Next Article in Journal
Artificial Intelligence for Antimicrobial Resistance Prediction: Challenges and Opportunities towards Practical Implementation
Next Article in Special Issue
Antimicrobial Resistance Patterns of Enterobacter cloacae and Klebsiella aerogenes Strains Isolated from Clinical Specimens: A Twenty-Year Surveillance Study
Previous Article in Journal
Implementation Strategies for Preventing Healthcare-Associated Infections across the Surgical Pathway: An Italian Multisociety Document
Previous Article in Special Issue
Fluoroquinolones Are Useful as Directed Treatment for Complicated UTI in a Setting with a High Prevalence of Quinolone-Resistant Microorganisms
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 12
Issue 3
10.3390/antibiotics12030522
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Genotypic and Phenotypic Characteristics Contributing to Flomoxef Sensitivity in Clinical Isolates of ESBL-Producing E. coli Strains from Urinary Tract Infections

by
Kazuma Sakaeda
1,
Takuya Sadahira
1,*,
Yuki Maruyama
1,
Takehiro Iwata
1,
Masami Watanabe
1,
Koichiro Wada
2 and
Motoo Araki
1
1
Department of Urology, Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama University, 2-5-1, Shikata-cho, Kita-ku, Okayama 700-8558, Japan
2
Koichiro Wada Department of Urology, School of Medicine, Shimane University, 89-1, Enya-cho, Izumo 693-8501, Japan
*
Author to whom correspondence should be addressed.
Antibiotics 2023, 12(3), 522; https://doi.org/10.3390/antibiotics12030522
Submission received: 16 February 2023 / Revised: 1 March 2023 / Accepted: 2 March 2023 / Published: 6 March 2023
(This article belongs to the Special Issue The Interplay between Urinary Tract Infections and Antimicrobial Resistance)
Browse Figures
Versions Notes

Abstract

:
We carried out a molecular biological analysis of extended-spectrum β-lactamase (ESBL)-producing E. coli strains and their sensitivity to flomoxef (FMOX). Sequence type (ST) analysis by multilocus sequence typing (MLST) and classification of ESBL genotypes by multiplex PCR were performed on ESBL-producing E. coli strains isolated from urine samples collected from patients treated at our institution between 2008 and 2018. These sequences were compared with results for antimicrobial drug susceptibility determined using a micro-liquid dilution method. We also analyzed cases treated with FMOX at our institution to examine its clinical efficacy. Of the 911 E. coli strains identified, 158 (17.3%) were ESBL-producing. Of these, 67.7% (107/158) were strain ST-131 in ST analysis. Nearly all (154/158; 97.5%) were CTX-M genotypes, with M-14 and M-27 predominating. The isolated strains were sensitive to FMOX in drug susceptibility tests. Among the patient samples, 33 cases received FMOX, and of these, 5 had ESBL-producing E. coli. Among these five cases, three received FMOX for surgical prophylaxis as urinary carriers of ESBL-producing E. coli, and postoperative infections were prevented in all three patients. The other two patients received FMOX treatment for urinary tract infections. FMOX treatment was successful for one, and the other was switched to carbapenem. Our results suggest that FMOX has efficacy for perioperative prophylactic administration in urologic surgery involving carriers of ESBL-producing bacteria and for therapeutic administration for urinary tract infections. Use of FMOX avoids over-reliance on carbapenems or β-lactamase inhibitors and thus is an effective antimicrobial countermeasure.

1. Introduction

Escherichia coli (E. coli) is the most frequently detected pathogen in urinary tract infections (UTIs), accounting for 50% to 85% of cases [1,2]. Furthermore, the frequency of bacteria producing extended-spectrum β-lactamase (ESBL) has recently been increasing worldwide, including in Japan, and antibiotic resistance is becoming a larger problem [3,4]. The abuse of broad-spectrum antibiotics is one of the major causes of the development of antimicrobial-resistant bacteria. The problem of antimicrobial resistance has become a public threat. The frequency of occurrence of UTIs caused by ESBL-producing Enterobacterales has been increasing globally. Among ESBL-producing Enterobacterales, ESBL-producing E. coli is considered the greatest concern [4].
ESBL-producing bacteria are drug-resistant organisms that carry genetic mutations in the enzyme that degrades β-lactams by hydrolyzing them into cephalosporins and monobactams. The ESBL gene is encoded on a transmissible plasmid and is widely transmitted horizontally to mycobacteria of different Enterobacterales, leading to the spread of community-acquired and nosocomial infections. The genotypes of ESBL-producing bacteria include TEM, SHV, and CTX-M. In particular, the CTX-M type is spreading worldwide, and a pandemic was declared in 2006 [5,6]. There are more than 160 CTX-M ESBL subtypes that can be classified into subgroups, including the CTX-M-1 group, CTX-M-2 group, and CTX-M-9 group [7]. The distribution of these subtypes varies regionally and temporally. Sequence type 131 (ST131) is the predominant sequence type and is highly pathogenic and multidrug-resistant [8,9]. The presence of CTX-M-15, a common type of ESBL, was responsible for the global outbreak of ESBL-producing E. coli, and this type often belongs to ST131. It accounts for 8% of urinary non-ESBL-producing isolates in patients in a single institution in the United States [10]. The epidemic clones of E. coli ST131 carry a high number of virulence and resistance genes. Not only resistance to routine antibiotics was reported in E. coli ST131, but also resistance to carbapenem was a matter of great concern in this strain. For effective treatment of infections involving ESBL-producing organisms, it is important to properly identify the genotype and use appropriate antimicrobial agents that can preserve carbapenems as an AMR countermeasure [11].
Flomoxef (FMOX) is a broad-spectrum antibiotic with oxygen substituted for sulfur and the 7-α-methoxy group in the cephalosporin core that was introduced to the medical field in the 1980s [12]. The in vitro and clinical efficacy of flomoxef have been proven satisfactory in the treatment of infections caused by both Gram-positive and Gram-negative bacteria with minimal side effects [13,14]. The use of FMOX in empiric and definitive therapy has been previously evaluated and proven to be effective for ESBL-producing E. coli [15]. Preclinical studies have reported that FMOX susceptibility among ESBL-producing E. coli was comparable to imipenem (IPM) and meropenem (MEPM) [16,17]. Clinical studies conducted in patients with UTIs caused by ESBL-producing E. coli showed comparable susceptibility between FMOX and IPM [18,19]. Therefore, FMOX has attracted substantial attention as a promising agent for the treatment of ESBL-producing E. coli infections as an alternative to broad-spectrum antibiotics, such as carbapenem. In 2021, the study of the in vitro efficacy of FMOX against ESBL-producing E. coli associated with UTIs in Malaysia was reported [20]. In this study, carbapenem remained the most effective antibiotic against ESBL-producing E. coli associated with UTIs, followed by FMOX [20]. However, the in vitro activity of FMOX on ESBL-producing E. coli with respect to genotypic and phenotypic characteristics has not been investigated. The current literature showed that FMOX would be a potential alternative to broad-spectrum antimicrobial agents for the treatment of UTIs caused by ESBL-producing E. coli. Here, we carried out a molecular biological analysis to investigate ESBL-producing E. coli strains and the use of FMOX, which has good sensitivity in terms of its minimum inhibitory concentration (MIC).

