Next Article in Journal
Biological Invasions Affect Resource Processing in Aquatic Ecosystems: The Invasive Amphipod Dikerogammarus villosus Impacts Detritus Processing through High Abundance Rather than Differential Response to Temperature
Previous Article in Journal
Systemic and Pulmonary Inflammation/Oxidative Damage: Implications of General and Respiratory Muscle Training in Chronic Spinal-Cord-Injured Patients
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biology
Volume 12
Issue 6
10.3390/biology12060829
biology-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A New Cell Line Derived from the Caudal Fin of the Dwarf Gourami (Trichogaster lalius) and Its Susceptibility to Fish Viruses

by
Ye-Jin Jeong
and
Kwang-Il Kim
*
Department of Aquatic Life Medicine, Pukyong National University, Busan 48513, Republic of Korea
*
Author to whom correspondence should be addressed.
Biology 2023, 12(6), 829; https://doi.org/10.3390/biology12060829
Submission received: 18 May 2023 / Revised: 1 June 2023 / Accepted: 6 June 2023 / Published: 7 June 2023
(This article belongs to the Section Cell Biology)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Fish-derived primary cells are highly valuable for investigating cell–virus interactions, virus isolation, diagnosis, and vaccine development because of their rapid growth rate and high susceptibility to viruses. We established a new cell line, the dwarf gourami fin (DGF), from the caudal fin of the dwarf gourami (Trichogaster lalius). We analyzed the optimal growth conditions, including media, temperature, and fetal bovine serum concentration, modal chromosome number, and transfection efficiency. The susceptibility of DGF cells to different viruses, including red sea bream iridovirus, infectious spleen and kidney necrosis virus, viral hemorrhagic septicemia virus, hirame rhabdovirus, and spring viraemia of carp virus was evaluated.

Abstract

The detection of megalocytiviruses, especially the infectious spleen and kidney necrosis virus (ISKNV), in ornamental fish has increased with the rapid growth of the ornamental fish industry. In this study, dwarf gourami fin (DGF) cells derived from the caudal fin of the dwarf gourami (Trichogaster lalius), which is highly susceptible to red sea bream iridovirus (RSIV) and ISKNV, were established and characterized. The DGF cells were grown at temperatures ranging from 25 °C to 30 °C in Leibovitz’s L-15 medium supplemented with 15% fetal bovine serum and were subcultured for more than 100 passages, predominantly with epithelial-like cells. DGF cells had a diploid chromosome number of 2n = 44. Although the initial purpose of this study was to establish a cell line for the causative agents of red sea bream iridoviral disease (RSIV and ISKNV), DGF cells were also susceptible to rhabdoviruses (viral hemorrhagic septicemia virus, hirame rhabdovirus, and spring viraemia of carp virus), exhibiting a significant cytopathic effect characterized by cell rounding and lysis. Additionally, viral replication and virion morphology were confirmed using virus-specific conventional polymerase chain reaction and transmission electron microscopy. Furthermore, both RSIV and ISKNV were replicated at high concentrations in DGF cells compared to other cell lines. Notably, the DGF cells maintained a monolayer during ISKNV infection, indicating the possibility of persistent infection. Thus, DGF can be used for viral diagnosis and may play a critical role in advancing our understanding of ISKNV pathogenesis.

1. Introduction

Ornamental fish have become a growing sector in the international fish trade, primarily because of the increasing popularity of household and public aquaria worldwide [1]. The ornamental fish trade is a multibillion-dollar industry estimated to involve more than 125 countries, and more than two billion live ornamental fish are traded annually [2]. Various pathogens have been detected during live ornamental fish trades, especially infectious spleen and kidney necrosis virus (ISKNV), which has been detected in various ornamental fish, including peal gourami (Trichopodus leerii), moonlight gourami (Trichopodus microlepis), dwarf gourami (Trichogaster lalius), southern platyfish (Xiphophorus maculatus), green swordtail (Xiphophorus helleri), molly (Poecilia sphenops), guppy (Poecilia reticulatus), oscar (Astronotus ocellatus), neon tetra (Hyphessobrycon innesi), and angel fish (Pterophyllum eimekei) [3].
Members of the genus Megalocytivirus (family Iridoviridae) comprise double-stranded DNA enclosed within an icosahedral capsid surrounded by an envelope, and are classified into four viruses: infectious spleen and kidney necrosis virus (ISKNV), red sea bream iridovirus (RSIV), turbot reddish body iridovirus (TRBIV), and scale drop disease virus (SDDV) [4]. Among these, RSIV and ISKNV are causative agents of red sea bream iridoviral disease (RSIVD), which has a broad host range and infects over 40 species of freshwater and marine fish, resulting in significant global economic losses [5]. ISKNV-infected ornamental fish have been reported in imported ornamentals in retail shops [6,7,8], and during international trade around the world [8,9]. Despite ongoing detection of ISKNV in ornamental fish and the growth of the industry, there is a lack of research on the control and treatment of this virus in ornamental fish. Dwarf gourami, a small ornamental fish popular for its vibrant colors and peaceful temperament, accounts for a high proportion of ISKNV-like megalocytivirus detections in Australia’s quarantine process [8,9]. Therefore, we aimed to develop a new cell line derived from dwarf gourami, an ornamental fish with high susceptibility to RSIV and ISKNV.
Cells are highly valuable for in vitro investigations of cell–virus interactions, virus isolation, diagnosis, and vaccine development because of their fast growth rate and high susceptibility to viruses. More than 783 fish-derived cells have been developed for research since in vitro culture of fish cells started [10]. In addition, cell lines that are highly permissive to viruses play an important role in virus research, such as vaccine development and virus infection mechanisms. Although several cell lines have been developed for RSIV and ISKNV research in recent years [11,12,13,14,15,16,17,18], the lack of cell lines derived from ornamental fish has limited our understanding of the mechanisms of ISKNV infection in ornamental fish despite the increasing importance of this industry. Therefore, the development of ornamental-fish-derived cell lines is important to understand and fill this knowledge gap.
This study aimed to establish and optimize the culture conditions of a new cell line derived from the caudal fin of dwarf gourami and to evaluate its susceptibility to fish pathogenic viruses. Specifically, we investigated the replication ability of two megalocytiviruses, RSIV and ISKNV, in a new cell line and compared it to that in other fish cell lines.

2. Materials and Methods

2.1. Primary Culture and Subculture of Dwarf Gourami Fin Cells

Healthy dwarf gourami (body length: 2.5 cm, body weight: 5.0 g) were obtained from an ornamental fish shop in Busan. Prior to experimentation, dwarf gourami was screened for fish viruses using PCR analysis. The primers used for the PCR are listed in Table 1. The fish was anesthetized with ice and wiped with 70% alcohol. The caudal fin was collected and washed once with phosphate-buffered saline (PBS; Gibco, Grand Island, NY, USA) containing a 3 × antibiotic-antimycotic solution (AA Gibco, Grand Island, NY, USA). The dissected tissues were cut into small pieces (approximately 1 mm2). These tissue fragments were then washed three times with PBS containing 3 × AA. The cells were subsequently dispersed by stirring with a 0.25% trypsin-EDTA solution (Gibco, Grand Island, NY, USA) supplemented with 3 × AA for 45 min. After the digestion, the cells were suspended in 10 mL of complete cell culture medium, Leibovitz’s L-15 medium (L-15 medium; Gibco, Grand Island, NY, USA) supplemented with 20% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) and 2 × AA. The cell suspension was then filtered through a cell strainer (pore size; 100 μm; Falcon, Midland, MI, USA). The filtered cells were centrifuged at 500× g for 10 min at 4 °C, and the supernatant was discarded. This process was repeated three times. Primary cultured cells were transferred into a 25 cm2 culture flask and maintained at 25 °C. The culture medium was replaced daily, and the morphology of the attached cells was observed under a microscope. The primary cultured cells were designated as dwarf gourami fin (DGF) cells.
After 7 days of primary culture, DGF cells attained over 90% confluence in a 25 cm2 cell culture flask, and were digested with 0.25% trypsin-EDTA, subcultured at a ratio of 1:3, and maintained in a complete cell culture medium. The subcultured cells were passaged every five days. Cultured cells were stored every 5–10 passages at −80 °C or −176 °C (liquid nitrogen) using cell banker 1 (Zenoaq, Koriyama, Fukushima, Japan).

