Prevalence of Periodontal Pathogens in Slovak Patients with Periodontitis and Their Possible Aspect of Transmission from Companion Animals to Humans
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Plaque Samples from Human and Animal Population
2.2. Ethical Approval
2.3. Extraction of Microbial DNA
2.4. Molecular Detection of Periodontal Pathogens
2.5. Sequencing and Data Processing
2.6. Disk Diffusion Susceptibility Test
3. Results
3.1. Baseline Characteristics of the Participants and Companion Animals
3.2. Detection of Periodontal Pathogens in Humans
3.3. Comparison of Periodontal Pathogens between Companion Animals and Their Owners
3.4. Antibiotic Susceptibility of Tannerella forsythia
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jochebed, S.R.; Jacob, C.A. Isolation, Transportation and Culture Methods of Tannerella forsythia—A Review. Int. J. Sci. Dev. Res. 2020, 5, 208–212. [Google Scholar]
- Wei, Y.; Shi, M.; Zhen, M.; Wang, C.; Hu, W.; Nie, Y.; Wu, X. Comparison of Subgingival and Buccal Mucosa Microbiome in Chronic and Aggressive Periodontitis: A Pilot Study. Front. Cell. Infect. Microbial. 2019, 9, 53. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abebe, G.M. Oral Biofilm and Its Impact on Oral Health, Psychological and Social Interaction. Int. J. Oral Dent. Health 2021, 7, 127. [Google Scholar] [CrossRef]
- Li, X.; Liu, Y.; Yang, X.; Li, C.; Song, Z. The Oral Microbiota: Community Composition, Influencing Factors, Pathogenesis, and Interventions. Front. Microbiol. 2022, 13, 895537. [Google Scholar] [CrossRef]
- Boyer, E.; Martin, B.; Le Gall-David, S.; Fong, S.B.; Deugnier, Y.; Bonnaure-Mallet, M.; Meuric, V. Periodontal pathogens and clinical parameters in chronic periodontitis. Mol. Oral Microbiol. 2020, 35, 19–28. [Google Scholar] [CrossRef] [PubMed]
- de Coo, A.; Cruz, R.; Quintela, I.; Herrera, D.; Sanz, M.; Diz, P.; Rodríguez Grandío, S.; Vallcorba, N.; Ramos, I.; Oteo, A.; et al. Genome-Wide association study of stage III/IV grade C periodontitis (former aggressive periodontitis) in a Spanish population. J. Clin. Periodontol. 2021, 48, 896–906. [Google Scholar] [CrossRef] [PubMed]
- Lang, K.N.; Sculean, A.; Eick, S.; Stähli, A. A novel in vitro periodontal pocket model to evaluate the effect of root surface instrumentation on biofilm-epithelial cell interactions. Clin. Oral Investig. 2022, 26, 4021–4029. [Google Scholar] [CrossRef] [PubMed]
- Damgaard, C.; Danielsen, A.K.; Enevold, C.; Massarenti, L.; Nielsen, C.H.; Holmstrup, P.; Belstrøm, D. Porphyromonas gingivalis in saliva associates with chronic and aggressive periodontitis. J. Oral Microbiol. 2019, 11, 1653123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Montenegro, S.; Retamal-Valdes, B.; Bueno-Silva, B.; Duarte, P.M.; Faveri, M.; Figueiredo, L.C.; Feres, M. Do patients with aggressive and chronic periodontitis exhibit specific differences in the subgingival microbial composition? A systematic review. J. Periodontol. 2020, 91, 1503–1520. [Google Scholar] [CrossRef] [PubMed]