2. Results

2.1. E. coli Isolates and Antibiotic Sensitivity

Among the urine samples collected between 2008 and 2018, 911 E. coli strains were isolated from urine, of which 158 (17.3%) were ESBL-producing (Figure 1). Of these, nearly three-quarters (116/158; 73%) were from outpatients, and the remainder (42/158; 27%) were from inpatients. All 158 ESBL-producing E. coli strains were resistant to CEZ, all but one to CFDN, and all but two to CFPM (Table 1). On the other hand, all strains were susceptible to IPM and MEPM, all but one to FOM, all but two to FMOX, all but four to CMZ, and all but ten to PIPC/TAZ. Other strains that showed sensitivity to each drug were 133 (84.2%) for GM, 79 (50%) for CAZ, 66 (41.8%) for ST, and 25 (15.8%) for LVFX.

2.2. Multilocus Sequence Typing and β-Lactamase Gene PCR

Results of MLST analysis of the 158 ESBL-producing E.coli strains are shown in Figure 2. ST131 was the most commonly identified strain, with 107 out of 158 (67.7%), and the frequency increased over time. The next most common was ST38 with eight strains (5.1%), and the other strains each had fewer than eight within the panel.
Antimicrobial susceptibility to ST131 and non-ST131 E. coli was shown (Figure 3). For CEZ, 100% (107/107) of ST131 strains were not susceptible, and 100% (51/51) of non-ST131 strains were not susceptible (p = 1.000). For CFDN, 100% (107/107) of ST131 strains were not susceptible, and 98% (50/51) of non-ST131 strains were not susceptible (p = 0.323). For FMOX, 93% (1/107) of ST131 strains were not susceptible, and 1.9% (50/51) of non-ST131 strains were not susceptible (p = 0.543). For PIPC/TAZ, 2.8% (3/107) of ST131 strains were not susceptible, and 9.8% (5/51) of non-ST131 strains were not susceptible (p = 0.113). For LVFX, 94% (101/107) of ST131 strains were not susceptible, and 63% (32/51) of non-ST131 strains were not susceptible (p < 0.001). For IPM and MEPM, 0% (0/107) of ST131 strains were not susceptible, and 0% (0/51) of non-ST131 strains were not susceptible (p = 1.00). For CMZ, 1.9% (2/107) of ST131 strains were not susceptible, and 3.9% (2/51) of non-ST131 strains were not susceptible (p = 0.595). For CAZ, 59% (63/107) of ST131 strains were not susceptible, and 31% (16/51) of non-ST131 strains were not susceptible (p = 0.002). For CFPM, 100% (107/107) of ST131 strains were not susceptible, and 96% (49/51) of non-ST131 strains were not susceptible (p = 0.103). For FOM, 0% (0/107) of ST131 strains were not susceptible, and 3.9% (2/51) of non-ST131 strains were not susceptible (p = 0.103). For GM, 7.5% (8/107) of ST131 strains were not susceptible, and 31% (16/51) of non-ST131 strains were not susceptible (p < 0.001). For ST, 57% (61/107) of ST131 strains were not susceptible, and 61% (31/51) of non-ST131 strains were not susceptible (p = 0.731).
In genotyping using multiplex PCR (Figure 4), the CTX-M type was the most common genotype, accounting for 154 of 158 isolates (97.5%), followed by the TEM type with 52 of 158 (32.9%). However, only 2 of 158 isolates (1.3%) were SHV-type.
The classification of the CTX-M type is shown in Figure 5. For the classification of the CTX-M type, the CTX-M-9 group members CTX-M-14 type and CTX-M-27 type predominated among the study samples. The CTX-M-14 type was predominant in 54 of 154 (35.1%) strains, and the CTX-M-27 type was seen in 72 of 154 (46.8%) strains. The CTX-M-14 type predominated through 2013, while the CTX-M-27 type predominated in 2014. The next most common type was CTX-M-15, which belongs to the CTX-M-1 group, with 12 of 154 (7.8%).
Antimicrobial susceptibility to CTX-M types in E. coli was shown (Figure 6). For CEZ, 100% (54/54) of CTX-M-14 strains were not susceptible, 100% (72/72) of CTX-M-27 strains were not susceptible, 100% (12/12) of CTX-M-15 strains were not susceptible, and 100% (16/16) of other strains were not susceptible. For CFDN, 100% (54/54) of CTX-M-14 strains were not susceptible, 100% (72/72) of CTX-M-27 strains were not susceptible, 100% (12/12) of CTX-M-15 strains were not susceptible, and 100% (16/16) of other strains were not susceptible. For FMOX, 0% (0/54) of CTX-M-14 strains were not susceptible, 0% (0/72) of CTX-M-27 strains were not susceptible, 8.3% (1/12) of CTX-M-15 strains were not susceptible, and 100% (6.3/16) of other strains were not susceptible. For PIPC/TAZ, 3.7% (2/54) of CTX-M-14 strains were not susceptible, 0% (0/72) of CTX-M-27 strains were not susceptible, 17% (2/12) of CTX-M-15 strains were not susceptible, and 25% (4/16) of other strains were not susceptible. For IPM and MEPM, 3.7% (2/54) of CTX-M-14 strains were not susceptible, 0% (0/72) of CTX-M-27 strains were not susceptible, 17% (2/12) of CTX-M-15 strains were not susceptible, and 25% (4/16) of other strains were not susceptible. For LVFX, 78% (42/54) of CTX-M-14 strains were not susceptible, 94% (68/72) of CTX-M-27 strains were not susceptible, 92% (11/12) of CTX-M-15 strains were not susceptible, and 69% (11/16) of other strains were not susceptible. For CMZ, 0% (0/54) of CTX-M-14 strains were not susceptible, 0% (0/72) of CTX-M-27 strains were not susceptible, 8.3% (1/12) of CTX-M-15 strains were not susceptible, and 19% (3/16) of other strains were not susceptible. For CAZ, 7.4% (4/54) of CTX-M-14 strains were not susceptible, 72% (52/72) of CTX-M-27 strains were not susceptible, 100% (12/12) of CTX-M-15 strains were not susceptible, and 69% (11/16) of other strains were not susceptible. For CFPM, 100% (54/54) of CTX-M-14 strains were not susceptible, 100% (72/72) of CTX-M-27 strains were not susceptible, 100% (12/12) of CTX-M-15 strains were not susceptible, and 100% (16/16) of other strains were not susceptible. For FOM, 0% (0/54) of CTX-M-14 strains were not susceptible, 0% (0/72) of CTX-M-27 strains were not susceptible, 0% (0/12) of CTX-M-15 strains were not susceptible, and 6.3% (1/16) of other strains were not susceptible. For GM, 20% (11/54) of CTX-M-14 strains were not susceptible, 1.4% (1/72) of CTX-M-27 strains were not susceptible, 67% (8/12) of CTX-M-15 strains were not susceptible, and 25% (4/16) of other strains were not susceptible. For ST, 65% (35/54) of CTX-M-14 strains were not susceptible, 56% (40/72) of CTX-M-27 strains were not susceptible, 50% (6/12) of CTX-M-15 strains were not susceptible, and 69% (11/16) of other strains were not susceptible.
Two ESBL-producing E. coli strains that were resistant to FMOX are described in Table 2. The first strain had a ST131 sequence type and genotype of CTX-M-2 and was susceptible to PIPC/TAZ, IPM, MEPM, FOM, and GM. The other strain was a ST354 sequence type, had CTX-M-15 and CMY161 genotypes, and was susceptible to IPM, MEPM, and FOM. As mentioned above, the two FMOX-resistant strains had no correlation between ST analysis and genotype. As can be seen from the MIC, both strains were also resistant to CMZ. Furthermore, FMOX had greater efficacy than CMZ based on MIC50 and MIC90 values (Table 1).