2.2. Cell Growth Optimization

To determine the optimal conditions for DGF cell culture, DGF cells (5.0 × 104 cells/well) were seeded in 12-well culture plates. The effects of the cell culture medium, temperature, and FBS concentration on cell growth were investigated. The cells were trypsinized, collected for counting at days 1, 3, 5, 7, and 9, and counted using a C-Chip disposable hemocytometer (INCYTO, Cheonan, Chungcheongnam-do, Republic of Korea). For the evaluation of culture medium, cells were cultured with L-15, Dulbecco’s modified Eagles Media with high glucose (DMEM-H; Welgene, Gyeongsan, Gyeongsanbuk-do, Republic of Korea), and low glucose (DMEM-L; Welgene, Gyeongsan, Gyeongsanbuk-do, Republic of Korea) containing 15% FBS, and were incubated at 25 °C. To find the optimal temperature, DGF cells were cultured with L-15 medium including 15% FBS and incubated at 20, 25, 28, and 30 °C. Lastly, cell growth evaluation was also determined in L-15 medium supplemented with different concentrations of FBS (2%, 5%, 10%, 15%) and incubated at 28 °C. All experiments were performed in triplicate, and statistical analysis was conducted using two-way analysis of variance (ANOVA) using GraphPad Prism (version 9.5.1). Statistical significance was set at p < 0.05.

2.3. Chromosome Analysis

Two days prior to the experiment, DGF cells were subcultured in a 25 cm2 cell culture flask. The cells were washed once with PBS containing 1 × AA, and colchicine solution (Merck, Darmstadt, Germany) was added at a final concentration of 0.5 μg/mL and incubated for 5 h at 25 °C. The cells were then collected by cell scraper and harvested by centrifugation at 500× g for 10 min at 4 °C. The supernatant was discarded and 0.07 M KCl was added and incubated at 25 °C for 25 min. Cells were pre-fixed by Carnoy’s solution (methanol–acetic acid 3:1) for 2 min and centrifuged at 500× g for 10 min at 4 °C. The supernatant was discarded and the cells were re-fixed with chilled Carnoy’s solution at room temperature for 25 min. This process was repeated twice. Then, the cells were resuspended with Carnoy’s solution and stored at −20 °C overnight. The cells were resuspended and dropped onto glass slides, which were precleaned with Carnoy’s solution and chilled. After drying, the cells were stained with 5% Giemsa stain (pH 6.8) for 25 min at room temperature. The staining solution was washed off, and the glass slide was dried. Metaphase spreads of chromosomes were observed under a light microscope (1000× magnification), and 100 metaphase spreads were counted.

2.4. Species Confirmation of DGF Cells

The origin of the DGF cell line was determined through the analysis of mitochondrial cytochrome c oxidase subunit 1 (COI) gene sequence. Genomic DNA was extracted from DGF cells using the Patho Gene-SpinTM DNA/RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Kyonggi-do, Republic of Korea) according to the manufacturer’s protocol. The COI gene was amplified using the following primers: DwGCOI-F:5′-GTC ACA GCA CAC GCT TTT GT-3′ and DwGCOI-R:5′-TGC TGG CTA GTG GAG GGT AT-3′. The PCR conditions were as follows: initial denaturation at 95 °C for 5 min; 30 cycles at 95 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min; and a final extension at 72 °C for 5 min. The PCR products were sequenced by Bionics using an ABI 3730XL DNA Analyzer (Applied Biosystems, Foster, CA, USA), and the nucleotide homology was confirmed using the National Center for Biotechnology Information (NCBI) website and the Basic Local Alignment Search Tool (BLAST) program (http://www.ncbi.nlm.nih.gov/BLAST, accessed on 1 June 2022). A phylogenetic tree was constructed using the maximum likelihood method with 1000 bootstrap values using MEGA software (ver.11.0.10).

2.5. Transfection of GFP Vector

DGF cells were passaged into a confocal dish at a density of 3.0 × 105 cells/mL. After being cultured for 20 h at 28 °C, DGF cells were transfected with pAcGFP1 vector (Takara, Kusatsu-Shi, Chuo-Ku, Japan) using Lipofectamine 3000 reagent and pAcGFP1 vector. A total of 5 µg of pAcGFP1 vector was diluted by 250 µL of Opti-MEM medium (Gibco, Grand Island, NY, USA). The diluted pAcGFP1 vector was mixed with Lipofectamine 3000 and incubated at RT for 15 min. This mixture was then added to a confocal dish. After 48 h, green fluorescence signals were detected using a Ts2 FL (Nikon, Minato-Ku, Kadoma-Shi, Japan).

2.6. Propagation of Viruses

2.6.1. Virus Susceptibility and Viral Multiplication

Various fish viruses were inoculated into DGF cells to evaluate their susceptibility to viruses. The viruses used in this experiment are as follows: red sea bream iridovirus (RSIV, 17RbGs strain; isolated from rock bream; [25]), infectious spleen and kidney necrosis virus (ISKNV, PGIV strain; isolated from pearl gourami; [7]), viral hemorrhagic septicemia virus (VHSV; isolated from olive flounder; [26]), hirame rhabdovirus (HIRRV; ATCC, VR-1391), and spring viraemia of carp virus (SVCV, SVCV-K1 strain; isolated from common crap; [27]); nervous necrosis virus (NNV, RGNNV-type; isolated from sea bass; [26]). The infectivity titer of the virus was measured by TCID50 assay using DGF, epithelioma papulosum cyprini (EPC), and E11 cell lines for megalocytiviruses (RSIV and ISKNV), rhabdoviruses (VHSV, HIRRV, and SVCV), and NNV, respectively.
A viral inoculum with a concentration of 105.8 TCID50/mL was adsorbed onto a monolayer of DGF cells in a 25 cm2 cell culture flask, and incubated for 2 h. The cells were then washed twice with PBS and cultured in 5% heat-inactivated FBS (at 55 °C for 30 min) supplemented L-15 medium (L-155 medium). Incubation temperatures for RSIV-, ISKNV-, and NNV-inoculated DGF cells were 28 °C, while those for other viruses (VHSV, HIRRV, and SVCV) were 20 °C. The cytopathic effect (CPE) was observed daily under a microscope. The supernatants were harvested either upon the appearance of CEP or at 14 days post-inoculation (dpi), followed by three freeze–thaw cycles, and subsequently centrifuged at 500× g for 10 min at 4 °C. Total DNA or RNA was extracted using the Patho Gene-spinTM DNA/RNA Extraction Kit, according to the manufacturer’s instructions. To detect RNA viruses (rhabdovirus and NNV), cDNA was synthesized using the PrimeScriptTM RT Reagent Kit (Takara, Shiga, Japan) following the manufacturer’s instructions. Cultured viruses were identified by PCR. The primers and PCR conditions used in this study are listed in Table 1. After confirming virus susceptibility, DGF-formed monolayers in 24-well culture plates were infected with RSIV, ISKNV, and rhabdoviruses using the same method as mentioned above. RSIV- and ISKNV-inoculated DGF cells were incubated at 28 °C, and rhabdovirus-inoculated DGF cells were incubated at 20 °C for 7 days. At 7 dpi, the supernatants were collected, and each supernatant was quantified using the TCID50 assay: RSIV and ISKNV with DGF cells, and VHSV, HIRRV, and SVCV with EPC cells throughout this study.

2.6.2. Transmission Electron Microscopy

DGF cells infected with megalocytiviruses (RSIV and ISKNV) and rhabdoviruses (VHSV, HIRRV, and SVCV) were collected and pre-fixed in 2.5% glutaraldehyde buffer at 4 °C overnight. The cells were subsequently immobilized in 1% osmium tetroxide, dehydrated using graded ethyl alcohol, and embedded in epoxy resin for sectioning. The sections were double-stained with uranyl acetate and lead citrate and examined under a transmission electron microscope (JEM-1200EXII, JEOL).