- Takedachi, M.; Shimabukuro, Y.; Sawada, K.; Koshimizu, M.; Shinada, K.; Asai, H.; Mizoguchi, A.; Hayashi, Y.; Tsukamoto, A.; Miyago, M.; et al. Evaluation of periodontitis-related tooth loss according to the new 2018 classification of periodontitis. Sci. Rep. 2022, 12, 11893. [Google Scholar] [CrossRef] [PubMed]
- Schulz, S.; Porsch, M.; Grosse, I.; Hoffmann, K.; Schaller, H.G.; Reichert, S. Comparison of the oral microbiome of patients with generalized aggressive periodontitis and periodontitis-free subjects. Arch. Oral Biol. 2019, 99, 169–176. [Google Scholar] [CrossRef]
- Eick, S.; Kindblom, C.; Mizgalska, D.; Magdoń, A.; Jurczyk, K.; Sculean, A.; Stavropoulos, A. Adhesion of Porphyromonas gingivalis and Tannerella forsythia to dentin and titanium with sandblasted and acid etched surface coated with serum and serum proteins—An in vitro study. Arch. Oral Biol. 2017, 75, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Abu Fanas, S.; Brigi, C.; Varma, S.R.; Desai, V.; Senok, A.; D’souza, J. The prevalence of novel periodontal pathogens and bacterial complexes in Stage II generalized periodontitis based on 16S rRNA next generation sequencing. J. Appl. Oral Sci. 2021, 29, e20200787. [Google Scholar] [CrossRef] [PubMed]
- Kumawat, R.M.; Ganvir, S.M.; Hazarey, V.K.; Qureshi, A.; Purohit, H.J. Detection of Porphyromonas gingivalis and Treponema denticola in chronic and aggressive periodontitis patients: A comparative polymerase chain reaction study. Contemp. Clin. Dent. 2016, 7, 481–486. [Google Scholar] [CrossRef]
- Lauritano, D.; Martinelli, M.; Mucchi, D.; Palmieri, A.; Lo Muzio, L.; Carinci, F. Bacterial load of periodontal pathogens among italian patients with chronic periodontitis: A comparative study of three different areas. J. Biol. Regul. Homeost. Agents 2016, 30, 149–154. [Google Scholar] [PubMed]
- Wallis, C.; Holcombe, L.J. A review of the frequency and impact of periodontal disease in dogs. J. Small Anim. Pract. 2020, 61, 529–540. [Google Scholar] [CrossRef] [PubMed]
- Albuquerque, C.; Morinha, F.; Requicha, J.; Martins, T.; Dias, I.; Guedes-Pinto, H.; Bastos, E.; Viegas, C. Canine periodontitis: The dog as an important model for periodontal studies. Vet. J. 2012, 191, 299–305. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Salcedo, L.; Laguna, E.; Sánchez, M.C.; Marín, M.J.; O’Connor, A.; González, I.; Sanz, M.; Herrera, D. Molecular identification of black-pigmented bacteria from subgingival samples of cats suffering from periodontal disease. J. Small Anim. Pract. 2015, 56, 270–275. [Google Scholar] [CrossRef] [PubMed]
- Özavci, V.; Erbas, G.; Parin, U.; Yüksel, H.T.; Kirkan, Ş. Molecular detection of feline and canine periodontal pathogens. Vet. Anim. Sci. 2019, 8, 100069. [Google Scholar] [CrossRef]
- Booij-Vrieling, H.E.; van der Reijden, W.A.; Houwers, D.J.; de Wit, W.E.; Bosch-Tijhof, C.J.; Penning, L.C.; van Winkelhoff, A.J.; Hazewinkel, H.A. Comparison of periodontal pathogens between cats and their owners. Vet. Microbiol. 2010, 144, 147–152. [Google Scholar] [CrossRef]
- Oh, C.; Lee, K.; Cheong, Y.; Lee, S.W.; Park, S.Y.; Song, C.S.; Choi, I.S.; Lee, J.B. Comparison of the Oral Microbiomes of Canines and Their Owners Using Next-Generation Sequencing. PLoS ONE 2015, 10, e0131468. [Google Scholar] [CrossRef] [PubMed]
- Nises, J.; Rosander, A.; Pettersson, A.; Backhans, A. The occurrence of Treponema spp. in gingival plaque from dogs with varying degree of periodontal disease. PLoS ONE 2018, 13, e0201888. [Google Scholar] [CrossRef] [PubMed]
- Yamasaki, Y.; Nomura, R.; Nakano, K.; Naka, S.; Matsumoto-Nakano, M.; Asai, F.; Ooshima, T. Distribution of periodontopathic bacterial species in dogs and their owners. Arch. Oral Biol. 2012, 57, 1183–1188. [Google Scholar] [CrossRef] [PubMed]
- Tonetti, M.S.; Greenwell, H.; Kornman, K.S. Staging and grading of periodontitis: Framework and proposal of a new classification and case definition. J. Periodontol. 2018, 89, S159–S172. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bauer, A.E.; Stella, J.; Lemmons, M.; Croney, C.C. Evaluating the validity and reliability of a visual dental scale for detection of periodontal disease (PD) in non-anesthetized dogs (Canis familiaris). PLoS ONE 2018, 13, e0203930. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vesty, A.; Biswas, K.; Taylor, M.W.; Gear, K.; Douglas, R.G. Evaluating the Impact of DNA Extraction Method on the Representation of Human Oral Bacterial and Fungal Communities. PLoS ONE 2017, 12, e0169877. [Google Scholar] [CrossRef] [Green Version]
- Brandt, S.; Apprich, V.; Hackl, V.; Tober, R.; Danzer, M.; Kainzbauer, C.; Gabriel, C.; Stanek, C.; Kofler, J. Prevalence of bovine papillomavirus and Treponema DNA in bovine digital dermatitis lesions. Vet. Microbiol. 2011, 148, 161–167. [Google Scholar] [CrossRef] [PubMed]
- Slots, J.; Ashimoto, A.; Flynn, M.J.; Li, G.; Chen, C. Detection of putative periodontal pathogens in subgingival specimens by 16S ribosomal DNA amplification with the polymerase chain reaction. Clin. Infect. Dis. 1995, 20, S304–S307. [Google Scholar] [CrossRef]
- Senhorinho, G.N.; Nakano, V.; Liu, C.; Song, Y.; Finegold, S.M.; Avila-Campos, M.J. Detection of Porphyromonas gulae from subgingival biofilms of dogs with and without periodontitis. Anaerobe 2011, 17, 257–258. [Google Scholar] [CrossRef]
- Kannosh, I.; Staletovic, D.; Toljic, B.; Radunovic, M.; Pucar, A.; Matic Petrovic, S.; Grubisa, I.; Lazarevic, M.; Brkic, Z.; Knezevic Vukcevic, J.; et al. The presence of periopathogenic bacteria in subgingival and atherosclerotic plaques—An age related comparative analysis. J. Infect. Dev. Ctries. 2018, 12, 1088–1095. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Q.; Baum, L.; Fu, W.L. Simple and practical staining of DNA with GelRed in agarose gel electrophoresis. Clin. Lab. 2010, 56, 149–152. [Google Scholar]
- Dubreuil, L.; Members of the CA-SFM 2019. Improvement of a disk diffusion method for antibiotic susceptibility testing of anaerobic bacteria. French recommendations revisited for 2020. Anaerobe 2020, 64, 102213. [Google Scholar] [CrossRef]
- Nagy, E.; Justesen, U.S.; Eitel, Z.; Urbán, E.; ESCMID Study Group on Anaerobic Infection. Development of EUCAST disk diffusion method for susceptibility testing of the Bacteroides fragilis group isolates. Anaerobe 2015, 31, 65–71. [Google Scholar] [CrossRef] [PubMed]
- Ibrahim, S.A.; Al-Jamell, D.S.; Tweij, T.A.R.; Hameed, S.A. Comparative study between pre and post bacterial growth of periodontal infections by treatment with extracts Rue. An in vitro study. J. Pharm. Sci. Res. 2019, 11, 104–109. [Google Scholar]
- Mahalakshmi, K.; Krishnan, P.; Chandrasekaran, S.C. Detection of Tannerella forsythia bspA and prtH genotypes among periodontitis patients and healthy subjects—A case-Control study. Arch. Oral Biol. 2018, 96, 178–181. [Google Scholar] [CrossRef]
- Puletic, M.; Popovic, B.; Jankovic, S.; Brajovic, G. Detection rates of periodontal bacteria and herpesviruses in different forms of periodontal disease. Microbiol. Immunol. 2020, 64, 815–824. [Google Scholar] [CrossRef] [PubMed]
- Al Yahfoufi, Z.; Hadchiti, W. Prevalence of Periodontal Pathogens in a Group of Participants from the Middle East and North Africa Geographic Region with Minimal Periodontal Disease. J. Int. Soc. Prev. Community Dent. 2017, 7, S30–S35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rajakaruna, G.A.; Negi, M.; Uchida, K.; Sekine, M.; Furukawa, A.; Ito, T.; Kobayashi, D.; Suzuki, Y.; Akashi, T.; Umeda, M.; et al. Localization and density of Porphyromonas gingivalis and Tannerella forsythia in gingival and subgingival granulation tissues affected by chronic or aggressive periodontitis. Sci. Rep. 2018, 8, 9507. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Badanian, A.; de León, E.P.; Rodriquez, L.; Bascuas, T.; Capo, C.; Battle, A.; Bueno, L.; Papone, V. Detection of periodontal pathogens in a Uruguayan population with aggressive periodontitis using conventional and molecular methods. Odontoestomatología 2018, 20, 68–77. [Google Scholar] [CrossRef]
- Menini, M.; Delucchi, F.; Bagnasco, F.; Pera, F.; Di Tullio, N.; Pesce, P. Analysis of the Subgingival Microbiota in Implant-Supported Full-Arch Rehabilitations. Dent. J. 2020, 8, 104. [Google Scholar] [CrossRef] [PubMed]
- dos Santos, P.B.R.E.; de Lima, P.M.N.; Palma, A.L.R.; Hasna, A.A.; Rossoni, R.D.; Junqueira, J.C.; de Oliveira, L.D. Review- The periodontal pathogen Treponema denticola: An atherosclerosis risk factor. Res. Soc. Dev. 2021, 10, e25810111637. [Google Scholar] [CrossRef]
- Zeng, H.; Chan, Y.; Gao, W.; Leung, W.K.; Watt, R.M. Diversity of Treponema denticola and Other Oral Treponeme Lineages in Subjects with Periodontitis and Gingivitis. Microbiol. Spectr. 2021, 9, e0070121. [Google Scholar] [CrossRef] [PubMed]
- Jepsen, K.; Falk, W.; Brune, F.; Fimmers, R.; Jepsen, S.; Bekeredjian-Ding, I. Prevalence and antibiotic susceptibility trends of periodontal pathogens in the subgingival microbiota of German periodontitis patients: A retrospective surveillance study. J. Clin. Periodontol. 2021, 48, 1216–1227. [Google Scholar] [CrossRef] [PubMed]
- Feng, X.; Zhu, L.; Xu, L.; Meng, H.; Zhang, L.; Ren, X.; Lu, R.; Tian, Y.; Shi, D.; Wang, X. Distribution of 8 periodontal microorganisms in family members of Chinese patients with aggressive periodontitis. Arch. Oral. Biol. 2015, 60, 400–407. [Google Scholar] [CrossRef] [PubMed]
- Torrungruang, K.; Jitpakdeebordin, S.; Charatkulangkun, O.; Gleebbua, Y. Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, and Treponema denticola/Prevotella intermedia Co-Infection are Associated with Severe Periodontitis in a Thai Population. PLoS ONE 2015, 10, e0136646. [Google Scholar] [CrossRef]
- Al-Deen, H.S.; Al-Ankoshy, A.A.M.; Al-Najhi, M.M.A.; Al-Kabsia, T.A.; AL-Haddad, K.A.; Al-Akwa, A.A.Y.; Al-Shamahy, H.A.; Al-labani, M.A. Porphyromonas gingivalis: Biofilm formation, antimicrobial susceptibility of isolates from cases of Localized Aggressive Periodontitis (LAP). Univers. J. Pharm. Res. 2021, 6, 1–7. [Google Scholar] [CrossRef]
- Jia, L.; Han, N.; Du, J.; Guo, L.; Luo, Z.; Liu, Y. Pathogenesis of Important Virulence Factors of Porphyromonas gingivalis via Toll-Like Receptors. Front. Cell. Infect. Microbiol. 2019, 9, 262. [Google Scholar] [CrossRef] [PubMed]
- Xu, W.; Zhou, W.; Wang, H.; Liang, S. Roles of Porphyromonas gingivalis and its Virulence factors in periodontitis. Adv. Protein Chem. Struct. Biol. 2020, 120, 45–84. [Google Scholar] [CrossRef] [PubMed]
- Septiwidyati, T.R.; Bachtiar, E.W. The Role of Porphyromonas gingivalis Virulence Factors in Periodontitis Immunopathogenesis. Dentika Dent. J. 2020, 23, 6–12. [Google Scholar] [CrossRef]
- Joshi, V.M.; Bhat, K.G.; Kugaji, M.S.; Ingalagi, P.S. Prevalence of Porphyromonas gingivalis and its relationship with herpesvirus in Indian subjects with chronic periodontitis: A cross-sectional study. J. Int. Clin. Dent. Res. Organ. 2016, 8, 106–110. [Google Scholar] [CrossRef]
- Rafiei, M.; Kiani, F.; Sayehmiri, K.; Sayehmiri, F.; Tavirani, M.; Dousti, M.; Sheikhi, A. Prevalence of Anaerobic Bacteria (P. gingivalis) as Major Microbial Agent in the Incidence Periodontal Diseases by Meta-Analysis. J. Dent. (Shiraz) 2018, 19, 232–242. [Google Scholar]
- Mínguez, M.; Ennibi, O.K.; Perdiguero, P.; Lakhdar, L.; Abdellaoui, L.; Sánchez, M.C.; Sanz, M.; Herrera, D. Antimicrobial susceptibilities of Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis strains from periodontitis patients in Morocco. Clin. Oral Investig. 2019, 23, 1161–1170. [Google Scholar] [CrossRef] [PubMed]
- Santibáñez, R.; Rodríguez-Salas, C.; Flores-Yáñez, C.; Garrido, D.; Thomson, P. Assessment of Changes in the Oral Microbiome That Occur in Dogs with Periodontal Disease. Vet. Sci. 2021, 8, 291. [Google Scholar] [CrossRef] [PubMed]
- Ardila, C.M.; Bedoya-García, J.A. Antimicrobial resistance of Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis and Tannerella forsythia in periodontitis patients. J. Glob. Antimicrob. Resist. 2020, 22, 215–218. [Google Scholar] [CrossRef] [PubMed]
- Alazemi, A.M.; Jamal, W.; Al Khabbaz, A.; Rotimi, V.O. Prevalence of target anaerobes associated with chronic periodontitis. Access. Microbiol. 2020, 2, acmi000177. [Google Scholar] [CrossRef] [PubMed]
- Papone, V.; Verolo, C.; Zaffaroni, L.; Batlle, A.; Capo, C.; Bueno, L.; Gamonal, J.; Silvia, N.; Soria, S. Detection and prevalence of periodontal pathogens in a Uruguayan population with chronic periodontitis using conventional methodology and metagenomics. Odontoestomatología 2015, 17, 23–33. [Google Scholar]
- Tettamanti, L.; Gaudio, R.M.; Cura, F.; Mucchi, D.; Illuzzi, N.; Tagliabue, A. Prevalence of periodontal pathogens among italian patients with chronic periodontitis: A retrospective study on 2992 patients. Oral Implantol. 2017, 10, 28–36. [Google Scholar] [CrossRef] [PubMed]
- Tanner, A.C.R.; Izard, J. Tannerella forsythia, a periodontal pathogen entering the genomic era. Periodontology 2000 2006, 42, 88–113. [Google Scholar] [CrossRef]
- Belibasakis, G.N.; Maula, T.; Bao, K.; Lindholm, M.; Bostanci, N.; Oscarsson, J.; Ihalin, R.; Johansson, A. Virulence and Pathogenicity Properties of Aggregatibacter actinomycetemcomitans. Pathogens 2019, 8, 222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fine, D.H.; Patil, A.G.; Velusamy, S.K. Aggregatibacter actinomycetemcomitans (Aa) Under the Radar: Myths and Misunderstandings of Aa and Its Role in Aggressive Periodontitis. Front. Immunol. 2019, 10, 728. [Google Scholar] [CrossRef] [Green Version]
- Jensen, A.B.; Isidor, F.; Lund, M.; Væth, M.; Johansson, A.; Lauritsen, N.N.; Haubek, D. Prevalence of Aggregatibacter actinomycetemcomitans and Periodontal Findings among 14 to 15-Year Old Danish Adolescents: A Descriptive Cross-Sectional Study. Pathogens 2020, 9, 1054. [Google Scholar] [CrossRef] [PubMed]
- Claesson, R.; Höglund-Åberg, C.; Haubek, D.; Johansson, A. Age-Related prevalence and characteristics of Aggregatibacter actinomycetemcomitans in periodontitis patients living in Sweden. J. Oral Microbiol. 2017, 9, 1334504. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Borilova Linhartova, P.; Danek, Z.; Deissova, T.; Hromcik, F.; Lipovy, B.; Szaraz, D.; Janos, J.; Fassmann, A.; Bartova, J.; Drizhal, I.; et al. Interleukin Gene Variability and Periodontal Bacteria in Patients with Generalized Aggressive Form of Periodontitis. Int. J. Mol. Sci. 2020, 21, 4728. [Google Scholar] [CrossRef] [PubMed]
- Govindarajan, K.; Muthukumar, S.; Rangarao, S. Relationship between interleukin 1α levels in the gingival crevicular fluid in health and in inflammatory periodontal disease and periodontal inflamed surface area: A correlative study. J. Indian Soc. Periodontol. 2015, 19, 618–623. [Google Scholar] [CrossRef]
- Grigoriadou, M.E.; Koutayas, S.O.; Madianos, P.N.; Strub, J.R. Interleukin-1 as a genetic marker for periodontitis: Review of the literature. Quintessence Int. 2010, 41, 517–525. [Google Scholar]
- Sippert, E.Â.; de Oliveira e Silva, C.; Ayo, C.M.; Marques, S.B.; Visentainer, J.E.; Sell, A.M. HLA Haplotypes and Genotypes Frequencies in Brazilian Chronic Periodontitis Patients. Mediat. Inflamm. 2015, 2015, 481656. [Google Scholar] [CrossRef]
- Reichert, S.; Altermann, W.; Stein, J.M.; Schaller, H.G.; Machulla, H.K.; Schulz, S. Individual composition of human leukocyte antigens and periodontopathogens in the background of periodontitis. J. Periodontol. 2013, 84, 100–109. [Google Scholar] [CrossRef]
- Brodzikowska, A.; Górska, R.; Kowalski, J. Interleukin-1 Genotype in Periodontitis. Arch. Immunol. Ther. Exp. 2019, 67, 367–373. [Google Scholar] [CrossRef] [Green Version]
- Arastu-Kapur, S.; Nguyen, M.; Raha, D.; Ermini, F.; Haditsch, U.; Araujo, J.; De Lannoy, I.; Ryder, M.I.; Dominy, S.S.; Lynch, C.; et al. Treatment of Porphyromonas gulae infection and downstream pathology in the aged dog by lysine-gingipain inhibitor COR388. Pharmacol. Res. Perspect. 2020, 8, e00562. [Google Scholar] [CrossRef] [Green Version]
- Fujiwara-Takahashi, K.; Watanabe, T.; Shimogishi, M.; Shibasaki, M.; Umeda, M.; Izumi, Y.; Nakagawa, I. Phylogenetic diversity in fim and mfa gene clusters between Porphyromonas gingivalis and Porphyromonas gulae, as a potential cause of host specificity. J. Oral Microbiol. 2020, 12, 1775333. [Google Scholar] [CrossRef]
- Oba, P.M.; Carroll, M.Q.; Alexander, C.; Somrak, A.J.; Keating, S.; Sage, A.M.; Swanson, K.S. Dental chews positively shift the oral microbiota of adult dogs. J. Anim. Sci. 2021, 99, skab100. [Google Scholar] [CrossRef] [PubMed]
- Lenzo, J.C.; O’Brien-Simpson, N.M.; Orth, R.K.; Mitchell, H.L.; Dashper, S.G.; Reynolds, E.C. Porphyromonas gulae Has Virulence and Immunological Characteristics Similar to Those of the Human Periodontal Pathogen Porphyromonas gingivalis. Infect. Immun. 2016, 84, 2575–2585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nomura, R.; Shirai, M.; Kato, Y.; Murakami, M.; Nakano, K.; Hirai, N.; Mizusawa, T.; Naka, S.; Yamasaki, Y.; Matsumoto-Nakano, M.; et al. Diversity of fimbrillin among Porphyromonas gulae clinical isolates from Japanese dogs. Vet. Med. Sci. 2012, 74, 885–891. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iwashita, N.; Nomura, R.; Shirai, M.; Kato, Y.; Murakami, M.; Matayoshi, S.; Kadota, T.; Shirahata, S.; Ohzeki, L.; Arai, N.; et al. Identification and molecular characterization of Porphyromonas gulae fimA types among cat isolates. Vet. Microbiol. 2019, 229, 100–109. [Google Scholar] [CrossRef] [PubMed]
- Kwon, D.; Bae, K.; Kim, H.; Kim, S.H.; Lee, D.; Lee, J.H. Treponema denticola as a prognostic biomarker for periodontitis in dogs. PLoS ONE 2022, 17, e0262859. [Google Scholar] [CrossRef] [PubMed]
Bacterial Species (Gene) | Primer Sequence (5′ to 3′) | PCR Conditions | Length (bp) | Source |
---|---|---|---|---|
Treponema sp. (flaB2 gene) | ACGGYATTTCYTTTATTCAAGTTGC | 94 °C 5 min, 45× [94 °C 30 s, 63 °C 30 s, 72 °C 40 s] 72 °C 5 min | 471 | [27] |
CGAGTCTGTTYTGGTATGCACC | ||||
Treponema denticola (fragment of 16S rRNA gene) | TAATACCGAATGTGCTCATTTACAT | 95 °C 2 min, 36× [95 °C 30 s, 60 °C 1 min, 72 °C 1 min] 72 °C 2 min | 316 | [28] |
TCAAAGAAGCATTCCCTCTTCTTCTTA | ||||
Porphyromonas gingivalis (fragment of 16S rRNA gene) | AGGCAGCTTGCCATACTGCG | 95 °C 5 min, 36× [95 °C 30 s, 60 °C 1 min, 72 °C 1 min] 72 °C 2 min | 404 | [28] |
ACTGTTAGCAACTACCGATGT | ||||
Porphyromonas gulae (fragment of 16S rRNA gene) | TTGGTTGCATGATCGGG | 94 °C 5 min, 35× [94 °C 30 s, 58 °C 1 min, 72 °C 30 s] 72 °C 5 min | 300 | [29] |
GCTTATTCTTACGGTACATTCAYA | ||||
Tannerella forsythia (fragment of 16S rRNA gene) | GCGTATGTAACCTGCCCGCA | 95 °C 2 min, 36× [95 °C 30 s, 60 °C 1 min, 72 °C 1 min] 72 °C 2 min | 641 | [28] |
TGCTTCAGTGTCAGTTATACCT | ||||
Aggregatibacter actinomycetemcomitans (fragment of 16S rRNA gene) | GCTAATACCGCGTAGAGTCGG | 95 °C 3 min, 35× [94 °C 45 s, 55 °C 1 min, 72 °C 1 min] 72 °C 5 min | 500 | [30] |
ATTTCACACCTCACTTAAAGGT |
Patients | Gender | Age (Years) | Periodontitis | Animals | |
---|---|---|---|---|---|
Stage | Grade | ||||
H1 | F | 58 | III | B | |
H2 | M | 44 | I | B | |
H3 | M | 61 | II–III | B | |
H4 | F | 38 | I | A | Dog |
H5 | F | 51 | I | A | |
H6 | M | 45 | III | B | |
H7 | M | 68 | II–III | B | |
H8 | M | 63 | I | A | |
H9 | F | 63 | II | C | Dog |
H10 | M | 41 | II–III | B | Dog, Cat |
H11 | F | 34 | I | A | |
H12 | M | 46 | III | C | Dog |
H13 | F | 44 | I | A | Dog |
Animals | Sample Name | Gender | Age (Year) | Breed | Periodontal Stage |
---|---|---|---|---|---|
Dog 1 | H4D1 | M | 1.5 | Labrador Retriever | I |
Dog 2 | H9D2 | F | 10 | Vizsla | I |
Dog 3 | H10D3 | F | 2 | x Siberian Husky | I |
Dog 4 | H12D4 | M | 6 | French Bulldog | Healthy |
Cat 1 | H10C1 | F | 10 | European Shorthair | III |
Patients | Treponema denticola | Porphyromonas gingivalis | Porphyromonas gulae | Tannerella forsythia | Aggregatibacter actinomycetemcomitans |
---|---|---|---|---|---|
H1 | + | + | + | + | |
H2 | + | + | + | + | |
H3 | + | + | + | + | |
H4 | + * | + | + | + | |
H5 | + | ||||
H6 | + | + | + | + | |
H7 | + | + | + | ||
H8 | + ** | + | + | ||
H9 | + | + | + | + | |
H10 | + | + | + | + | |
H11 | + | + | + | + | |
H12 | + | + | + | + | |
H13 | + | + | + | + |
Animals | Treponema denticola | Porphyromonas gingivalis | Porphyromonas gulae | Tannerella forsythia | Aggregatibacter actinomycetemcomitans |
---|---|---|---|---|---|
Dog 1 | + * | + | + | + | |
Dog 2 | + * | + | + | + | |
Dog 3 | + | + * | + | + | + |
Dog 4 | + * | + | + | + | |
Cat 1 | + * | + | + | + |
Isolate | Inhibition Zone of Antibiotics (mm) | |||
---|---|---|---|---|
AMC | CD | MO | MT | |
H3c | 35 | 33 | 30 | 0 |
H4a | 45 | 31 | 25 | 0 |
H5a | 42 | 31 | 30 | 0 |
H6a | 42 | 34 | 27 | 0 |
H7b | 36 | 29 | 30 | 0 |
H8b | 33 | 29 | 27 | 0 |
H9b | 41 | 36 | 29 | 0 |
H11a | 30 | 27 | 25 | 0 |
H12a | 28 | 26 | 22 | 0 |
H13b | 31 | 26 | 31 | 0 |
H12D4a | 30 | 0 | 22 | 0 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sondorová, M.; Kučera, J.; Kačírová, J.; Krchová Nagyová, Z.; Šurín Hudáková, N.; Lipták, T.; Maďar, M. Prevalence of Periodontal Pathogens in Slovak Patients with Periodontitis and Their Possible Aspect of Transmission from Companion Animals to Humans. Biology 2022, 11, 1529. https://doi.org/10.3390/biology11101529
Sondorová M, Kučera J, Kačírová J, Krchová Nagyová Z, Šurín Hudáková N, Lipták T, Maďar M. Prevalence of Periodontal Pathogens in Slovak Patients with Periodontitis and Their Possible Aspect of Transmission from Companion Animals to Humans. Biology. 2022; 11(10):1529. https://doi.org/10.3390/biology11101529
Chicago/Turabian StyleSondorová, Miriam, Ján Kučera, Jana Kačírová, Zuzana Krchová Nagyová, Natália Šurín Hudáková, Tomáš Lipták, and Marián Maďar. 2022. "Prevalence of Periodontal Pathogens in Slovak Patients with Periodontitis and Their Possible Aspect of Transmission from Companion Animals to Humans" Biology 11, no. 10: 1529. https://doi.org/10.3390/biology11101529