2.3. The Clinical Efficacy of FMOX

The breakdown of cases treated with FMOX in our study is shown in Figure 7. Among the 33 cases that received FMOX at our institution (Figure 7), 14 were for prophylactic administration prior to surgery and 19 were for therapeutic administration for UTI. Of the 14 cases with prophylactic administration, 3 were switched to other agents due to postoperative infection, and of the 19 cases that received therapeutic administration, 6 were switched due to inadequate efficacy.
Of the 33 cases treated with FMOX at our institution (Table 3), 16 had E. coli, three had Proteus mirabilis, and one each had Klebsiella oxytoca, Citrobacter koseri, Pseudomonas aeruginosa, and MRSA. Two had other Gram-negative rods, two had Enterococcus spp, one had Gram-positive cocci, and three were culture-negative. There were a total of eight ESBL-producing bacteria identified: five E. coli and one each of Klebsiella oxytoca, Proteus mirabilis, and Citrobacter koseri (Table 4). For the five cases with E. coli, three received FMOX for surgical prophylaxis against urinary ESBL-producing E. coli, and all treatments successfully prevented postoperative infections. On the other hand, two patients received FMOX to treat UTIs: one patient had an effective response, and the other had an inadequate response and was switched to carbapenems.

3. Materials and Methods

3.1. ESBL-Producing E. coli

E. coli isolated from the urine of patients with UTI who were treated at the outpatient clinic or in a ward of Okayama University Hospital, Okayama, Japan, between January 2008 and December 2018 were included in our study. Pyuria was diagnosed as the presence of white blood cells (WBC) ≥5/HPF in a urine sediment specimen, and bacteriuria was diagnosed as a bacterial count ≥103 CFU/mL in catheter urine or 104 CFU/mL in midstream urine. Isolates were counted as one infection episode per patient, and plural isolates were counted in polymicrobial infections.
ESBL production of E. coli was confirmed using the disc method carried out according to Clinical and Laboratory Standards Institute (CLSI) document M100-S22 [21] with 30 μg/mL CTX. A total of 30 ESBL-producing E. coli strains were identified when the inhibition circle had a diameter larger than 5 mm using 30 μg/mL CTX, 30 μg/mL CTX plus 10 μg/mL CVA, 30 μg/mL CAZ, or 30 μg/mL CAZ plus 10 μg/mL CVA.
Sequence type analysis by multilocus sequence typing (MLST) and classification of ESBL genotypes by Multiplex PCR were performed on ESBL-producing E. coli strains. MLST is a molecular genetic method that involves the sequencing of seven housekeeping genes (adk, fumC, gyrB, icd, mdh, purA, and recA) to determine allele numbers that are then compared with information in enterobase (https://enterobase.warwick.ac.uk accessed on 1 March 2018). The sequencing type is determined by combining the seven types of genes (Table 5).
Classification of ESBL genotypes by Multiplex PCR was performed according to the used primers as described by Dallenne et al. [22]. Rapid DNA preparation was carried out by first placing one colony in 100 µL distilled water and heating at 95 °C. Total DNA (2 µL) was subjected to multiplex PCR in a 50 µL reaction mixture containing 1× PCR buffer (10 mM Tris-HCl, pH 8.3/50 mM KCl/1.5 mM MgCl2), 200 mM of each deoxynucleotide triphosphate, a variable concentration of group-specific primers (Table 6), and 1 U Taq polymerase (Sigma Aldrich, St Quentin Fallavier, France). DNA was amplified with initial denaturation at 94 °C for 10 min followed by 30 cycles of 94 °C for 40 s, 60 °C for 40 s and 72 °C for 1 min, and a final 7-min elongation step at 72 °C. A 55 °C annealing temperature was used to amplify the blaVIM, blaIMP, and blaKPC genes, and 57 °C was used to amplify the blaGES and blaOXA-48 genes. Amplicons were visualized on a 2% agarose gel containing ethidium bromide run at 100 V for 1 h. A 100-bp DNA ladder (New England Biolabs, Ipswich, MA, USA) was used as a size marker. To identify the β-lactamase genes detected in the multiplex PCR assays, DNA sequence analyses of the amplicons were performed. Amplified PCR products were purified using the ExoSap purification kit (ExoSap-it, GE Healthcare, Piscataway, NJ, USA), and bidirectional sequencing was performed. Each sequence is aligned by multiple-sequence alignment using the BLAST program.
The minimum inhibitory concentrations (MIC) of various antimicrobials were analyzed using micro-liquid dilution and agar dilution methods, and drug susceptibility was measured. Antimicrobial agents for which MICs were measured were cefazolin (CEZ), cefdinir (CFDN), flomoxef (FMOX), cefmetazole (CMZ), ceftazidime (CAZ), cefepime (CFPM), piperacillin/tazobactam (PIPC/TAZ), imipenem (IPM), faropenem (FRPM), meropenem (MEPM), levofloxacin (LVFX), sitafloxacin (STFX), fosfomycin (FOM), gentamicin (GM), sulfamethoxazole/trimethoprim (ST).

3.2. Flomoxef Efficacy

To investigate the efficacy of flomoxef (FMOX) against ESBL-producing E. coli, samples from 33 patients with UTI who were treated with FMOX at our institution between 2008 and 2018 were collected. The rationale for the choice of FMOX, urinary isolates, drug sensitivity, administration method, and outcome were retrospectively reviewed from patient charts to determine the clinical positioning of FMOX.

3.3. Statistical Analyses

Statistical analyses were performed using EZR software (version 1.71; Saitama Medical Center, Jichi Medical University, Saitama, Japan) [23]. The antimicrobial susceptibilities among the strains were compared with Fisher’s exact test. Results with p values < 0.05 were considered statistically significant.

4. Discussion

In our study, the susceptibility of ESBL-producing E. coli to FMOX was comparable to that seen for MEPM and TAZ/PIPC. Among the E. coli strains, ST131 was the most common sequence type (67.7%), and in our study population, the percentage increased annually. Consistent with previous reports, CTX-M was the most common genotype, and the frequency of CTX-M-27 increased over that of CTX-M-14 after 2013; CTX-M-15 appeared in 2012. The susceptibility rate of CTX-M-15 to FMOX, TAZ/PIPC, CMZ, CAZ, and GM was lower than that for other genotypes.
ESBL-producing E. coli were first reported by Knothe et al. in 1983 [24], and ESBL-producing E. coli were isolated in Japan by Ishii et al. in 1993 [25]. TEM and SHV types of ESBL-producing E. coli were prevalent in Europe and the United States in the 1980s, and CTX-M types spread worldwide beginning in 2000; a pandemic of these types was declared in 2006 [5]. Since 2010, CTX-M-27 and CTX-M-15 have been detected in Japan and abroad [26,27]. These phenotypes tend to be more resistant to drugs than CTX-M-14, which was the mainstay of AMR [28]. In our study, we also observed increased resistance rates to LVFX, CAZ, and GM by CTX-M-27 and CTX-M-15 compared to CTX-M-14, which is comparable to earlier findings. In addition, the frequencies of TEM and SHV were similar to those reported by Aihe et al. [29], but for TEM, the frequency was lower than that seen by Jena et al. [30]. There has been almost no genotype analysis of UTIs in Japan, and such studies would be useful for better understanding the prevalence of multidrug-resistant E. coli in the country. Moreover, since 2000, ST131 has become the predominant E. coli isolate worldwide [8], and our results were consistent with this trend. The ST131 group had a higher rate of insensitivity to LVFX and CAZ compared to non-ST131 strains (Figure 3). Among antimicrobial agents, fluoroquinolone resistance is increasing [31], and of the 158 isolates in this study, the majority (133/158; 84.2%) were resistant to LVFX. The most promising antimicrobial agents are carbapenems [32], and other antimicrobial agents, including TAZ/PIPC, CMZ, and FMOX, continue to have good activity [33,34]. FOM is reported to be effective in the US and Europe [35], and the new drug TAZ/CTLZ is also expected to be effective [36]. We observed a similar trend in our study. However, due to the risk of AMR, the use of carbapenems and TAZ/PIPC should be limited whenever possible, and CMZ and FMOX should be used with preference.
We also examined the clinical status of FMOX, and our findings suggest that FMOX has some efficacy for perioperative prophylactic administration in urologic surgery for carriers of ESBL-producing bacteria and for therapeutic administration for UTIs. FMOX is an oxacefem-derived antimicrobial agent that was first released in 1988 and is effective against Gram-negative rods, MSSA, and anaerobes, including E. coli. FMOX has also been reported to be effective against ESBL-producing bacteria [24] and ESBL-producing E. coli [34]. In addition, FMOX has efficacy against CTX-M-type ESBL-producing bacteria with urinary excretion [16,37] and for UTIs caused by ESBL-producing E. coli in children [18]. The MIC data for both IPN and MEPM look interesting and are as good as those for FMOX in the present study. In fact, in a clinical situation, a previous study showed that no significant differences were observed in the febrile period and recurrence rate between the FMOX-initiated group and the other antibiotic groups, suggesting that FMOX may be a useful alternative carbapenem antibiotic for UTIs caused by ESBL-producing E. coli [38]. The cause of the change in the percentage of ESBLs within the observation period is unknown, but the effect of changes in therapeutic agents is less likely, and no severe cases were observed in the current reports. We think that FMOX would be a suitable alternative for perioperative prophylactic administration because of its narrow-spectrum antimicrobial feature, therapeutic administration for UTIs caused by ESBL-producing bacteria of moderate or lower severity, and de-escalation from empiric therapy against ESBL-producing bacteria. This approach would allow for more limited use of carbapenem and combination β-lactamase inhibitors as part of AMR countermeasures.
Uropathogenic E. coli strains have a variety of flexible and adaptive genomic pools. These genomic pools are the arsenal of a wide range of virulence and drug resistance genes. Therefore, the armed uropathogenic E. coli pathotypes with a powerful virulome enable them to survive against the human body’s immune system and the deathly effects of antimicrobial agents. However, there is neither a regular pattern for drug resistance properties nor ESBL production in reported isolated pathotypes of Uropathogenic E. coli worldwide. For example, the presence or absence of mrk genes has no correlation with antimicrobial susceptibility in uropathogenic E. coli pathotypes [39]. On the other hand, the presence of hlyA and cnf1 virulence genes may lead to increased bacterial sensitivity to fluoroquinolones [40]. The gene profiles may be helpful for choosing the appropriate antibiotic for determined uropathogenic E. coli strains in the procedure for the treatment of UTIs. Further study is needed to determine the sensitivity of FOMX from the perspective of gene profiles.
The present study had some limitations. First, this study was done in a single hospital in Japan, and due to budget limitations, a multicenter study was not possible. Access to medical data of the patients, such as underlying patients characteristics, diseases, and recent medications, to correlate their links with colonization of E. coli strains and their antimicrobial resistance phenotypes was not possible, because of the lack of registry system. In addition, there was no follow-up program at the time of the study to understand differences in the success or complications of UTIs caused by E. coli identified in our hospital. Although our strain pools could not represent the entire ESBL-producing E. coli population in this region, both temporally and geographically, the data generated in the present study provided an insight into the extent of β-lactam resistance among ESBL producers associated with UTIs in Japan. Moreover, the susceptibility data obtained in this study support further consideration of the potential use of FMOX as an alternative option for the treatment of UTIs caused by ESBL-producing E. coli. Second, the major drawback of the present study was that the analyzed isolates were collected from 2008 to 2018 and did not reflect the current situation well. However, it is meaningful work to provide the basic molecular characteristics of a common causative pathogen for community-based UTIs. Further studies on changes in microbiological characteristics in Japan are necessary to clarify this issue.
Despite these limitations, our results showed ESBL-producing E. coli isolates with common rep-types presented diversity in their clone types and antibiotic-resistance patterns. Constant monitoring would be done to control their spread in the community because of the high prevalence of the strains and their involvement in UTIs.

5. Conclusions

The frequency of ESBL-producing E. coli is increasing annually, especially in outpatients. Although antimicrobial susceptibility has not significantly decreased, we have continued to observe E. coli strains like CTX-M-15 that have a multidrug-resistant genotype. Throughout the study period, favorable sensitivity to FMOX was observed, suggesting that FMOX continues to be a valid treatment option that can prevent AMR. We think that the continuous surveillance of ESBL-producing E. coli at both the institutional and national levels will preserve the clinical efficacy of broad-spectrum cephalosporin and prevent the emergence of carbapenem resistance in local E. coli strains.