2.7. Characteristics of RSIV and ISKNV Replication in DGF Cells

2.7.1. Extracellular Virus Propagated in DGF Cells

DGF cells that had formed a monolayer in a 24-well cell culture plate were infected with RSIV and ISKNV-type viruses using the same method mentioned in Section 2.6.1 and incubated at 28 °C for 11 days. The supernatant of the culture media was collected from each well at 1, 3, 5, 7, 9, and 10 dpi to measure the infectivity titers and genome copies of propagated RSIV and ISKNV in the DGF cells. An infectivity test was performed using the TCID50 assay in DGF cells. The genome copies of RSIV and ISKNV were determined via real-time PCR using the method described by Kim et al., (2021) [20]. Briefly, real-time PCR was performed using a 20 μL (total volume) mixture containing 1 μL of DNA extracted from each virus, 200 nM of each primer (RSIV 1094F/1221R) and probe (RSIV 1177 probe) (Table 1), 10 μL of 2× HS Prime qPCR Premix (Genet Bio, Yuseong-gu, Daejeon, Republic of Korea), 0.4 μL of 50× ROX dye, and 7.1 μL of DEPC-treated water. Amplification was performed using a StepOne Real-time PCR System (Applied Biosystems, Waltham, MA, USA) with cycling conditions of 95 °C for 10 min, followed by 40 cycles of 94 °C for 10 s and 60 °C for 35 s.

2.7.2. Comparison of DGF and Other Cell Lines for Megalocytivirus Propagation

DGF, grunt fin (GF), Pagrus major fin (PMF [18]), and rock bream fin (RBF [28]) cells were used. The cells were grown to form a monolayer in a 24-well cell culture plate and were infected using the method mentioned in Section 2.6.1. and incubated at 28 °C for 7 days. The supernatants were collected at 7 dpi and the infectivity titers and genome copies were measured as described above. The infectious viral titer was analyzed by two-way analysis of variance (ANOVA) using GraphPad Prism (version 9.5.1). Statistical significance was set at p < 0.05.

2.7.3. Viral Gene Expression

To determine the difference in propagation between RSIV and ISKNV, the megalocytivirus viral gene was analyzed using four viral genes: major capsid protein (MCP), adenosine triphosphatase (ATPase), polymerase, and myristoylated membrane protein (MMP) genes. The viral inoculation was performed as described in Section 2.6.1. Total RNA was extracted from virus-inoculated cells at 6, 24, 48, and 72 h using the yesRTM Total RNA Extraction Kit (GenesGen, Busan, Republic of Korea). cDNA synthesis was performed using the PrimeScriptTM RT Reagent Kit, following the manufacturer’s protocol. Real-time PCR reactions were conducted in a total volume of 20 µL, comprising 10 µL of Prime Q-master mix (SYBR GREEN1; Genet Bio), 1 µL of cDNA, 0.5 µL of each primer set, and 8 µL of DEPC-treated water. The primer sets and amplification protocols used in this study are listed in Table 2. Each gene expression analysis was performed in triplicate. The β-actin gene was chosen as the housekeeping gene. Relative mRNA expression was determined using the 2−∆∆CT method.

3. Results

3.1. Development of DGF Cells

The division of primary cells was observed in close proximity to fragments from the dwarf gourami caudal fin on the second day, as shown in Figure 1A. By the seventh day at 25 °C, a monolayer consisting of epithelial-like and fibroblast-like cells had formed (Figure 1B). In the early passages (up to 10 passages), the cells were subcultured at a ratio of 1:3 every 7–9 days and cultured in L-15 medium supplemented with 20% FBS and 2 × AA. After subculturing for more than 10 passages, the concentrations of FBS and AA were reduced to 15% and 1 ×, respectively. As passage time increased (over 40 passages), it was observed that epithelial-like cells were predominant (Figure 1C); the FBS concentration was further reduced to 10%, and 5 mL of MEM non-essential amino acid solution (NEAA; Gibco, Grand Island, NY, USA) and 10 mL of HEPES (Gibco, Grand Island, NY, USA) were added to the cell culture medium. Currently, the cell line has been subcultured for over 100 passages and is designated as the DGF cell line (Figure 1D). Cryopreserved cells were successfully recovered and formed a monolayer in a 25 cm2 cell culture flask within five days. DGF cells at passage 96 were deposited in the Korean Cell Line Research Foundation (KCLRF) under the accession number KCLRF-00522.

3.2. Species Confirmation of DGF Cells

The origin species of the DGF cell line was verified by analyzing its COI gene sequence. The COI gene was amplified from the extracted cellular DNA, and the expected PCR product of 243 bp was obtained. The amplified sequence exhibited 100% identity with the dwarf gourami gene (GenBank accession No. KU569055) and belonged to the same branch (Figure 2), confirming that the DGF cells originated from dwarf gourami.

3.3. Chromosome Number

Chromosomal analysis was performed to investigate the chromosomal characteristics of the DGF cell line. The number of chromosomes in the DGF cells varied from 35 to 49, with a modal number of 2n = 44 (Figure 3).

3.4. Growth Characteristics of DGF Cells

To determine the optimal growth conditions for the newly established DGF cells in vitro, we investigated the culture medium, incubation temperature, and FBS concentration. Successful cell growth was only observed when using L-15 medium containing 15% FBS, whereas DMEM showed no ability to grow DGF cells, causing them to detach from the well plates regardless of glucose concentration (Figure 4A). Therefore, the DGF cells were maintained in L-15 medium containing 15% FBS. The results of the temperature-dependent growth analysis suggest that cells could be maintained at 20 °C without growing, but they could grow at a temperature ranging from 25 °C to 30 °C, with the most efficient growth observed at 30 °C (Figure 4B). In addition, at 28 °C, explosive growth occurred between 5 d and 7 d, and by day 9, there was no significant difference in rate compared to growth at 30 °C. These results suggest that the optimal growth temperature for DGF cells is 28 °C to 30 °C. When cells were maintained and grown in L-15 medium supplemented with 5%, 10%, and 15% FBS (Figure 4C), they showed explosive growth in 15% FBS-containing L-15 medium at 9 d. During the initial 1 to 5 d of culture, there was no significant difference in growth between cells cultured in 10% and 15% FBS-containing L-15 medium.

3.5. DGF Cell Transfection

The pAcGFP1 plasmid was successfully transfected into DGF cells using Lipofectamine 3000 and green fluorescence was observed at 24 h post-transfection. More than 30% of the cells expressed the fluorescence signals, as shown in Figure 5.

3.6. Virus Susceptibility

DGF cells inoculated with megalocytiviruses (RSIV and ISKNV), rhabdoviruses (VHSV, HIRRV, and SVCV), and NNV to test their virus susceptibility exhibited CPE (Figure 6) and specific PCR amplicons were generated. CPE, characterized by cell rounding and enlargement, was observed within 2–3 days of inoculation with RSIV and ISKNV (Figure 6A,B). Although all RSIV-inoculated cells shrunk and detached from the plate within 8–10 dpi, interestingly, no cell shrinkage or detachment was observed in ISKNV-inoculated cells. The effects of rhabdovirus infection (VHSV, HIRRV, and SVCV) on DGF cells were not clearly observed initially. However, after 5–7 dpi, the characteristic CPE of cell lysis was observed in rhabdovirus-inoculated DGF cells (Figure 6C–E). Although CPE appeared to slow down by day 10, no cells adhered to the cell culture plate. In contrast, no cytopathic effect was observed in NNV-inoculated DGF cells, and no specific PCR amplicons were generated from the supernatant. The replication of megalocytiviruses (RSIV and ISKNV) and rhabdoviruses (VHSV, HIRRV, and SVCV) in DGF cells was also confirmed by electron microscopy. Infected DGF cells showed a large number of viral particles with icosahedral nucleocapsids, a characteristic morphology of megalocytiviruses (Figure 7A,B). Additionally, only a small number of bullet-shaped viral particles were observed in the cytoplasm of rhabdovirus-infected DGF cells (Figure 7C–E).

3.7. Viral Multiplication

The amounts of megalocytiviruses (RSIV and ISKNV) and rhabdoviruses (VHSV, HIRRV, and SVCV) released from the infected DGF cells were determined using the TCID50 assay after 7 dpi. As shown in Figure 8, RSIV exhibited the highest multiplication, reaching 109.29TCID50/mL. A similar infectivity titer was observed for ISKNV and HIRRV as 108.48TCID50/mL and 108.44TCID50/mL, respectively. Among the five viruses tested, VHSV and SVCV showed the lowest replication titers of 107.74TCID50/mL and 107.72TCID50/mL, respectively, despite the high propagation concentration. These results suggest that all five viruses can be replicated at high concentrations by DGF cells.

3.8. Propagation of RSIV and ISKNV

The genome copy and infectivity titer of propagated viruses was titered by real-time PCR and TCID50 assay, respectively. As shown in Figure 9, in RSIV-inoculated DGF cells, the genome copy and infectious viral titers in the supernatant were markedly increased between 3 dpi (8.54 × 106 genome copies/mL, 104.39 TCID50/mL) and 5 dpi (5.15 × 108 genome copies/mL, 106.72 TCID50/mL), and steadily increased up to 11 dpi when the RSIV-type release reached a plateau (2.50 × 109 genome copies/mL, 109.08 TCID50/mL). In DGF cells inoculated with ISKNV, the genome copy number was higher than that in RSIV-inoculated cells at 1 dpi, but the infectivity titer was lower. The genome and infectivity titers of RSIV remained higher than those of ISKNV throughout the experiments. The genome copies and infectivity titers in the supernatant of ISKNV-inoculated DGF cells markedly increased between 3 dpi (1.36 × 106 genome copies/mL, 105.5 TCID50/mL) and 5 dpi (3.24 × 108 genome copies/mL, 107.17 TCID50/mL). The genomic copy number was highest at 11 dpi (7.36 × 108 genome copies/mL, 107.83 TCID50/mL). However, the highest infectivity titer of ISKNV was observed at 7 dpi (2.22 × 108 genome copies/mL, 108.06 TCID50/mL).

3.9. Comparison of DGF and Other Cell Lines for RSIV and ISKNV Propagation

Within 7 days of RSIV inoculation, the typical CPE of megalocytivirus, such as cell rounding, shrinking, and detachment, was observed in DGF, RBF, and GF cells, whereas PMF cells showed only cell rounding (Figure 10A). In contrast, weak CPE in the form of rounded cells was observed in ISKNV-inoculated GF cells within 7 days, but no CPE was observed in ISKNV-inoculated PMF cells (Figure 10B). Notably, numerous enlarged rounding-up cells were observed in the RBF and DGF cells after 4 dpi (Figure 10B). Specifically, ISKNV caused cell dropout and monolayer disruption in RBF cells; however, monolayer disruption was not observed within 7 days in ISKNV-inoculated DGF cells. The supernatant of the infected cells was collected at 7 dpi, and both the infectivity and genomic titers were quantified (Figure 10C). For RSIV, the highest titers were found in PMF cells (5.98 × 1010genome copies/mL, 109.44TCID50/mL); these were approximately five times higher than that in DGF cells (1.54 × 1010genome copies/mL, 108.74TCID50/mL), but there was no statistical difference in the infectious viral titer. The highest ISKNV titers were found in DGF cells (5.22 × 109 genome copies/mL, 108.48 TCID50/mL). The titer of ISKNV in RBF cells was approximately 100-fold lower (1.88 × 107genome copies/mL, 106.2 TCID50/mL) than that in DGF cells. GF cells showed the lowest titers for both RSIV (1.20 × 108 genome copies/mL; 107.03 TCID50/mL) and ISKNV (3.27 × 105 genome copies/mL, 104.36 TCID50/mL).

3.10. Viral Gene Expression

The expression of four viral genes, MCP, ATPase, polymerase, and MMP, was analyzed in DGF cells (Figure 11). The MCP gene was expressed later but showed the highest expression at 72 h compared to the other genes, whereas ATPase was expressed rapidly. Other genes showed a steady increase with infection over time. RSIV had higher viral gene expression levels than ISKNV, which aligns with the observation of higher replication of RSIV than ISKNV.

4. Discussion

ISKNV, a species of megalocytivirus, has been consistently detected in various ornamental fish, both in retail shops [6,7,8] and during global trade [8,9], leading to significant economic losses. However, studies on the control and treatment of ISKNV infections in ornamental fish are lacking. Therefore, this study aimed to establish a cell line derived from the dwarf gourami, an ornamental fish species susceptible to RSIV and ISKNV, to facilitate further research on megalocytivirus infections and their control in ornamental fish.
In this study, a new cell line derived from the caudal fin of the dwarf gourami (Trichogaster lalius) was established and characterized for potential applications in fish virus research. DGF cells were subcultured more than 100 times, and sequence analysis of the COI gene confirmed that the DGF cells were derived from dwarf gourami. In addition, the results indicated that the DGF cell line could express exogenous genes via transfection and could be used for the functional verification of genes in vitro. The chromosome number is an important characteristic for the identification of certain species. However, fish cell lines may not always contain the same number of chromosomes as the intact host species. For DGF cells, the modal value of the chromosome number was 2n = 44 (Figure 3), whereas the diploid chromosome number of the intact species was 2n = 46 [30]. The cell lines derived from the Japanese flounder (Paralichthys olivaceus) developed in a previous study did not exhibit the same chromosome number as the complete host species. For example, the Japanese flounder spleen (JFSP) cell line has a chromosome number of 2n = 68 [31], and the flounder fin (FFN) and flounder spleen (FSP) cell lines have 64 and 62 chromosomes, respectively [32], while the Japanese flounder brain (JFB) cell line has 48, which is identical to the Japanese flounder (2n = 48) [33]. The different chromosome numbers between dwarf gourami and DGF cells could be attributed to chromosomal instability resulting from long-term cell culture and processes, such as doubling, cleavage, or regrouping [32].
To optimize the conditions for DGF cell incubation, three culture media were evaluated: DMEM-high glucose, DMEM-low glucose, and L-15. Our results showed that DGF cells were unable to grow in DMEM and even detached from the well plate, regardless of the glucose concentration (Figure 4A). Conversely, L-15 medium, which has been widely used for over 30 years, contains a rich supply of amino acids, including glycine, arginine, histidine, and threonine, and can support the growth of DGF cells as well as other teleost cell lines [10,34]. Moreover, we observed an increased rate of DGF cell growth without any change in cell morphology after passage 40 when NEAA was added to the culture medium and buffered with HEPES. These findings suggested that high amino acid nutrition is essential for DGF cell culture. Interestingly, DGF cells showed growth at temperatures ranging from 25 to 30 °C, and were also able to maintain at 20 °C (Figure 4B). This may be due to the ability of poikilotherms such as fish, reptiles, amphibians, and invertebrates to tolerate a wide range of temperatures [34]. Other studies on ornamental fish cell lines, such as the giant gourami (Osphronemus goramy) spleen (GP) cell line [17], parrot fish brain, spleen, and heart (PFB, PFS, PFH; [35]) cell line, and Aequidens rivulatus brain (ARB8; [16]), have also reported optimal growth at temperatures similar to those observed in our study.
Cell lines are considered ideal tools for studying cell–virus interactions, virus isolation, diagnosis, and vaccine development in vitro. Although the initial purpose of this study was to establish a cell line for the causative agents of RSIVD (RSIV and ISKNV), DGF cells were also susceptible to rhabdoviruses (VHSV, HIRRV, and SVCV). DGF cells inoculated with these viruses showed typical cytopathic effects (Figure 6C–E), and transmission electron microscopy confirmed the presence of intracellular virions (Figure 7C–E). However, it is interesting that DGF cells are susceptible to rhabdoviruses, while, currently, there is no information available on the susceptibility of dwarf gourami to rhabdoviruses. It is known that rhabdoviruses such as VHSV, HIRRV, and SVCV are typically pathogenic at low water temperatures ranging from approximately 3 to 17 °C [36]. Therefore, it is unlikely that infection studies have been conducted on dwarf gourami residing at higher temperatures exceeding 23 °C. Therefore, further assessment of the susceptibility of dwarf gourami to rhabdoviruses may be necessary.
Our findings confirmed that DGF cells are highly susceptible to both RSIV and ISKNV and show a higher replication capacity than other fish cell lines, such as GF, RBF [28], and PMF [18]. CPE was observed in cells that had been inoculated with RSIV or ISKNV (Figure 10A,B). At 7 dpi, cell rounding, enlargement, shrinkage, and detachment were observed in DGF, RBF, and GF cells infected with RSIV. In contrast, PMF cells exhibited strong cell rounding without detachment. Previous studies have shown that PMF cells have a characteristic advantage in persistently replicating at high concentrations of RSIV, without cell detachment [18]. Similarly, DGF did not show disruption of the monolayer, but strong cell rounding was evident after ISKNV infection with high propagation of ISKNV (5.22 × 109 genome copies/mL corresponding to 108.48 TCID50/mL). These results suggested that DGF cells have the potential to support persistent ISKNV infections. CPE is important for virus isolation and infectivity titration, such as TCID50 and plaque assays, because it is a visible manifestation of virus-induced damage to cells. However, GF cells, which are recommended by the World Organization for Animal Health for the isolation of RSIVD, do not form a complete CPE when inoculated with RSIV and require special techniques to maintain a steady viral titer [37]. For these reasons, several fish-derived cell lines were developed in recent decades to facilitate the study of megalocytiviruses. The mandarin fish fry (MFF-1; [11]) cell line has demonstrated efficient replication of ISKNV, reaching high concentrations of approximately 107.6–8.4 TCID50/mL. Similarly, the spotted knifejaw (Oplengathus punctatus; SKF-9; [15]) cell line has been established, although it exhibits a lower propagation capability for ISKNV, with viral concentrations of approximately 106.5 TCID50/mL achieved within 8 dpi, compared to approximately 105.1 TCID50/mL for ISKNV. Compared to various previously developed cell lines, DGF cells propagated high concentrations for both RSIV and ISKNV. Therefore, DGF cells represent a valuable resource for the isolation and characterization of RSIV and ISKNV.
From the comparison of viral genome copies and infectivity titers in different susceptible cells, the highest copy numbers of RSIV and ISKNV were detected in PMF (5.98 × 1010 genome copies/mL, 109.44 TCID50/mL) and DGF cells (5.22 × 109 genome copies/mL, 108.48 TCID50/mL), respectively (Figure 10C). There was no statistically significant difference in the infectivity titers between PMF and DGF cells (108.74 TCID50/mL) during RSIV propagation. Additionally, the difference in infectivity titers between RSIV and ISKNV was insignificant (approximately 1.81 times) in DGF cells, whereas it was significant in RBF, PMF, and GF cells, at approximately 30.44 times, 113,588.02 times, and 469.61 times, respectively. This suggests that the cells exhibit different levels of susceptibility to RSIV and ISKNV. From the expression of viral genes including MCP, ATPase, polymerase, and MMP, the expression levels of all four genes were consistently higher in RSIV-infected cells than in ISKNV-infected cells (Figure 11). MCP and ATPase are considered conserved regions that have both been used for genotyping based on the phylogeny and molecular diagnosis of the megalocytivirus genus [38]. Polymerase also plays an important role in the replication of viral nucleic acids. Finally, MMP is a protein present in the virus envelope that plays a crucial role in the structure of the virus particle and the infection process [39]. Thus, the different expressions of major viral genes indicate differences in the replication and propagation of RSIV and ISKNV in DGF cells, which could be utilized as a useful tool for understanding RSIV and ISKNV infection mechanisms in future studies.

5. Conclusions

In summary, we successfully established a cell line called DGF, which was derived from the caudal fin of dwarf gourami. DGF cells were susceptible to megalocytiviruses (RSIV and ISKNV) and rhabdoviruses (VHSV, HIRRV, and SVCV). The broad susceptibility of DGF cells makes them excellent tools for studying various viruses, particularly those related to viral diseases in ornamental fish. These findings may lead to the development of effective strategies for the diagnosis, prevention, and control of viral diseases in ornamental fish.

Author Contributions

Conceptualization, Y.-J.J. and K.-I.K.; methodology, data curation, formal analysis, writing—original draft preparation, Y.-J.J.; writing—review and editing, K.-I.K.; project administration, K.-I.K.; funding acquisition, K.-I.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2022R1I1A2064371).

Institutional Review Board Statement

Animal experiments were performed with the approval of the Animal Ethics Committee of Pukyong National University (Permission No. PKNUIACUC-2023-17c).

Informed Consent Statement

Not applicable.

Data Availability Statement

All data presented in this study are included in this article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Olivier, K. World trade in ornamental species. In Marine Ornamental Species–Collection, Culture & Conservation; Wiley: Hoboken, NJ, USA, 2003; pp. 49–63. [Google Scholar]
  2. Raja, K.; Aanand, P.; Padmavathy, S.; Sampathkumar, J.S. Present and future market trends of Indian ornamental fish sector. Int. J. Fish. Aquat. Stud. 2019, 7, 6–15. [Google Scholar]
  3. Johan, C.A.C.; Zainathan, S.C. Megalocytiviruses in ornamental fish: A review. Vet. World 2020, 13, 2565. [Google Scholar] [CrossRef] [PubMed]
  4. de Groof, A.; Guelen, L.; Deijs, M.; van der Wal, Y.; Miyata, M.; Ng, K.S.; van Grinsven, L.; Simmelink, B.; Biermann, Y.; Grisez, L.; et al. A Novel Virus Causes Scale Drop Disease in Lates calcarifer. PLoS Pathog. 2015, 11, e1005074. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. WOAH (World Organization for Animal Health). Manual of Diagnostic Tests for Aquatic Animal. Chapter 2.3.7. Red Sea Bream Iridoviral Disease. Available online: https://www.oie.int/fileadmin/Home/eng/Health_standards/aahm/current/2.3.07_RSIVD.pdf (accessed on 13 March 2023).
  6. Go, J.; Lancaster, M.; Deece, K.; Dhungyel, O.; Whittington, R. The molecular epidemiology of iridovirus in Murray cod (Mac-cullochella peelii peelii) and dwarf gourami (Colisa lalia) from distant biogeographical regions suggests a link between trade in ornamental fish and emerging iridoviral diseases. Mol. Cell. 2016, 20, 212–222. [Google Scholar]
  7. Jeong, J.B.; Kim, H.Y.; Jun, L.J.; Lyu, J.H.; Park, N.G.; Kim, J.K.; Do Jeong, H. Outbreaks and risks of infectious spleen and kidney necrosis virus disease in freshwater ornamental fishes. Dis. Aquat. Org. 2008, 78, 209–215. [Google Scholar] [CrossRef] [PubMed]
  8. Rimmer, A.E.; Becker, J.A.; Tweedie, A.; Lintermans, M.; Landos, M.; Stephens, F.; Whittington, R.J. Detection of dwarf gourami iridovirus (Infectious spleen and kidney necrosis virus) in populations of ornamental fish prior to and after importation into Australia, with the first evidence of infection in domestically farmed Platy (Xiphophorus maculatus). Prev. Vet. Med. 2015, 122, 181–194. [Google Scholar] [CrossRef]
  9. Hood, Y.; Sadler, J.; Poldy, J.; Starkey, C.S.; Robinson, A.P. Biosecurity system reforms and the development of a risk-based surveillance and pathway analysis system for ornamental fish imported into Australia. Prev. Vet. Med. 2019, 167, 159–168. [Google Scholar] [CrossRef] [PubMed]
  10. Thangaraj, R.S.; Narendrakumar, L.; Prasannan Geetha, P.; Shanmuganathan, A.R.; Dharmaratnam, A.; Nithianantham, S.R. Comprehensive update on inventory of finfish cell lines developed during the last decade (2010–2020). Rev. Aquac. 2021, 13, 2248–2288. [Google Scholar] [CrossRef]
  11. Dong, C.; Weng, S.; Shi, X.; Xu, X.; Shi, N.; He, J. Development of a mandarin fish Siniperca chuatsi fry cell line suitable for the study of infectious spleen and kidney necrosis virus (ISKNV). Virus Res. 2008, 135, 273–281. [Google Scholar] [CrossRef] [PubMed]
  12. Imajoh, M.; Sugiura, H.; Oshima, S.I. Morphological changes contribute to apoptotic cell death and are affected by caspase-3 and caspase-6 inhibitors during red sea bream iridovirus permissive replication. Virology 2004, 322, 220–230. [Google Scholar] [CrossRef] [Green Version]
  13. Ku, C.C.; Lu, C.H.; Wang, C.S. Establishment and characterization of a fibroblast cell line derived from the dorsal fin of red sea bream, Pagrus major (Temminck & Schlegel). J. Fish Dis. 2010, 33, 187–196. [Google Scholar] [PubMed]
  14. Oh, S.Y.; Nishizawa, T. Establishment of rock bream Oplegnathus fasciatus embryo (RoBE-4) cells with cytolytic infection of red seabream iridovirus (RSIV). J. Virol. Methods 2016, 238, 1–5. [Google Scholar] [CrossRef] [PubMed]
  15. Kawato, Y.; Yamashita, H.; Yuasa, K.; Miwa, S.; Nakajima, K. Development of a highly permissive cell line from spotted knifejaw (Oplegnathus punctatus) for red sea bream iridovirus. Aquaculture 2017, 473, 291–298. [Google Scholar] [CrossRef]
  16. Yeh, S.W.; Cheng, Y.H.; Nan, F.N.; Wen, C.M. Characterization and virus susceptibility of a continuous cell line derived from the brain of Aequidens rivulatus (Günther). J. Fish Dis. 2018, 41, 635–641. [Google Scholar] [CrossRef] [PubMed]
  17. Gardenia, L.; Sukenda, S.; Junior, M.Z.; Lusiastuti, A.; Alimuddin, A. Development of primary cell culture from spleen of giant gourami Osphronemus goramy for propagation of giant gourami iridovirus (GGIV). J. Fish Dis. 2020, 43, 829–838. [Google Scholar] [CrossRef] [PubMed]
  18. Kwon, W.J.; Yoon, M.J.; Jin, J.W.; Kim, K.I.; Kim, Y.C.; Hong, S.; Jeong, J.B.; Do Jeong, H. Development and characterization of megalocytivirus persistently-infected cell cultures for high yield of virus. Tissue Cell 2020, 66, 101387. [Google Scholar] [CrossRef]
  19. Kurita, J.; Nakajima, K.; Hirono, I.; Aoki, T. Polymerase chain reaction (PCR) amplification of DNA of red sea bream iridovirus (RSIV). Fish Pathol. 1998, 33, 17–23. [Google Scholar] [CrossRef] [Green Version]
  20. Kim, G.H.; Kim, M.J.; Choi, H.J.; Koo, M.J.; Kim, M.J.; Min, J.G.; Kim, K.I. Evaluation of a novel TaqMan probe-based real-time PCR assay for detection and quantitation of red sea bream iridovirus. Fish. Aquat. Sci. 2021, 24, 351–359. [Google Scholar] [CrossRef]
  21. Dalla Valle, L.; Zanella, L.; Patarnello, P.; Paolucci, L.; Belvedere, P.; Colombo, L. Development of a sensitive diagnostic assay for fish nervous necrosis virus based on RT-PCR plus nested PCR. J. Fish Dis. 2000, 23, 321–327. [Google Scholar] [CrossRef]
  22. Kim, H.J.; Cuenca, A.; Olesen, N.J. Validation of a novel one-step reverse transcription polymerase chain reaction method for detecting viral haemorrhagic septicaemia virus. Aquaculture 2018, 492, 170–183. [Google Scholar] [CrossRef]
  23. Cho, M.Y.; Lee, D.C.; Kim, J.W.; Cha, S.J.; Park, S.H.; Park, M. Monitoring of diseases in wild marine fish stocks collected in June 2006 by a trawl in the Southern Korean waters. J. Fish Dis. 2006, 19, 215–225. [Google Scholar]
  24. Stone, D.M.; Ahne, W.; Denham, K.L.; Dixon, P.F.; Liu, C.Y.; Sheppard, A.M.; Tayloar, G.R.; Way, K. Nucleotide sequence analysis of the glycoprotein gene of putative spring viraemia of carp virus and pike fry rhabdovirus isolates reveals four genogroups. Dis. Aquat. Org. 2003, 53, 203–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Jeong, M.A.; Jeong, Y.J.; Kim, K.I. Complete genome sequences and pathogenicity analysis of two red sea bream iridoviruses isolated from cultured fish in Korea. Fishes 2021, 6, 82. [Google Scholar] [CrossRef]
  26. Kim, K.I.; Kwon, W.J.; Kim, Y.C.; Kim, M.S.; Hong, S.; Do Jeong, H. Surveillance of aquatic animal viruses in seawater and shellfish in Korea. Aquaculture 2016, 461, 17–24. [Google Scholar] [CrossRef]
  27. Byun, J.H. Detected SVCV in Carp and Its Culturing Characteristics in New Cell Lines. Master’s Thesis, Pukyong National University, Busan, Republic of Korea, 27 February 2015. [Google Scholar]
  28. Jeong, Y.J.; Kim, Y.C.; Min, J.G.; Jeong, M.A.; Kim, K.I. Characterization of rock bream (Oplegnathus fasciatus) fin cells and its susceptibility to different genotypes of megalocytiviruses. Fish Pathol. 2021, 34, 149–159. [Google Scholar]
  29. Jin, J.W.; Kim, Y.K.; Hong, S.; Kim, Y.C.; Kwon, W.J.; Jeong, H.D. Identification and characterization of Megalocytivirus type 3 infection with low mortality in starry flounder, Platichthys stellatus, in Korea. J. World Aquac. Soc. 2018, 49, 229–239. [Google Scholar] [CrossRef]
  30. Supiwong, W.; Tanomtong, A.; Kenthao, A.; Seetapan, K.; Kaewsri, S.; Sanoamuang, L.O. Standardized karyotype of the three-spot gourami, Trichogaster trichopterus (Perciformes, Belontidae) from Thailand by conventional and Ag-NOR staining technique. Nucleus 2010, 53, 103–107. [Google Scholar] [CrossRef]
  31. Yang, Y.; Ren, Y.; Zhang, Y.; Wang, G.; He, Z.; Liu, Y.; Cao, W.; Wang, Y.; Chen, S.; Fu, Y.; et al. A New Cell Line Derived from the Spleen of the Japanese Flounder (Paralichthys olivaceus) and Its Application in Viral Study. Biology 2022, 11, 1697. [Google Scholar] [CrossRef]
  32. Kang, M.S.; Oh, M.J.; Kim, Y.J.; Kawai, K.; Jung, S.J. Establishment and characterization of two new cell lines derived from flounder, Paralichthys olivaceus (Temminck & Schlegel). J. Fish Dis. 2003, 26, 657–665. [Google Scholar]
  33. Sun, Z.; Ren, Y.; Zhang, Y.; Yang, Y.; Wang, G.; He, Z.; Liu, Y.; Cao, W.; Wang, F.; Fu, Y.; et al. Establishment and characterization of a cell line from the brain of the Japanese flounder (Paralichthys olivaceus) and its application in the study of viral infection. Aquaculture 2023, 562, 738825. [Google Scholar] [CrossRef]
  34. Lakra, W.S.; Swaminathan, T.R.; Joy, K.P. Development, characterization, conservation and storage of fish cell lines: A review. Fish Physiol. Biochem. 2011, 37, 1–20. [Google Scholar] [CrossRef] [PubMed]
  35. Rastogi, A.; Yadav, M.K.; Joaquin, M.P.C.; Verma, D.K.; Swaminathan, T.R.; Kushwaha, B.; Paria, A.; Pradhan, P.K.; Sood, N. Development of cell lines from brain, spleen and heart of ornamental blood parrot cichlid and their susceptibility to Tilapia ti-lapinevirus. Aquaculture 2022, 561, 738711. [Google Scholar] [CrossRef]
  36. Kibenge, F.S.; Godoy, M.G. (Eds.) Aquaculture Virology; Academic Press: Cambridge, MA, USA, 2016. [Google Scholar]
  37. Ito, T.; Yoshiura, Y.; Kamaishi, T.; Yoshida, K.; Nakajima, K. Prevalence of red sea bream iridovirus among organs of Japanese amberjack (Seriola quinqueradiata) exposed to cultured red sea bream iridovirus. J. Gen. Virol. 2013, 94, 2094–2101. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Kurita, J.; Nakajima, K. Megalocytiviruses. Viruses 2012, 4, 521–538. [Google Scholar] [CrossRef] [Green Version]
  39. Jung, M.H.; Nikapitiya, C.; Jung, S.J. DNA vaccine encoding myristoylated membrane protein (MMP) of rock bream iridovirus (RBIV) induces protective immunity in rock bream (Oplegnathus fasciatus). Vaccine 2018, 36, 802–810. [Google Scholar] [CrossRef]
Biology 12 00829 g001 550
Figure 1. Morphology of the dwarf gourami fin (DGF) cells. (A–D) Morphology of DGF cells at primary passage on day 2 (A), and on day 7 (B), passage 63 (C), and passage 100 (D). Scale bar = 100 μm.
Figure 1. Morphology of the dwarf gourami fin (DGF) cells. (A–D) Morphology of DGF cells at primary passage on day 2 (A), and on day 7 (B), passage 63 (C), and passage 100 (D). Scale bar = 100 μm.
Biology 12 00829 g001
Biology 12 00829 g002 550
Figure 2. Phylogenic analysis to identify the mitochondrial cytochrome c oxidase subunit I (COI) gene of dwarf gourami fin (DGF) cells. The phylogenetic tree was constructed using the maximum likelihood algorithm with 1000 bootstrap replicates using MEGA software (ver.11.0.10). The COI gene from the DGF cell in this study is highlighted in bold and red.
Figure 2. Phylogenic analysis to identify the mitochondrial cytochrome c oxidase subunit I (COI) gene of dwarf gourami fin (DGF) cells. The phylogenetic tree was constructed using the maximum likelihood algorithm with 1000 bootstrap replicates using MEGA software (ver.11.0.10). The COI gene from the DGF cell in this study is highlighted in bold and red.
Biology 12 00829 g002
Biology 12 00829 g003 550
Figure 3. Chromosome analysis of the dwarf gourami fin (DGF) cells. Chromosome number and distribution of metaphase DGF cells, and representative picture for chromosomes of the DGF cell.
Figure 3. Chromosome analysis of the dwarf gourami fin (DGF) cells. Chromosome number and distribution of metaphase DGF cells, and representative picture for chromosomes of the DGF cell.
Biology 12 00829 g003
Biology 12 00829 g004 550
Figure 4. Growth curves of dwarf gourami fin (DGF) cells. (A) Number of DGF cells in various cell culture media (Leibovitz’s L-15 medium, L-15; Dulbecco’s modified Eagles Media with high glucose, DMEM-H; and Dulbecco’s modified Eagles Media with low glucose, DMEM-L) containing 15% fetal bovine serum (FBS) at 25 °C, (B) number of DGF cells in L-15 medium containing 15% FBS at different temperatures (20 °C, 25 °C, 28 °C, and 30 °C), and (C) number of DGF cells in L-15 medium containing different FBS concentrations (2%, 5%, 10%, and 15%) at 28 °C. The statistical analysis via two-way ANOVA was conducted using GraphPad Prism version 9.5.1. The cell numbers are expressed as the mean ± S.D. The significant differences (p < 0.05). The significant difference (p < 0.05) between groups are indicated by different lowercase letters (a, b, c, and d).
Figure 4. Growth curves of dwarf gourami fin (DGF) cells. (A) Number of DGF cells in various cell culture media (Leibovitz’s L-15 medium, L-15; Dulbecco’s modified Eagles Media with high glucose, DMEM-H; and Dulbecco’s modified Eagles Media with low glucose, DMEM-L) containing 15% fetal bovine serum (FBS) at 25 °C, (B) number of DGF cells in L-15 medium containing 15% FBS at different temperatures (20 °C, 25 °C, 28 °C, and 30 °C), and (C) number of DGF cells in L-15 medium containing different FBS concentrations (2%, 5%, 10%, and 15%) at 28 °C. The statistical analysis via two-way ANOVA was conducted using GraphPad Prism version 9.5.1. The cell numbers are expressed as the mean ± S.D. The significant differences (p < 0.05). The significant difference (p < 0.05) between groups are indicated by different lowercase letters (a, b, c, and d).
Biology 12 00829 g004
Biology 12 00829 g005 550
Figure 5. The expression of the green fluorescence protein gene in DGF cells 24 h after pAcGFP1 vector transfection in a confocal dish. (A) DGF cells under a bright field, (B) expression of GFP in DGF cells under a fluorescence microscope.
Figure 5. The expression of the green fluorescence protein gene in DGF cells 24 h after pAcGFP1 vector transfection in a confocal dish. (A) DGF cells under a bright field, (B) expression of GFP in DGF cells under a fluorescence microscope.
Biology 12 00829 g005
Biology 12 00829 g006 550
Figure 6. Infection of DGF cells with various fish viruses. Cytopathic effect (CPE) was observed under an inverted microscope. CPE of DGF cells infected with red seabream iridovirus (RSIV; (A)), infectious spleen and kidney necrosis virus (ISKNV; (B)), viral hemorrhagic septicemia virus (VHSV; (C)), hirame rhabdovirus (HIRRV; (D)), spring viraemia of carp virus (SVCV; (E)), nervous necrosis virus (NNV; (F)), and control (G). Scale bar = 100 μm.
Figure 6. Infection of DGF cells with various fish viruses. Cytopathic effect (CPE) was observed under an inverted microscope. CPE of DGF cells infected with red seabream iridovirus (RSIV; (A)), infectious spleen and kidney necrosis virus (ISKNV; (B)), viral hemorrhagic septicemia virus (VHSV; (C)), hirame rhabdovirus (HIRRV; (D)), spring viraemia of carp virus (SVCV; (E)), nervous necrosis virus (NNV; (F)), and control (G). Scale bar = 100 μm.
Biology 12 00829 g006
Biology 12 00829 g007 550
Figure 7. Transmission electron micrograph of virus-infected DGF cells under 30,000× magnification. (A) Red sea bream iridovirus (RSIV)-infected DGF cells, (B) infectious spleen and kidney necrosis virus (ISKNV)-infected DGF cells, (C) viral hemorrhagic septicemia virus (VHSV)-infected DGF cells, (D) hirame rhabdovirus (HIRRV)-infected DGF cells, (E) spring viraemia of carp virus (SVCV)-infected DGF cells. Arrows indicate virus particles. Scale bar = 1 μm.
Figure 7. Transmission electron micrograph of virus-infected DGF cells under 30,000× magnification. (A) Red sea bream iridovirus (RSIV)-infected DGF cells, (B) infectious spleen and kidney necrosis virus (ISKNV)-infected DGF cells, (C) viral hemorrhagic septicemia virus (VHSV)-infected DGF cells, (D) hirame rhabdovirus (HIRRV)-infected DGF cells, (E) spring viraemia of carp virus (SVCV)-infected DGF cells. Arrows indicate virus particles. Scale bar = 1 μm.
Biology 12 00829 g007
Biology 12 00829 g008 550
Figure 8. Propagation of megalocytiviruses (red sea bream iridovirus; RSIV and infectious spleen and kidney necrosis virus; ISKNV) and rhabdoviruses (viral hemorrhagic septicemia virus; VHSV, hirame rhabdovirus; HIRRV and spring viraemia of carp virus; SVCV) in DGF cells. Infectious viral titers from DGF cells inoculated with megalocytiviruses (RSIV and ISKNV) and rhabdoviruses (VHSV, HIRRV, and SVCV) at 7 days post-inoculation. The initial virus inoculum concentration was 105.8 TCID50/mL. Megalocytivirus-inoculated DGF cells were incubated at 28 °C and rhabdovirus-inoculated DGF cells were incubated at 20 °C.
Figure 8. Propagation of megalocytiviruses (red sea bream iridovirus; RSIV and infectious spleen and kidney necrosis virus; ISKNV) and rhabdoviruses (viral hemorrhagic septicemia virus; VHSV, hirame rhabdovirus; HIRRV and spring viraemia of carp virus; SVCV) in DGF cells. Infectious viral titers from DGF cells inoculated with megalocytiviruses (RSIV and ISKNV) and rhabdoviruses (VHSV, HIRRV, and SVCV) at 7 days post-inoculation. The initial virus inoculum concentration was 105.8 TCID50/mL. Megalocytivirus-inoculated DGF cells were incubated at 28 °C and rhabdovirus-inoculated DGF cells were incubated at 20 °C.
Biology 12 00829 g008
Biology 12 00829 g009 550
Figure 9. Infectivity titer and genome copy numbers of dwarf gourami fin (DGF) cells inoculated with red sea bream iridovirus (RSIV) and infectious spleen and kidney necrosis virus (ISKNV) at 1, 3, 5, 7, 9, and 11 days post-inoculation (dpi). The initial concentration of inoculum was 105.8 TCID50/mL and virus-inoculated cells were incubated at 28 °C.
Figure 9. Infectivity titer and genome copy numbers of dwarf gourami fin (DGF) cells inoculated with red sea bream iridovirus (RSIV) and infectious spleen and kidney necrosis virus (ISKNV) at 1, 3, 5, 7, 9, and 11 days post-inoculation (dpi). The initial concentration of inoculum was 105.8 TCID50/mL and virus-inoculated cells were incubated at 28 °C.
Biology 12 00829 g009
Biology 12 00829 g010 550
Figure 10. Comparison of cytopathic effect of red sea bream iridovirus- and infectious spleen and kidney necrosis virus-inoculated cells. (A) Cells infected with RSIV, and (B) cells infected with ISKNV. Scale bar = 100 μm. (C) Comparison of infectious viral titer and genome copy number of RSIV- and ISKNV-inoculated cells. The initial inoculum concentration was 105.8 TCID50/mL. Virus-inoculated dwarf gourami fin (DGF) cells and rock bream fin (RBF) cells were incubated at 28 °C, while Pagrus major fin (PMF) cells and grunt fin (GF) cells were incubated at 25 °C for 7 days. The statistical analysis via two-way ANOVA was conducted using GraphPad Prism version 9.5.1. The infectious titer (TCID50 value) was expressed as the mean ± S.D. The significant differences (p < 0.05) among cell lines are indicated by different lowercase letters (a and b), and significant differences between cell lines are indicated by *, p < 0.05.
Figure 10. Comparison of cytopathic effect of red sea bream iridovirus- and infectious spleen and kidney necrosis virus-inoculated cells. (A) Cells infected with RSIV, and (B) cells infected with ISKNV. Scale bar = 100 μm. (C) Comparison of infectious viral titer and genome copy number of RSIV- and ISKNV-inoculated cells. The initial inoculum concentration was 105.8 TCID50/mL. Virus-inoculated dwarf gourami fin (DGF) cells and rock bream fin (RBF) cells were incubated at 28 °C, while Pagrus major fin (PMF) cells and grunt fin (GF) cells were incubated at 25 °C for 7 days. The statistical analysis via two-way ANOVA was conducted using GraphPad Prism version 9.5.1. The infectious titer (TCID50 value) was expressed as the mean ± S.D. The significant differences (p < 0.05) among cell lines are indicated by different lowercase letters (a and b), and significant differences between cell lines are indicated by *, p < 0.05.
Biology 12 00829 g010
Biology 12 00829 g011 550
Figure 11. Comparison of viral gene expression in DGF cells inoculated with RSIV and ISKNV at a concentration of 105.8TCID50/mL. The supernatant was sampled, respectively, at 6, 24, 48, and 72 h post-inoculation, and the viral genes were measured by SYBR green-based real-time PCR. (A) Major capsid protein (MCP), (B) adenosine triphosphatase (ATPase), (C) polymerase, and (D) myristoylated membrane protein genes. The statistical analysis via two-way ANOVA was conducted using GraphPad Prism version 9.5.1. The viral gene expression was expressed as the mean ± S.D. The significant differences (p < 0.05). The significant differences (p < 0.05) among groups are indicated by different lowercase letters (a and b), and significant differences between groups are indicated by ****, p < 0.05 and ns, not significant.
Figure 11. Comparison of viral gene expression in DGF cells inoculated with RSIV and ISKNV at a concentration of 105.8TCID50/mL. The supernatant was sampled, respectively, at 6, 24, 48, and 72 h post-inoculation, and the viral genes were measured by SYBR green-based real-time PCR. (A) Major capsid protein (MCP), (B) adenosine triphosphatase (ATPase), (C) polymerase, and (D) myristoylated membrane protein genes. The statistical analysis via two-way ANOVA was conducted using GraphPad Prism version 9.5.1. The viral gene expression was expressed as the mean ± S.D. The significant differences (p < 0.05). The significant differences (p < 0.05) among groups are indicated by different lowercase letters (a and b), and significant differences between groups are indicated by ****, p < 0.05 and ns, not significant.
Biology 12 00829 g011
Table
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Target VirusObjectPrimersSequenceReference
Megalocytiviruses a
(RSIV and ISKNV)		Detection1-FCTCAAACACTCTGGCTCATC[19]
1-RGCACCAACACATCTCCTATC
Detection and quantificationRSIV 1094FCCAGCATGCCTGAGATGGA[20]
RSIV 1221RGTCCGACACCTTACATGACAGG
RSIV 1177 ProbeFAM-TACGGCCGCCTGTCCAACG-BHQ1
NNV bDetectionVNN1ACACTGGAGTTTGAAATTCA[21]
VNN2GTCTTGTTGAAGTTGTCCCA
VHSV cDetectionVHSV 3FGGGACAGGAATGACCATGAT[22]
VHSV 2RTCTGTCACCTTGATCCCCTCCAG
HIRRV dDetectionHRV-FACCCTGGGATTCCTTGATTC[23]
HRV-RTCTGGTGGGCACGATAAGTT
SVCV eDetectionSVCV F1TCTTGGAGCCAAATAGCTCARRTC[24]
SVCV R2AGATGGTATGGACCCCAATACATHACNCAY
a Megalocytiviruses causing RSIVD, red sea bream iridovirus (RSIV), and infectious nervous necrosis virus (ISKNV), b nervous necrosis virus, c viral hemorrhagic septicemia virus, d hirame rhabdovirus, e spring viraemia of carp virus.
Table
Table 2. SYBR Green-based real-time PCR primers used in RSIV and ISKNV gene expression experiments.
Table 2. SYBR Green-based real-time PCR primers used in RSIV and ISKNV gene expression experiments.
Target GenePrimer NamePrimer Sequence (5′ to 3′)ConditionProduct Size (bp)Reference
MCPqM1FGGCGACTACCTCATTAATGT95 °C, 10 min
(95 °C, 10 s, 60 °C, 1 min) × 40 cycles		141[29]
qM1RCCACCAGGTCGTTAAATGA
ATPaseqATPase1FAACAAGCCAGACATGTGTG95 °C, 10 min,
(95 °C, 15 sec, 60 °C, 1 min) × 40 cycles		165In this study
qATPase1RTGTAGTAGCGCACCATGTC
PolymeraseqPoly1FGTTTATGGCGGGGGCAAT136
qPoly1RTGGCCCAGCTGTATGTAGC
Ring finger proteinqRFP1FTGTGCAGAGTGCCGTTCAA161
qRFP1RTGTGTGCCTGTACACACAGT
Myristoylated membrane proteinqMyristmem1FTGCGGGACTGGGAGTTG146
qMyristmem1RTGCCATAAAAGGCGGCC
β-actinqDwBactin_FTAGCCACGCTCTGTCAGGAT152
qDwBactin_RACCACCGGTATTGTCATGGA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jeong, Y.-J.; Kim, K.-I. A New Cell Line Derived from the Caudal Fin of the Dwarf Gourami (Trichogaster lalius) and Its Susceptibility to Fish Viruses. Biology 2023, 12, 829. https://doi.org/10.3390/biology12060829

AMA Style

Jeong Y-J, Kim K-I. A New Cell Line Derived from the Caudal Fin of the Dwarf Gourami (Trichogaster lalius) and Its Susceptibility to Fish Viruses. Biology. 2023; 12(6):829. https://doi.org/10.3390/biology12060829

Chicago/Turabian Style

Jeong, Ye-Jin, and Kwang-Il Kim. 2023. "A New Cell Line Derived from the Caudal Fin of the Dwarf Gourami (Trichogaster lalius) and Its Susceptibility to Fish Viruses" Biology 12, no. 6: 829. https://doi.org/10.3390/biology12060829

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop