Avian Coronavirus Infectious Bronchitis Virus Activates Mitochondria-Mediated Apoptosis Pathway and Affects Viral Replication by Inducing Reactive Oxygen Species Production in Chicken HD11 Cells
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Virus Infection
2.2. Fluorescence Microscopy Observation of ROS Generation
2.3. ROS Determination by Flow Cytometry
2.4. Measurement of Mitochondrial Transmembrane Potential (Δψm)
2.5. Quantitative Real-Time PCR (qRT-PCR) Analysis
2.6. Caspase-3 Activity Assay
2.7. Apoptotic Rate Measurement
2.8. Plasmid Construction and Cell Transfection
2.9. Indirect Immunofluorescence Assay (IFA)
2.10. Statistical Analysis
3. Results
3.1. The Increase in ROS Was Induced by IBV Infection
3.2. Mitochondrial Membrane Potential Was Decreased by IBV Infection
3.3. The Function of ROS in Virus-Induced Intrinsic Apoptosis
3.4. Interaction between Virus Replication and ROS Accumulation
3.5. Expression of IBV-N Gene Induces ROS Accumulation and Apoptosis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Brierley, I.; Boursnell, M.E.; Binns, M.M.; Bilimoria, B.; Blok, V.C.; Brown, T.D.; Inglis, S.C. An efficient ribosomal frame-shifting signal in the polymerase-encoding region of the coronavirus IBV. EMBO J. 1987, 6, 3779–3785. [Google Scholar] [CrossRef] [PubMed]
- Cavanagh, D. Coronavirus avian infectious bronchitis virus. Vet. Res. 2007, 38, 281–297. [Google Scholar] [CrossRef] [PubMed]
- Cook, J.K.; Jackwood, M.; Jones, R.C. The long view: 40 years of infectious bronchitis research. Avian Pathol. 2012, 41, 239–250. [Google Scholar] [CrossRef] [PubMed]
- Jordan, B. Vaccination against infectious bronchitis virus: A continuous challenge. Vet. Microbiol. 2017, 206, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Legnardi, M.; Tucciarone, C.M.; Franzo, G.; Cecchinato, M. Infectious Bronchitis Virus Evolution, Diagnosis and Control. Vet. Sci. 2020, 7, 79. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Guo, M.; Zhao, J.; Wu, Y. Avian Infectious Bronchitis in China: Epidemiology, Vaccination, and Control. Avian Dis. 2021, 65, 652–656. [Google Scholar] [CrossRef] [PubMed]
- Tay, F.P.; Huang, M.; Wang, L.; Yamada, Y.; Liu, D.X. Characterization of cellular furin content as a potential factor determining the susceptibility of cultured human and animal cells to coronavirus infectious bronchitis virus infection. Virology 2012, 433, 421–430. [Google Scholar] [CrossRef]
- Han, X.; Tian, Y.; Guan, R.; Gao, W.; Yang, X.; Zhou, L.; Wang, H. Infectious Bronchitis Virus Infection Induces Apoptosis during Replication in Chicken Macrophage HD11 Cells. Viruses 2017, 9, 198. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Li, J.; Wang, P.-H.; Yang, N.; Huang, J.; Ou, J.; Xu, T.; Zhao, X.; Liu, T.; Huang, X.; et al. SARS-CoV-2 spike promotes inflammation and apoptosis through autophagy by ROS-suppressed PI3K/AKT/mTOR signaling. Biochim. Biophys. Acta Mol. Basis Dis. 2021, 1867, 166260. [Google Scholar] [CrossRef]
- Wang, L.; Cao, Z.; Wang, Z.; Guo, J.; Wen, J. Reactive oxygen species associated immunoregulation post influenza virus infection. Front. Immunol. 2022, 13, 927593. [Google Scholar] [CrossRef]
- Sun, P.; Jin, J.; Wang, L.; Wang, J.; Zhou, H.; Zhang, Q.; Xu, X. Porcine epidemic diarrhea virus infections induce autophagy in Vero cells via ROS-dependent endoplasmic reticulum stress through PERK and IRE1 pathways. Vet. Microbiol. 2021, 253, 108959. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Liu, X.; Gao, Y.; Zhou, R.; Wei, M.; Dong, J.; Yan, H.; Zhao, Y. Hepatitis B Virus Inhibits Neutrophil Extracellular Trap Release by Modulating Reactive Oxygen Species Production and Autophagy. J. Immunol. 2019, 202, 805–815. [Google Scholar] [CrossRef] [PubMed]
- Circu, M.L.; Aw, T.Y. Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med. 2010, 48, 749–762. [Google Scholar] [CrossRef] [PubMed]
- Forrester, S.J.; Kikuchi, D.S.; Hernandes, M.S.; Xu, Q.; Griendling, K.K. Reactive Oxygen Species in Metabolic and Inflammatory Signaling. Circ. Res. 2018, 122, 877–902. [Google Scholar] [CrossRef]
- Su, L.J.; Zhang, J.H.; Gomez, H.; Murugan, R.; Hong, X.; Xu, D.; Jiang, F.; Peng, Z.-Y. Reactive Oxygen Species-Induced Lipid Peroxidation in Apoptosis, Autophagy, and Ferroptosis. Oxid Med. Cell. Longev. 2019, 2019, 5080843. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Xu, Y.; Zhang, Q.; Yang, F.; Yin, Z.; Wang, L.; Li, Q. Porcine epidemic diarrhea virus infections induce apoptosis in Vero cells via a reactive oxygen species (ROS)/p53, but not p38 MAPK and SAPK/JNK signalling pathways. Vet. Microbiol. 2019, 232, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Zhou, X.; Dong, W.; Zhang, Y.; Du, J.; Zhou, X.; Fang, W.; Wang, X.; Song, H. Porcine circovirus type 2 induces CHOP-ERO1α-ROS-mediated apoptosis in PK-15 cells. Vet. Microbiol. 2022, 273, 109548. [Google Scholar] [CrossRef] [PubMed]
- Foo, J.; Bellot, G.; Pervaiz, S.; Alonso, S. Mitochondria-mediated oxidative stress during viral infection. Trends Microbiol. 2022, 30, 679–692. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Xiang, H.; Bai, X.; Fei, N.; Huang, Y.; Song, X.; Zhang, H.; Zhang, L.; Tong, D. Porcine parvovirus infection activates mitochondria-mediated apoptotic signaling pathway by inducing ROS accumulation. Virol. J. 2016, 13, 26. [Google Scholar] [CrossRef]
- Ding, L.; Zhao, X.; Huang, Y.; Du, Q.; Dong, F.; Zhang, H.; Song, X.; Zhang, W.; Tong, D. Regulation of ROS in transmissible gastroenteritis virus-activated apoptotic signaling. Biochem. Biophys. Res. Commun. 2013, 442, 33–37. [Google Scholar] [CrossRef]
- Eruslanov, E.; Kusmartsev, S. Identification of ROS using oxidized DCFDA and flow-cytometry. Methods Mol. Biol. 2010, 594, 57–72. [Google Scholar] [CrossRef] [PubMed]
- Yuan, S.; Wu, B.; Yu, Z.; Fang, J.; Liang, N.; Zhou, M.; Huang, C.; Peng, X. The mitochondrial and endoplasmic reticulum pathways involved in the apoptosis of bursa of Fabricius cells in broilers exposed to dietary aflatoxin B1. Oncotarget 2016, 7, 65295–65306. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Jiang, W.; Liu, Z.; Liu, S.; Liang, X. Virus Infection and Death Receptor-Mediated Apoptosis. Viruses 2017, 9, 316. [Google Scholar] [CrossRef] [PubMed]
- Koyama, A.H.; Irie, H.; Fukumori, T.; Hata, S.; Iida, S.; Akari, H.; Adachi, A. Role of virus-induced apoptosis in a host defense mechanism against virus infection. J. Med. Investig. 1998, 45, 37–45. [Google Scholar]
- Kvansakul, M. Viral Infection and Apoptosis. Viruses 2017, 9, 356. [Google Scholar] [CrossRef] [PubMed]
- Zsak, L.; Neilan, J.G. Regulation of apoptosis in African swine fever virus-infected macrophages. Sci. World J. 2002, 2, 1186–1195. [Google Scholar] [CrossRef]
- Kalantari, A.; Farashi Bonab, S.; Keyvanfar, H.; Mortazavi, P. Evaluation of Apoptosis Induction by Newcastle Disease Virus LaSota Strain in Human Breast Carcinoma Cells. Arch. Razi Inst. 2020, 75, 367–376. [Google Scholar] [CrossRef] [PubMed]
- Simon, H.U.; Haj-Yehia, A.; Levi-Schaffer, F. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 2000, 5, 415–418. [Google Scholar] [CrossRef]
- Marsden, V.S.; O’Connor, L.; O’Reilly, L.A.; Silke, J.; Metcalf, D.; Ekert, P.G.; Huang, D.C.S.; Cecconi, F.; Kuida, K.; Tomaselli, K.J.; et al. Apoptosis initiated by Bcl-2-regulated caspase activation independently of the cytochrome c/Apaf-1/caspase-9 apoptosome. Nature 2002, 419, 634–637. [Google Scholar] [CrossRef]
- Neumann, S.; El Maadidi, S.; Faletti, L.; Haun, F.; Labib, S.; Schejtman, A.; Maurer, U.; Borner, C. How do viruses control mitochondria-mediated apoptosis? Virus Res. 2015, 209, 45–55. [Google Scholar] [CrossRef] [PubMed]
- Sinha, K.; Das, J.; Pal, P.B.; Sil, P.C. Oxidative stress: The mitochondria-dependent and mitochondria-independent pathways of apoptosis. Arch. Toxicol. 2013, 87, 1157–1180. [Google Scholar] [CrossRef] [PubMed]
- Yang, T.C.; Lai, C.C.; Shiu, S.L.; Chuang, P.-H.; Tzou, B.-C.; Lin, Y.-Y.; Tsai, F.-J.; Lin, C.-W. Japanese encephalitis virus down-regulates thioredoxin and induces ROS-mediated ASK1-ERK/p38 MAPK activation in human promonocyte cells. Microbes Infect. 2010, 12, 643–651. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.M.; Kleiboeker, S.B. Porcine reproductive and respiratory syndrome virus induces apoptosis through a mitochondria-mediated pathway. Virology 2007, 365, 419–434. [Google Scholar] [CrossRef] [PubMed]
- Narayanan, A.; Amaya, M.; Voss, K.; Chung, M.; Benedict, A.; Sampey, G.; Kehn-Hall, K.; Luchini, A.; Liotta, L.; Bailey, C.; et al. Reactive oxygen species activate NFκB (p65) and p53 and induce apoptosis in RVFV infected liver cells. Virology 2014, 449, 270–286. [Google Scholar] [CrossRef] [PubMed]
- Reshi, M.L.; Su, Y.C.; Hong, J.R. RNA Viruses: ROS-Mediated Cell Death. Int. J. Cell Biol. 2014, 2014, 467452. [Google Scholar] [CrossRef] [PubMed]
- Romeo, M.A.; Santarelli, R.; Gilardini Montani, M.S.; Gonnella, R.; Benedetti, R.; Faggioni, A.; Cirone, M. Viral Infection and Autophagy Dysregulation: The Case of HHV-6, EBV and KSHV. Cells 2020, 9, 2624. [Google Scholar] [CrossRef] [PubMed]
- Lin, R.J.; Liao, C.L.; Lin, Y.L. Replication-incompetent virions of Japanese encephalitis virus trigger neuronal cell death by oxidative stress in a culture system. J. Gen. Virol. 2004, 85, 521–533. [Google Scholar] [CrossRef]
- Treeza, M.M.; Augustine, S.; Mathew, A.A.; Kanthlal, S.K.; Panonummal, R. Targeting Viral ORF3a Protein: A New Approach to Mitigate COVID-19 Induced Immune Cell Apoptosis and Associated Respiratory Complications. Adv. Pharm. Bull. 2023, 13, 678–687. [Google Scholar] [CrossRef]
- Chen, Y.; Zhu, S.; Liao, T.; Wang, C.; Han, J.; Yang, Z.; Lu, X.; Hu, Z.; Hu, J.; Wang, X.; et al. The HN protein of Newcastle disease virus induces cell apoptosis through the induction of lysosomal membrane permeabilization. PLoS Pathog. 2024, 20, e1011981. [Google Scholar] [CrossRef]
- Huang, M.; Liu, Y.; Xia, Y.; Wang, J.; Zheng, X.; Cao, Y. Infectious bronchitis virus nucleocapsid protein suppressed type I interferon production by interfering with the binding of MDA5-dsRNA and interacting with LGP2. Vet. Microbiol. 2023, 284, 109798. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
Bax | GGTGACAGGGATCGTCACAG | TAGGCCAGGAACAGGGTGAA |
Bcl-2 | TGTTTCTCAAACCAGACACCAA | CAGTAGGCACCTGTGAGATCG |
IBV-N | AAGCTTATGGCAAGCGGTAAAGCAGCT | GAATTCTCAAAGTTCATTCTCTCCTAGAGCTGC |
β-actin | TGCTGTGTTCCCATCTATCG | TTGGTGACAATACCGTGTTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, X.; Huang, Y.; Hao, J. Avian Coronavirus Infectious Bronchitis Virus Activates Mitochondria-Mediated Apoptosis Pathway and Affects Viral Replication by Inducing Reactive Oxygen Species Production in Chicken HD11 Cells. Biology 2024, 13, 491. https://doi.org/10.3390/biology13070491
Han X, Huang Y, Hao J. Avian Coronavirus Infectious Bronchitis Virus Activates Mitochondria-Mediated Apoptosis Pathway and Affects Viral Replication by Inducing Reactive Oxygen Species Production in Chicken HD11 Cells. Biology. 2024; 13(7):491. https://doi.org/10.3390/biology13070491
Chicago/Turabian StyleHan, Xiaoxiao, Yuan Huang, and Junli Hao. 2024. "Avian Coronavirus Infectious Bronchitis Virus Activates Mitochondria-Mediated Apoptosis Pathway and Affects Viral Replication by Inducing Reactive Oxygen Species Production in Chicken HD11 Cells" Biology 13, no. 7: 491. https://doi.org/10.3390/biology13070491