Author Contributions

Conceptualization, K.S. and T.S.; methodology, K.S., M.W. and K.W.; validation, K.S., Y.M. and T.I.; formal analysis, K.S. and M.W.; investigation, T.S.; data curation, K.S. and T.S.; writing—original draft preparation, K.S.; writing—review and editing, T.S., Y.M., T.I., M.W. and K.W.; supervision, M.W. and M.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was approved by the Institutional Review Board of Okayama University Hospital (approved number 1803-028).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data sharing is not applicable to this study as no datasets were generated.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ramanath, K.V.; Shafiya, S.B. Prescription pattern of antibiotic usage for urinary tract infection treated in a rural tertiary care hospital. Indian J. Pharma. Pract. 2011, 4, 57–63. [Google Scholar]
  2. Jena, J.; Debata, N.K.; Subudhi, E. Prevalence of extended-spectrum-β-lactamase and metallo-β-lactamase producing multi drug rsistance gram negative bacteria from urinary isolates. Indian J. Med. Microbiol. 2013, 31, 420–421. [Google Scholar] [CrossRef] [PubMed]
  3. Wada, K.; Yokoyama, T.; Uno, S.; Araki, M.; Sadahira, T.; Maruyama, Y.; Acosta, H.; Nakajima, H.; Hiyama, Y.; Kunishima, Y.; et al. Nationwide surveillance of bacterial pathogens isolated from patients with acute uncomplicated cystitis in 2018: Conducted by the Japanese Research Group for Urinary Tract Infections (JRGU). J. Infect. Chemother. 2021, 27, 1169–1180. [Google Scholar] [CrossRef] [PubMed]
  4. Sadahira, T.; Wada, K.; Araki, M.; Ishii, A.; Takamoto, A.; Kobayashi, Y.; Watanabe, M.; Watanabe, T.; Nasu, Y.; Okayama Urological Research Group (OURG). Efficacy and safety of 3 day versus 7 day cefditoren pivoxil regimens for acute uncomplicated cystitis: Multicentre, randomized, open-label trial. J. Antimicrob. Chemother. 2017, 72, 529–534. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Canton, R.; Coque, T.M. The CTX-M beta-lactamase pandemic. Curr. Opin. Microbiol. 2006, 9, 466–475. [Google Scholar] [CrossRef] [PubMed]
  6. Bradford, P.A. Extended-spectrum beta-lactamases in the 21st century: Characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 2001, 14, 933–951. [Google Scholar] [CrossRef] [Green Version]
  7. D’Andrea, M.M.; Arena, F.; Pallecchi, L.; Rossolini, G.M. CTX-M-type β-lactamases: A successful story of antibiotic resistance. Int. J. Med. Microbiol. 2013, 303, 305–317. [Google Scholar] [CrossRef]
  8. Pitout, J.D.; Gregson, D.B.; Campbell, L.; Laupland, K.B. Molecular characteristics of extended-spectrum-beta-lactamase-producing Escherichia coli isolates causing bacteremia in the Calgary Health Region from 2000 to 2007: Emergence of clone ST131 as a cause of community-acquired infections. Antimicrob. Agents Chemother. 2009, 53, 2846–2851. [Google Scholar] [CrossRef] [Green Version]
  9. Nicolas-Chanoie, M.H.; Bertrand, X.; Madec, J.Y. Escherichia coli ST131, an intriguing clonal group. Clin. Microbial. Rev. 2014, 27, 543–574. [Google Scholar] [CrossRef] [Green Version]
  10. Blanc, V.; Leflon-Guibout, V.; Blanco, J.; Haenni, M.; Madec, J.Y.; Rafignon, G.; Bruno, P.; Mora, A.; Lopez, C.; Dahbi, G.; et al. Prevalence of day-care centre children (France) with fecal CTX-M-producing Escherichia coli comprising O25b:H4 and O16:H5 ST131 strains. J. Antimicrob. Chemother. 2014, 69, 1231–1237. [Google Scholar] [CrossRef]
  11. Bevan, E.R.; Jones, A.M.; Hawkey, P.M. Global epidemiology of CTX-M β-lactamases: Temporal and geographical shifts in genotype. J. Antimicrob. Chemother. 2017, 72, 2145–2155. [Google Scholar] [CrossRef] [Green Version]
  12. Kawamoto, I.; Miyauchi, M. β-Lactams and Other Antimicrobial Agents. In Antibiotics; Kawamoto, I., Ed.; CRC Press: Boca Raton, FL, USA, 1992. [Google Scholar]
  13. Sato, H.; Narita, A.; Suzuki, H.; Mastumoto, K.; Nakanishi, Y.; Nakazawa, S.; Niino, K.; Nakada, Y. The study of flomoxef in the pediatric field. Jpn. J. Antibiot. 1987, 40, 1349–1363. [Google Scholar]
  14. Yokoyama, T.; Kodama, T.; Takesue, Y.; Fujimoto, M.; Hiyama, E.; Ichikawa, T. Studies on antibacterial activity of flomoxef and its distribution to serum and intraperitoneal exudate in surgery. Jpn. J. Antibiot. 1987, 40, 1809–1819. [Google Scholar] [PubMed]
  15. Matsumura, Y.; Yamamoto, M.; Nagao, M.; Komori, T.; Fujita, N.; Hayashi, A.; Shimizu, T.; Watanabe, H.; Doi, S.; Tanaka, M.; et al. Multicenter retrospective study of cefmetazole and flomoxef for treatment of extended-spectrum-β-lactamase-producing Escherichia coli bacteremia. Antimicrob. Agents Chemother. 2015, 59, 5107–5113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Lee, C.-H.; Su, L.-H.; Tang, Y.-F.; Liu, J.-W. Treatment of ESBL-producing Klebsiella pneumoniae bacteraemia with carbapenems or flomoxef: A retrospective study and laboratory analysis of the isolates. J. Antimicrob. Chemother. 2006, 58, 1074–1077. [Google Scholar] [CrossRef] [Green Version]
  17. Yang, Q.; Zhang, H.; Cheng, J.; Xu, Z.; Xu, Y.-C.; Cao, B.; Kong, H.; Ni, Y.; Yu, Y.; Sun, Z.; et al. In vitro activity of flomoxef and comparators against Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis producing extended-spectrum β-lactamases in China. Int. J. Antimicrob. Agents. 2015, 45, 485–490. [Google Scholar] [CrossRef]
  18. Abe, Y.; Inan-Erdogan, I.; Fukuchi, K.; Wakabayashi, H.; Ogawa, Y.; Hibino, S.; Sakurai, S.; Matsuhashi, K.; Watanabe, Y.; Hashimoto, K.; et al. Efficacy of non-carbapenem antibiotics for pediatric patients with first febrile urinary tract infection due to extended-spectrum beta-lactamase-producing Escherichia coli. J. Infect. Chemother. 2017, 23, 517–522. [Google Scholar] [CrossRef] [PubMed]
  19. Horie, A.; Nariai, A.; Katou, F.; Abe, Y.; Saito, Y.; Koike, D.; Hirade, T.; Ito, T.; Wakuri, M.; Fukuma, A. Increased community-acquired upper urinary tract infections caused by extended-spectrum beta-lactamase-producing Escherichia coli in children and the efficacy of flomoxef and cefmetazole. Clin. Exp. Nephrol. 2019, 23, 1306–1314. [Google Scholar] [CrossRef] [Green Version]
  20. Ngoi, S.T.; The, C.S.J.; Chong, C.W.; Abdul Jabar, K.; Tan, S.C.; Yu, L.H.; Leong, K.C.; Tee, L.H.; AbuBakar, S. In Vitro Efficacy of Flomoxef against Extended-Spectrum Beta-Lactamase-Producing Escherichia coli and Klebsiella pneumoniae Associated with Urinary Tract Infections in Malaysia. Antibiotics 2021, 10, 181. [Google Scholar] [CrossRef]
  21. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; CLSI: Wayne, PA, USA, 2012. [Google Scholar]
  22. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J. Antimicrob. Chemother. 2010, 65, 490–495. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Kanda, Y. Investigation of the freely available easy-to-use software ‘EZR’ for medical statistics. Bone Marrow Transplant. 2013, 48, 452–458. [Google Scholar] [CrossRef] [Green Version]
  24. Knothe, H.; Shah, P.; Krcmery, V.; Antal, M.; Mitsuhashi, S. Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens. Infection 1983, 11, 315–317. [Google Scholar] [CrossRef]
  25. Ishii, Y.; Ohno, A.; Taguchi, H.; Imajo, S.; Ishiguro, M.; Matsuzawa, H. Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A beta-lactamase isolated from Escherichia coli. Antimicrob. Agents Chemother. 1995, 39, 2269–2275. [Google Scholar] [CrossRef] [Green Version]
  26. Chong, Y.; Yakushiji, H.; Ito, Y.; Kamimura, T. Clinical and molecular epidemiology of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in a long-term study from Japan. Eur. J. Clin. Microbiol. Infect. Dis. 2011, 30, 83–87. [Google Scholar] [CrossRef]
  27. Johnson, J.R.; Tchesnokova, V.; Johnston, B.; Clabots, C.; Roberts, P.L.; Billig, M.; Riddell, K.; Rogers, P.; Qin, X.; Butler-Wu, S.; et al. Abrupt emergence of a single dominant multidrug-resistant strain of Escherichia coli. J. Infect. Dis. 2013, 207, 919–928. [Google Scholar] [CrossRef]
  28. Demirci, M.; Unlu, O.; Tosun, A.I. Detection of O25b-ST131 clone, CTX-M-1 and CTX-M-15 genes via real-time PCR in Escherichia coli strains in patients with UTIs obtained from a university hospital in Istanbul. J. Infect. Public Health 2019, 12, 640–644. [Google Scholar] [CrossRef]
  29. Ismail, A.I.; Ali, S.S.; Altayeb, H.N.; Alla, A.A.; Moglad, E.H.; Elmissbah, T.E.; Elaskary, A.; Dahlawi, H. Detection of TEM, AmpC, SHV, CTX-M, and MCR-1 Genes in Gram Negative Isolates of Urinary Tract Infections. Clin. Lab. 2021, 67, 12. [Google Scholar] [CrossRef]
  30. Jena, J.; Sahoo, R.K.; Debata, N.K.; Subudhi, E. Prevalence of TEM, SHV, and CTX-M genes of extended-spectrum β-lactamase-producing Escherichia coli strains isolated from urinary tract infections in adults. 3 Biotech. 2017, 7, 244. [Google Scholar] [CrossRef]
  31. Sadahira, T.; Wada, K.; Araki, M.; Ishii, A.; Watanabe, T.; Nasu, Y.; Tsugawa, M.; Takenaka, T.; Nasu, Y.; Kumon, H. Impact of selective media for detecting fluoroquinolone-insusceptible/extended-spectrum beta-lactamase-producing Escherichia coli before transrectal prostate biopsy. Int. J. Urol. 2017, 24, 842–847. [Google Scholar] [CrossRef] [Green Version]
  32. Paterson, D.L.; Bonomo, R.A. Extended-spectrum beta-lactamases:a clinical update. Clin. Microbiol. Rev. 2005, 18, 657–686. [Google Scholar] [CrossRef] [Green Version]
  33. Nakagawa, S.; Hisada, H.; Nomura, N.; Mitsuyama, J.; Matsubara, S.; Yamaoka, K.; Watanabe, K.; Asano, Y.; Suematsu, H.; Sawamura, H.; et al. Antimicrobial activity of several drugs against extended-spectrum beta-lactamase positive Enterobacteriaceae isolates in Gifu and Aichi prefecture. Jpn. J. Antibiot. 2013, 66, 251–264. [Google Scholar]
  34. Hara, T.; Sato, T.; Horiyama, T.; Kanazawa, S.; Yamaguchi, T.; Maki, H. Prevalence and molecular characterization of CTX-M extended-spectrum β-lactamase-producing Escherichia coli from 2000 to 2010 in Japan. Jpn. J. Antibiot. 2015, 68, 75–84. [Google Scholar]
  35. Johnson, J.R.; Drawz, S.M.; Porter, S.; Kuskowski, M.A. Susceptibility to alternative oral antimicrobial agents in relation to sequence type ST131 status and Coresistance phenotype among recent Escherichia coli isolates from U.S. veterans. Antimicrob. Agents Chemother. 2013, 57, 4856–4860. [Google Scholar] [CrossRef] [Green Version]
  36. Popejoy, M.W.; Paterson, D.L.; Cloutier, D.; Huntington, J.A.; Miller, B.; Bliss, C.A.; Steenbergen, J.N.; Hershberger, E.; Umeh, O.; Kaye, K.S. Efficacy of ceftolozane/tazobactam against urinary tract and intra-abdominal infections caused by ESBL-producing Escherichia coli and Klebsiella pneumoniae: A pooled analysis of Phase 3 clinical trials. J. Antimicrob. Chemother. 2017, 72, 268–272. [Google Scholar] [CrossRef] [Green Version]
  37. Yang, C.C.; Li, S.H.; Chuang, F.R.; Chen, C.H.; Lee, C.H.; Chen, J.B.; Wu, C.H.; Lee, C.T. Discrepancy between effects of carbapenems and flomoxef in treating nosocomial hemodialysis access-related bacteremia secondary to extended spectrum beta-lactamase producing Klebsiella pneumoniae in patients on maintenance hemodialysis. BMC Infect Dis. 2012, 12, 206. [Google Scholar] [CrossRef] [Green Version]
  38. Tsujimoto, M.; Yokoyama, H.; Shimizu, K.; Yoneda, N.; Sano, H.; Ueyama, J.; Namba, N.; Tsuji, Y. Cases of Pediatric Pyelonephritis: A Single-Center Retrospective Study from an Extended-Spectrum β-Lactamase-Producing Escherichia coli Endemic Area in Japan. Yonago Acta Med. 2023, 66, 104–111. [Google Scholar] [CrossRef]
  39. Khonsari, M.; Behzadi, P.; Foroohi, F. The prevalence of type 3 fimbriae in Uropathogenic Escherichia coli isolated from clinical urine samples. Meta Gene 2021, 28, 100881. [Google Scholar] [CrossRef]
  40. Hozzari, A.; Behzadi, P.; Khiabani, K.P.; Sholeh, M.; Sabokroo, N. Clinical cases, drug resistance, and virulence genes profiling in Uropathogenic Escherichia coli. J. Appl. Genet. 2020, 61, 265–273. [Google Scholar] [CrossRef]
Antibiotics 12 00522 g001 550
Figure 1. Trends of E. coli isolated in urine from urinary tract infections. Among the urine samples collected between 2008 and 2018, E. coli strains were isolated from urine, of which 17.3% were ESBL-producing strains. Of these, nearly 73% were from outpatients, and the remainder, 27%, were from inpatients.
Figure 1. Trends of E. coli isolated in urine from urinary tract infections. Among the urine samples collected between 2008 and 2018, E. coli strains were isolated from urine, of which 17.3% were ESBL-producing strains. Of these, nearly 73% were from outpatients, and the remainder, 27%, were from inpatients.
Antibiotics 12 00522 g001
Antibiotics 12 00522 g002 550
Figure 2. MLST analysis of ESBL-producing E. coli strains. ST131 was the most commonly identified strain with 67.7%, and the frequency increased over time. The next most common was ST38, with 5.1%.
Figure 2. MLST analysis of ESBL-producing E. coli strains. ST131 was the most commonly identified strain with 67.7%, and the frequency increased over time. The next most common was ST38, with 5.1%.
Antibiotics 12 00522 g002
Antibiotics 12 00522 g003 550
Figure 3. Antimicrobial susceptibility to ST131 and non-ST131 E. coli. Among ST131 and non-ST131 ESBL-producing E. coli, there were no differences in susceptibility rates to CEZ, CFDN, FMOX, PIPC/TAZ, IPM, MEPM, CMZ, CFPM, FOM, and ST. While there were significant differences in susceptibility rates for LVFX, CAZ, and GM.
Figure 3. Antimicrobial susceptibility to ST131 and non-ST131 E. coli. Among ST131 and non-ST131 ESBL-producing E. coli, there were no differences in susceptibility rates to CEZ, CFDN, FMOX, PIPC/TAZ, IPM, MEPM, CMZ, CFPM, FOM, and ST. While there were significant differences in susceptibility rates for LVFX, CAZ, and GM.
Antibiotics 12 00522 g003
Antibiotics 12 00522 g004 550
Figure 4. Genotype. In genotyping using multiplex PCR, the CTX-M type was the most common genotype, accounting for 97.5%, followed by the TEM type with 32.9%. However, only 1.3% were SHV types.
Figure 4. Genotype. In genotyping using multiplex PCR, the CTX-M type was the most common genotype, accounting for 97.5%, followed by the TEM type with 32.9%. However, only 1.3% were SHV types.
Antibiotics 12 00522 g004
Antibiotics 12 00522 g005 550
Figure 5. The classification of the CTM-M type. For the classification of the CTX-M type, the CTX-M-9 group members, CTX-M-14 type, and the CTX-M-27 type predominated among the study samples. CTX-M-14 type was predominant in 35.1% of strains, and CTX-M-27 type was seen in 46.8% of strains. The CTX-M-14 type predominated through 2013, and the CTX-M-27 type came to dominate in 2014. The next most common type was CTX-M-15, which belongs to the CTX-M-1 group, with 7.8%.
Figure 5. The classification of the CTM-M type. For the classification of the CTX-M type, the CTX-M-9 group members, CTX-M-14 type, and the CTX-M-27 type predominated among the study samples. CTX-M-14 type was predominant in 35.1% of strains, and CTX-M-27 type was seen in 46.8% of strains. The CTX-M-14 type predominated through 2013, and the CTX-M-27 type came to dominate in 2014. The next most common type was CTX-M-15, which belongs to the CTX-M-1 group, with 7.8%.
Antibiotics 12 00522 g005
Antibiotics 12 00522 g006 550
Figure 6. Antimicrobial susceptibility to E. coli with the CTX-M type. Among the CTX-M types, no differences in susceptibility to CEZ, CFDN, FMOX, IPM, MEPM, CFPM, FOM, and ST were observed. However, significant differences in susceptibility to PIPC/TAZ, LVFX, CMZ, CAZ, and GM were observed.
Figure 6. Antimicrobial susceptibility to E. coli with the CTX-M type. Among the CTX-M types, no differences in susceptibility to CEZ, CFDN, FMOX, IPM, MEPM, CFPM, FOM, and ST were observed. However, significant differences in susceptibility to PIPC/TAZ, LVFX, CMZ, CAZ, and GM were observed.
Antibiotics 12 00522 g006
Antibiotics 12 00522 g007 550
Figure 7. The breakdown of cases treated with FMOX. Fourteen were for prophylactic administration prior to surgery, and 19 were for therapeutic administration for UTI. Of the 14 cases with prophylactic administration, 3 were switched to other agents due to postoperative infection, and of the 19 cases that received therapeutic administration, 6 were switched due to inadequate efficacy.
Figure 7. The breakdown of cases treated with FMOX. Fourteen were for prophylactic administration prior to surgery, and 19 were for therapeutic administration for UTI. Of the 14 cases with prophylactic administration, 3 were switched to other agents due to postoperative infection, and of the 19 cases that received therapeutic administration, 6 were switched due to inadequate efficacy.
Antibiotics 12 00522 g007
Table
Table 1. Antibiotic susceptibility to different antibiotic agents.
Table 1. Antibiotic susceptibility to different antibiotic agents.
Antibiotic
Agent		MIC (μg/ml) for All Isolates (n = 158)Susceptible Rate (%)
Breakpoint *MIC50MIC902008–2010 2011–20132014–20162017–2018
(n = 17)(n = 31)(n = 58)(n = 52)
cefazolin2>16>160000
cefdinir1>8>80020
flomoxef8 †0.1250.59410010098
cefmetazole1628881009898
ceftazidime443259654544
cefepime2>8>80320
piperacilin/tazobactam16/42/416/483979792
imipenem1≦0.5≦0.5100100100100
faropenem- ‡0.52----
meropenem1≦0.5≦0.5100100100100
levofloxacin0.5163212162210
sitafloxacin-‡12----
fosfomycin644810010097100
gentamicin4≦1>1688818485
sulfamethoxazole/trimethoprim2/388>6424425038
*: CLSI M100-ED30:based on 2020 breakpoint; †: Breakpoint of flomoxef is 8μg/ml (J Infect Chemother. 2017 Aug;23(8):517-522.) [18]; ‡: fBreakpoint is not defined about faropenem, sitafloxacin.
Table
Table 2. Two ESBL-producing Escherichia coli strains that are resistant to FMOX.
Table 2. Two ESBL-producing Escherichia coli strains that are resistant to FMOX.
No.STβ-Lactamase Gene PCRMIC50 (µg/mL)Antibiotic Agent Sensitivity
FMOXCMZ
1ST131CTX-M-21664PIPC/TAZ, IPM, MEPM, FOM, GM
2ST354CTX-M-15,CMY16164>64IPM, MEPM, FOM
Table
Table 3. Bacteria types were identified in urine samples collected before administration of FMOX.
Table 3. Bacteria types were identified in urine samples collected before administration of FMOX.
Bacteria Typesn
Escherichiscoli16
   ESBL-producing 5
   not ESBL-producing11
Klebsiella oxytoca (ESBL-producing)1
Proteus mirabillis3
   ESBL-producing 1
   not ESBL-producing2
Citrobacter koseri (ESBL-producing)1
Pseudomonas aeruginosa1
Other Gram-negative rods2
Enterococcus2
MRSA1
Other Gram-positive cocci3
Negative3
Table
Table 4. Outcomes for treatment with FMOX against ESBL-producing bacteria.
Table 4. Outcomes for treatment with FMOX against ESBL-producing bacteria.
Clinically Effective
(Success)		Change to Other Antibiotic
(Failure)		Other Antibiotic
Surgical antibiotic prophylaxis
Escherichia coli ESBL-producing3-
Other ESBL-producing bacteria-1DRPM
Urinary tract infection treatment
Escherichia coli ESBL-producing11DRPM, STFX
Other ESBL-producing bacteria11DRPM
Table
Table 5. Primers and reaction conditions used for MLST.
Table 5. Primers and reaction conditions used for MLST.
PrimerTarget GeneNucleotide Sequence (5′---3′)DenaturationAnnealingExpansionNumber of CyclesProduct Length (b.p.)
adkFadkATTCTGCTTGGCGCTCCGGG95 °C 1 min54 °C 1 min72 °C 2 min30583
adkR CCGTCAACTTTCGCGTATTT
fumCFfumCTCACAGGTCGCCAGCGCTTC 54 °C 1 min 806
fumCR GTACGCAGCGAAAAAGATTC
gyrBFgyrBTCGGCGACACGGATGACGGC 60 °C 1 min 911
gyrBR ATCAGGCCTTCACGCGCATC
icdFicdATGGAAAGTAAAGTAGTTGTTCCGGCACA 54 °C 1 min 878
icdR GGACGCAGCAGGATCTGTT
mdhFmdhATGAAAGTCGCAGTCCTCGGCGCTGCTGGCGG 60 °C 1 min 932
mdhR TTAACGAACTCCTGCCCCAGAGCGATATCTTTCTT
purAFpurACGCGCTGATGAAAGAGATGA 54 °C 1 min 816
purAR CATACGGTAAGCCACGCAGA
recAFrecACGCATTCGCTTTACCCTGACC 58 °C 1 min 780
recAR TCGTCGAAATCTACGGACCGGA
Table
Table 6. Group-specific primers used for the assays.
Table 6. Group-specific primers used for the assays.
PCR Nameβ-Lactamase TargetedPrimer NameSequence(5′-3′)Length
(Bases)		Annealing PositionAmplicon Size(bp)Primer
Concentration
(pmol/μL)
Multiplex I TEM, SHV and OXA-1-like TEM variants including TEM-1 and TEM-2 MultiTSO-T_forCATTTCCGTGTCGCCCTTATTC2213–348000.4
MultiTSO-T_revCGTTCATCCATAGTTGCCTGAC22812–7910.4
SHV variants including SHV-1 MultiTSO-S_forAGCCGCTTGAGCAAATTAAAC2171–917130.4
MultiTSO-S_revATCCCGCAGATAAATCACCAC21783–7630.4
OXA-1, OXA-4 and OXA-30 MultiTSO-O_forGGCACCAGATTCAACTTTCAAG22201–2225640.4
MultiTSO-O_revGACCCCAAGTTTCCTGTAAGTG22764–7430.4
Multiplex II CTX-M group 1, group 2 and group 9 variants of CTX-M group 1 including CTX-M-1, CTX-M-3 and CTX-M-15 MultiCTXMGp1_forTTAGGAARTGTGCCGCTGYA b2061–806880.4
MultiCTXMGp1-2_revCGATATCGTTGGTGGTRCCAT b21748–7280.2
variants of CTX-M group 2 including CTX-M-2 MultiCTXMGp2_forCGTTAACGGCACGATGAC18345–3624040.2
MultiCTXMGp1-2_revCGATATCGTTGGTGGTRCCAT b21748–7280.2
variants of CTX-M group 9 including CTX-M-9 and CTX-M-14 MultiCTXMGp9_forTCAAGCCTGCCGATCTGGT19299-3175610.4
MultiCTXMGp9_revTGATTCTCGCCGCTGAAG18859–8420.4
CTX-M group 8/25 CTX-M-8, CTX-M-25, CTX-M-26 and CTX-M-39 to CTX-M-41 CTX-Mg8/25_forAACRCRCAGACGCTCTAC b18172–1893260.4
CTX-Mg8/25_revTCGAGCCGGAASGTGTYAT b19497–4790.4
Multiplex III ACC, FOX, MOX, DHA, CIT and EBC ACC-1 and ACC-2 MultiCaseACC_forCACCTCCAGCGACTTGTTAC20744–7633460.2
MultiCaseACC_revGTTAGCCAGCATCACGATCC201089–10700.2
FOX-1 to FOX-5 MultiCaseFOX_for CTACAGTGCGGGTGGTTT 18396–4131620.5
MultiCaseFOX_rev CTATTTGCGGCCAGGTGA 18557–5400.5
MOX-1, MOX-2, CMY-1, CMY-8 to CMY-11 and CMY-19 MultiCaseMOX_for GCAACAACGACAATCCATCCT 213–238950.2
MultiCaseMOX_rev GGGATAGGCGTAACTCTCCCAA 22900–8790.2
DHA-1 and DHA-2 MultiCaseDHA_for TGATGGCACAGCAGGATATTC 21113–1339970.5
MultiCaseDHA_rev GCTTTGACTCTTTCGGTATTCG 221109–10880.5
LAT-1 to LAT-3, BIL-1, CMY-2 to CMY-7, CMY-12 to CMY-18 and CMY-21 to CMY-23 MultiCaseCIT_for CGAAGAGGCAATGACCAGAC 20570–5895380.2
MultiCaseCIT_rev ACGGACAGGGTTAGGATAGY b201107–10880.2
ACT-1 and MIR-1 MultiCaseEBC_for CGGTAAAGCCGATGTTGCG 19189–2076830.2
MultiCaseEBC_rev AGCCTAACCCCTGATACA 18871–8540.2
Multiplex IV VEB, PER and GES GES-1 to GES-9 and GES-11 MultiGES_for AGTCGGCTAGACCGGAAAG 19463–4813990.3
MultiGES_rev TTTGTCCGTGCTCAGGAT 18861–8440.3
PER-1 and PER-3 MultiPER_for GCTCCGATAATGAAAGCGT 19325–3435200.3
MultiPER_rev TTCGGCTTGACTCGGCTGA 19844–8260.3
VEB-1 to VEB-6 MultiVEB_for CATTTCCCGATGCAAAGCGT 20187–2066480.3
MultiVEB_rev CGAAGTTTCTTTGGACTCTG 20834–8150.3
Multiplex V GES and OXA-48-like GES-1 to GES-9 and GES-11 MultiGES_for AGTCGGCTAGACCGGAAAG 19463–4813990.3
MultiGES_rev TTTGTCCGTGCTCAGGAT 18861–8440.3
OXA-48-like MultiOXA-48_for GCTTGATCGCCCTCGATT 18230–2472810.4
MultiOXA-48_rev GATTTGCTCCGTGGCCGAAA 20490–5100.4
Multiplex VI IMP, VIM and KPC IMP variants except IMP-9, IMP-16, IMP-18, IMP-22 and IMP-25 MultiIMP_for TTGACACTCCATTTACDG b18194–2111390.5
MultiIMP_rev GATYGAGAATTAAGCCACYCT b21332–3130.5
VIM variants including VIM-1 and VIM-2 MultiVIM_for c GATGGTGTTTGGTCGCATA 19151–1693900.5
MultiVIM_rev c CGAATGCGCAGCACCAG 17540–5240.5
KPC-1 to KPC-5 MultiKPC_for CATTCAAGGGCTTTCTTGCTGC 22209–2305380.2
MultiKPC_rev ACGACGGCATAGTCATTTGC 20746–7270.2
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sakaeda, K.; Sadahira, T.; Maruyama, Y.; Iwata, T.; Watanabe, M.; Wada, K.; Araki, M. The Genotypic and Phenotypic Characteristics Contributing to Flomoxef Sensitivity in Clinical Isolates of ESBL-Producing E. coli Strains from Urinary Tract Infections. Antibiotics 2023, 12, 522. https://doi.org/10.3390/antibiotics12030522

AMA Style

Sakaeda K, Sadahira T, Maruyama Y, Iwata T, Watanabe M, Wada K, Araki M. The Genotypic and Phenotypic Characteristics Contributing to Flomoxef Sensitivity in Clinical Isolates of ESBL-Producing E. coli Strains from Urinary Tract Infections. Antibiotics. 2023; 12(3):522. https://doi.org/10.3390/antibiotics12030522

Chicago/Turabian Style

Sakaeda, Kazuma, Takuya Sadahira, Yuki Maruyama, Takehiro Iwata, Masami Watanabe, Koichiro Wada, and Motoo Araki. 2023. "The Genotypic and Phenotypic Characteristics Contributing to Flomoxef Sensitivity in Clinical Isolates of ESBL-Producing E. coli Strains from Urinary Tract Infections" Antibiotics 12, no. 3: 522. https://doi.org/10.3390/antibiotics12030522

APA Style

Sakaeda, K., Sadahira, T., Maruyama, Y., Iwata, T., Watanabe, M., Wada, K., & Araki, M. (2023). The Genotypic and Phenotypic Characteristics Contributing to Flomoxef Sensitivity in Clinical Isolates of ESBL-Producing E. coli Strains from Urinary Tract Infections. Antibiotics, 12(3), 522. https://doi.org/10.3390/antibiotics12030522

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop