms: Risk, Responsibility, and Action. Front. Vet. Sci. 2020, 7, 524. [Google Scholar] [CrossRef]
  61. Santamaría, J.; López, L.; Soto, C.Y. Detection and Diversity Evaluation of Tetracycline Resistance Genes in Grassland-Based Production Systems in Colombia, South America. Front. Microbiol. 2011, 2, 252. [Google Scholar] [CrossRef] [Green Version]
  62. Girlich, D.; Bonnin, R.A.; Naas, T. Occurrence and Diversity of CTX-M-Producing Escherichia coli From the Seine River. Front. Microbiol. 2020, 11, 603578. [Google Scholar] [CrossRef]
  63. Chee-Sanford, J.C.; Aminov, R.I.; Garrigues-Jeanjean, N.; Mackie, R.I. Occurrence and Diversity of Tetracycline Resistance Genes in Lagoons and Groundwater Underlying Two Swine Production Facilities. Appl. Environ. Microbiol. 2001, 67, 1494–1502. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Kyselková, M.; Jirout, J.; Vrchotová, N.; Schmitt, H.; Elhottová, D. Spread of Tetracycline Resistance Genes at a Conventional Dairy Farm. Front. Microbiol. 2015, 6, 536. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  65. Oliveira de Araujo, G.; Huff, R.; Favarini, M.O.; Mann, M.B.; Peters, F.B.; Frazzon, J.; Guedes Frazzon, A.P. Multidrug Resistance in Enterococci Isolated from Wild Pampas Foxes (Lycalopex gymnocercus) and Geoffroy’s Cats (Leopardus geoffroyi) in the Brazilian Pampa Biome. Front. Vet. Sci. 2020, 7, 606377. [Google Scholar] [CrossRef] [PubMed]
  66. Gevers, D.; Danielsen, M.; Huys, G.; Swings, J. Molecular characterization of tet(M) genes in Lactobacillus isolates from different types of fermented dry sausage. Appl. Environ. Microbiol. 2003, 69, 1270–1275. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Pang, Y.; Bosch, T.; Roberts, M.C. Single polymerase chain reaction for the detection of tetracycline-resistant determinants Tet K and Tet L. Mol. Cell. Probes 1994, 8, 417–422. [Google Scholar] [CrossRef] [PubMed]
  68. Nawaz, M.; Wang, J.; Zhou, A.; Ma, C.; Wu, X.; Moore, J.E.; Millar, B.C.; Xu, J. Characterization and transfer of antibiotic resistance in lactic acid bacteria from fermented food products. Curr. Microbiol. 2011, 62, 1081–1090. [Google Scholar] [CrossRef]
  69. Gibreel, A.; Tracz, D.M.; Nonaka, L.; Ngo, T.M.; Connell, S.R.; Taylor, D.E. Incidence of Antibiotic Resistance in Campylobacter jejuni Isolated in Alberta, Canada, from 1999 to 2002, with Special Reference to tet(O)-Mediated Tetracycline Resistance. Antimicrob. Agents Chemother. 2004, 48, 3442–3450. [Google Scholar] [CrossRef] [Green Version]
  70. Trzciński, K.; Cooper, B.S.; Hryniewicz, W.; Dowson, C.G. Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J. Antimicrob. Chemother. 2000, 45, 763–770. [Google Scholar] [CrossRef] [Green Version]
  71. CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 4th ed.; Approved Standard. CLSI Document VET01-A4; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2013. [Google Scholar]
  72. CLSI. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 4th ed.; CLSI Supplement VET08; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
  73. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Green Version]
  74. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
  75. Tamura, K.; Nei, M.; Kumar, S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA 2004, 101, 11030–11035. [Google Scholar] [CrossRef] [Green Version]
  76. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  77. Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The phylogenetic tree based on a comparison of sequences (933 nucleotides) of the tetW gene of 15 Trueperella pyogenes isolates from this study (2/B, 26/B, 3/Z, 8/Z, 10/Z, 14/Z, 2/S, 8/S, 10/S, 11/S, 12/S, 14/S, 16/S, 17/S, 49/S) and the tetW sequences of selected bacterial species retrieved from the GenBank database (accession numbers in parentheses). The tree was constructed by the neighbor-joining method. Bootstrap values (1000 replicates) of above 70% are shown. The scale bar represents the number of substitutions per site.
Figure 1. The phylogenetic tree based on a comparison of sequences (933 nucleotides) of the tetW gene of 15 Trueperella pyogenes isolates from this study (2/B, 26/B, 3/Z, 8/Z, 10/Z, 14/Z, 2/S, 8/S, 10/S, 11/S, 12/S, 14/S, 16/S, 17/S, 49/S) and the tetW sequences of selected bacterial species retrieved from the GenBank database (accession numbers in parentheses). The tree was constructed by the neighbor-joining method. Bootstrap values (1000 replicates) of above 70% are shown. The scale bar represents the number of substitutions per site.
Antibiotics 10 00380 g001
Table 1. Distribution of minimum inhibitory concentration (MIC) of tetracycline, MIC50 and MIC90 values for the studied Trueperella pyogenes isolates (n = 114).
Table 1. Distribution of minimum inhibitory concentration (MIC) of tetracycline, MIC50 and MIC90 values for the studied Trueperella pyogenes isolates (n = 114).
Isolate OriginNumber of Isolates with the Indicated MIC (µg/mL)aMIC50MIC90
≤ 0.1250.250.51248163264≥128
Cattle112 4921 3232
Swine1311111621 48
Goat4521 1 0.251
Sheep5 1 ≤0.125≤0.125
European bison1194 1 14 0.2532
Total2218102211111226 432
a MIC breakpoint for tetracycline used in this study: ≥ 8 µg/mL. Resistant isolates are shaded.
Table 2. Occurrence of the tetW and tetA(33) genes, tetW-3 linked to ATE-1 transposon, and the tetracycline MIC values for the tetracycline-resistant Trueperella pyogenes isolates (n = 49). The presence of tetW was tested using two different primer sets.
Table 2. Occurrence of the tetW and tetA(33) genes, tetW-3 linked to ATE-1 transposon, and the tetracycline MIC values for the tetracycline-resistant Trueperella pyogenes isolates (n = 49). The presence of tetW was tested using two different primer sets.
Isolate DesignationIsolate OriginGeneatetW-3 Linked to ATE-1 eMIC (µg/mL)
TetbtetWctetWdtetA(33)
2/BBovine+++++32
4/BBovine+++++32
5/BBovine+++-+32
6/BBovine+++-+16
7/BBovine+++++32
8/BBovine+++-+32
9/BBovine+++-+16
10/BBovine+++-+32
11/BBovine+++-+16
12/BBovine+++-+32
14/BBovine+++-+16
15/BBovine---+-8
16/BBovine-----8
18/BBovine+++-+32
19/BBovine+++-+32
20/BBovine+++-+32
21/BBovine+++++32
22/BBovine+++-+32
23/BBovine+++++32
24/BBovine+++-+32
25/BBovine+++-+32
26/BBovine+++++16
27/BBovine+++-+32
28/BBovine+++-+32
29/BBovine+++-+16
30/BBovine+++-+16
31/BBovine+++-+16
32/BBovine+++++32
33/BBovine+++++32
34/BBovine+++-+8
35/BBovine+++-+32
36/BBovine+++-+16
37/BBovine+++-+8
38/BBovine+++-+32
2/SSwine+-+--16
8/SSwine+++-+32
10/SSwine+-+--8
11/SSwine+-+--8
12/SSwine+-+--8
14/SSwine+-+--8
16/SSwine+-+--16
17/SSwine+-+--8
49/SSwine+-+--8
3/ZEuropean bison+++-+32
7/ZEuropean bison+++-+32
8/ZEuropean bison+++-+16
10/ZEuropean bison+++-+32
14/ZEuropean bison+++-+32
6/KCaprine---+-8
a +: presence of a gene; -: absence of a gene; b gene detected using universal primers detecting tetracycline resistance genes encoding ribosome protection proteins; c gene detected using primers designed by Billington and Jost [37]; d gene detected using new primers designated in this study; e presence of 522 bp fragment indicating the presence of tetW-3 linked to ATE-1 transposon.
Table 3. Primers and PCR conditions used in this study.
Table 3. Primers and PCR conditions used in this study.
Primer DesignationPrimer Sequence (5’–3’)Target GeneAnnealing Temperature (°C)Amplicon Size (bp)Reference
plo_F
plo_R
TCATCAACAATCCCACGAAGAG
TTGCCTCCAGTTGACGCTTT
plo60 b150[27]
DI_F
DII_R
GAYACICCIGGICAYRTIGAYTT
GCCCARWAIGGRTTIGGIGGIACYTC
teta53 b1100[66]
TKI_F
TL32_R
CCTGTTCCCTCTGATAAA
CAAACTGGGTGAACACAG
tetK/
tetL
50 b1050[67]
tetW_F
tetW_R
GACAACGAGAACGGACACTATG
CGCAATAGCCAGCAATGAACGC
tetW58 b1843[37]
tetM_F
tetM_R
TTAAATAGTGTTCTTGGAG
CTAAGATATGGCTCTAACAA
tetM54 c656[68]
tetA(33)_F
tetA(33)_R
GATGCCGATTCTTCCCGCACTGC
CCACGCATGATGAGAATCACGC
tetA(33)58 b1089[36]
tetO_F
tetO_R
GGCGTTTTGTTTATGTGCG
ATGGACAACCCGACAGAAGC
tetO50 c559[69]
tetK_F
tetK_R
TATTTGGCTTTGTATTCTTTCAT
GCTATACCTGTTCCCTCTGATAA
tetK50 b1159[70]
tetL_F
tetL_R
ATAAATTGTTTCGGGTCGGAAT
AACCAGCCAACTAATGACAATGAT
tetL50 b1077[70]
ATE-1_F
ATE-1_R
TGCCTGGCAGCGTCCGTCCGTG
AGGGCCAAGACCGCCGAGTTCC
tetW-3–orf11055 c522[37]
tetW-all_F
tetW-all_R
GTCTGTTCGGGATAAGCTCT
TGGAATACGCATCTCTGTGA
tetW54 c466This study
a Universal primers detecting the tetracycline resistance genes encoding ribosome protection proteins; b PCR conditions: initial denaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 1 min, annealing for 1 min at variable temperatures and extension at 72 °C for 2 min; a final extension at 72 °C for 5 min; c PCR conditions: initial denaturation at 95 °C for 3 min; 30 cycles of denaturation at 95 °C for 45 sec, annealing for 45 sec at variable temperatures and extension at 72 °C for 1 min; a final extension at 72 °C for 2 min.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Kwiecień, E.; Stefańska, I.; Chrobak-Chmiel, D.; Kizerwetter-Świda, M.; Moroz, A.; Olech, W.; Spinu, M.; Binek, M.; Rzewuska, M. Trueperella pyogenes Isolates from Livestock and European Bison (Bison bonasus) as a Reservoir of Tetracycline Resistance Determinants. Antibiotics 2021, 10, 380. https://doi.org/10.3390/antibiotics10040380

AMA Style

Kwiecień E, Stefańska I, Chrobak-Chmiel D, Kizerwetter-Świda M, Moroz A, Olech W, Spinu M, Binek M, Rzewuska M. Trueperella pyogenes Isolates from Livestock and European Bison (Bison bonasus) as a Reservoir of Tetracycline Resistance Determinants. Antibiotics. 2021; 10(4):380. https://doi.org/10.3390/antibiotics10040380

Chicago/Turabian Style

Kwiecień, Ewelina, Ilona Stefańska, Dorota Chrobak-Chmiel, Magdalena Kizerwetter-Świda, Agata Moroz, Wanda Olech, Marina Spinu, Marian Binek, and Magdalena Rzewuska. 2021. "Trueperella pyogenes Isolates from Livestock and European Bison (Bison bonasus) as a Reservoir of Tetracycline Resistance Determinants" Antibiotics 10, no. 4: 380. https://doi.org/10.3390/antibiotics10040380

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop