Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis
Abstract
:1. Introduction
2. Material and Methods
2.1. (S-NASP) Semi Nested-Allele Specific PCR Method
2.2. Electrophoresis
2.3. Sequencing
3. Results
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
CDS | Coding Sequence |
MTB | Mycobacterium tuberculosis |
RFLP | Restriction fragment of length polymorphism |
sNASP | Semi-nested allele specific PCR |
References
- World Health Organization (WHO). Global Tuberculosis Report 2013. WHO Library Cataloguing-In-Publication Data; NLM Classification: WF 300; WHO: Geneva, Switzerland, 2013; ISBN 978 92 4 156465 6. [Google Scholar]
- Pourhajibagher, M.; Nasrollahi, M. Drug Resistance in Mycobacterium tuberculosis Isolates to Isoniazid and Rifampin. J. Babol. Univ. Med. Sci. 2012, 14, 66–72. [Google Scholar]
- Palomino, J.C.; Martin, A. Drug Resistance Mechanisms in Mycobacterium tuberculosis. Antibiotics 2014, 3, 317–340. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Heym, B.; Allen, B.; Young, D.; Cole, S. The Catalase. Peroxidase gene and Isoniazid Resistance of Mycobacterial tuberculosis. Nature 1992, 358, 591–593. [Google Scholar] [CrossRef] [PubMed]
- Walsh, P.S.; Metzger, D.A.; Higuchi, R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 1991, 4, 506–513. [Google Scholar] [CrossRef]
- Portugal, I.; Barreiro, L.; Moniz-Pereira, J.; Brum, A.L. pncA mutations In Pyrazinamide-Resistant Mycobacterium tuberculosis Isolates in Portugal. Antimicrob. Agents Chemother. 2004, 7, 2736–2738. [Google Scholar] [CrossRef] [PubMed]
- Perdigão, J.; Macedo, R.; João, I.; Fernandes, E.; Brum, L.; Portugal, I. Multidrug-Resistant Tuberculosis in Lisbon, Portugal: A Molecular Epidemiological Perspective. Microb. Drug Resist. 2008, 14, 133–143. [Google Scholar] [CrossRef] [PubMed]
- Tracevska, T.; Nodieva, A.; Skenders, G. Spectrum of pncA mutations in Multidrug-Resistant Mycobacterium tuberculosis Isolates Obtained In Lativia. Antimicrob. Agents Chemother. 2004, 48, 3209–3210. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.W.; Lee, J.M.; Jung, K. Characterization of pncA Mutations of Pyrazinamide-Resistant Mycobacterium tuberculosis in Korea. J. Korean Med. Sci. 2001, 16, 537–543. [Google Scholar] [CrossRef] [PubMed]
- McCammon, M.T.; Gillette, J.S.; Thomas, D.P.; Ramaswamy, S.V.; Graviss, E.A.; Kreiswirth, B.N.; Vijg, J.; Quitugua, T.N. Detection of rpoB mutations associated with rifampin resistance in Mycobacterium tuberculosis using denaturing gradient gel electrophoresis. Antimicrob. Agents Chemother. 2005, 49, 2200–2209. [Google Scholar] [CrossRef] [PubMed]
- Marttila, H.J.; Marjamaki, M.; Vyshnevskaya, E.; Vyshnevskiy, B.I.; Otten, T.F.; Vasilyef, A.V.; Viljanen, M.K. pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis isolates from northwestern Russia. Antimicrob. Agents Chemother. 1999, 43, 1764–1766. [Google Scholar] [PubMed]
- Somoskovi, A.; Wade, M.M.; Sun, Z.; Zhang, Y. Iron enhances the antituberculous activity of pyrazinamide. J. Antimicrob. Hemother. 2004, 53, 192–196. [Google Scholar] [CrossRef] [PubMed]
- Sheen, P.; Ferrer, P.; Gilman, R.H.; López-Llano, J.; Fuentes, P.; Valencia, E.; Zimic, M.J. Effect of pyrazinamidase activity on pyrazinamide resistance in Mycobacterium tuberculosis. Tuberculosis 2009, 89, 109–113. [Google Scholar] [CrossRef] [PubMed]
- Barco, P.; Cardoso, R.F.; Hirata, R.D.C.; Leite, C.Q.F.; Pandolfi, J.R.; Sato, D.N.; Shikama, M.L.; de Melo, F.F.z.; Mamizuka, E.M.; Campanerut, P.A.Z.; et al. pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis clinical isolates from the southeast region of Brazil. J. Antimicrob. Chemother. 2006, 58, 930–935. [Google Scholar] [CrossRef] [PubMed]
- Louw, G.E.; Warren, R.M.; Donald, P.R.; Murray, M.B.; Bosman, M.; van Helden, P.D.; Young, D.B.; Victor, T.C. Frequency and implications of pyrazinamide resistance in managing previously treated tuberculosis patients. Int. J. Tuberc. Lung Dis. 2006, 10, 802–807. [Google Scholar] [PubMed]
- Sekiguchi, J.I.; Nakamura, T.; Miyoshi-Akiyama, T.; Kirikae, F.; Kobayashi, I.; Augustynowicz-Kopeć, E.; Zwolska, Z.; Morita, K.; Suetake, T.; Yoshida, H.; et al. Development and evaluation of a line probe assay for rapid identification of pncA mutations in pyrazinamide-resistant Mycobacterium tuberculosis strains. J. Clin. Microbiol. 2007, 45, 2802–2807. [Google Scholar] [CrossRef] [PubMed]
- Hirano, K.; Takahashi, M.; Kazumi, Y.; Fukazawa, Y.; Abe, C. Mutation in pncA is a major mechanism of pyrazinamide resistance in Mycobacterium tuberculosis. Tuberc. Lung Dis. 1998, 78, 117–122. [Google Scholar] [CrossRef]
- Arjomandzadegan, M.; Owlia, P.; Ranjbar, R.; Farazi, A.; Masume, S.; Maryam, S.; Ghaznavi-Rad, E.; Surkova, L.; Titov, L. Prevalence of mutations at codon 463 of katG gene in MDR and XDR clinical isolates of Mycobacterium tuberculosis in Belarus and application of the method in rapid diagnosis. Acta Microbiol. Immunol. Hung. 2011, 58, 51–63. [Google Scholar] [CrossRef] [PubMed]
- Hosseini, H.; Fooladi, A.A.I.; Arjomandzadegan, M.; Emami, N.; Bornasi, H. Genetics study and transmission electron microscopy of pili in susceptible and resistant clinical isolates of Mycobacterium tuberculosis. Asian Pac. J. Trop. Biomed. 2014, 7, S199–S203. [Google Scholar]
- Arjomandzadegan, M.; Titov, L.P.; Surkova, L.K.; Farnia, P.; Sheikholeslami, F.; Owlia, P.; Eshghinejad, A.; Farazi, A.A.; Eshrati, M.; Kahbazi, M.; et al. Determination of principal genotypic groups among susceptible, MDR and XDR clinical isolates of Mycobacterium tuberculosis in Belarus and Iran. Tuberk. Toraks 2012, 60, 153–159. [Google Scholar] [CrossRef] [PubMed]
- Khrustalev, V.V.; Arjomandzadegan, M.; Barkovsky, E.V.; Titov, L.P. Low rates of synonymous mutations in sequences of Mycobacterium tuberculosis GyrA and KatG genes. Tuberculosis 2012, 92, 333–344. [Google Scholar] [CrossRef] [PubMed]
Sequence of Primers (5′-3′) | PCR Product Size (bp) | |
---|---|---|
Forward (pnc-8) | GGTTGGGTGGCCGCCGGTCAG | 744 bp |
Reverse (pnc-11) | GCTTTGCGGCGAGCGCTCCA | |
T359C-pnc | AGCCAATTCAGCAGTGGCGTG | 418 bp |
T374G-pnc | ACGCCGTGCCGCAGCC | 433 bp |
Nucleotide Alteration | Position | Phenotype | Sample ID |
---|---|---|---|
G→A | 3 | R | 725 |
C→T | 161 | R | 571 |
C→T | 195 | R | 24n |
T→G | 202 | R | 734 |
A→G | 212 | R | 526 |
T→C | 214 | R | 556 |
A→C | 226 | R | 27n |
T→G | 410 | R | 1228 |
T→C | 515 | R | 535 |
none | - | S | 4e |
none | - | S | 36e |
none | - | S | 11e |
none | - | S | 16e |
none | - | S | 1n |
none | - | S | 2n |
none | - | S | 3n |
none | - | S | 5n |
none | - | S | 6n |
none | - | S | 7n |
none | - | S | 9n |
none | - | S | 10n |
none | - | S | 11n |
none | - | S | 13n |
none | - | S | 15n |
none | - | S | 16n |
none | - | S | 19n |
none | - | S | 21n |
none | - | S | 22n |
none | - | S | 23n |
none | - | S | 24n |
none | - | S | 25n |
none | - | S | 26n |
none | - | S | 29n |
Activity of Pyrasinamidase (P: Positive) (N: Negative) | Nucleotide Alteration | Position | Number of Bacterial Samples | Phenotype (R: Resistant, S: Sensitive) | Author | Reference |
---|---|---|---|---|---|---|
N | G(3)T | 3 | 1 | R | Lee K.W. | [9] |
N | A(146)C | 146 | 1 | R | Lee K.W. | [9] |
? | A(146)C | 146 | 1 | R | McCammon M.T. | [10] |
N | A(146)T | 146 | 1 | R | Marttila H. | [11] |
N | R A(146)G | 146 | 1 | R | Marttila H. | [11] |
? | Del(146)delA | 146 | R | Somoskovi A. | [12] | |
del(161)delC | 161 | 1 | R | Lee K.W. | [9] | |
N | C(161)A | 161 | 1 | R | Barco P. | [14] |
? | C(161)T | 161 | 1 | R | Louw G.E. | [15] |
N | C(161)T | 161 | 6 | R | Sekiguchi J.I. | [16] |
? | R C(161)T | 161 | 1 | R | McCammon M.T. | [10] |
? | C(195)T | 195 | 2 | S | Somoskovi A. | [12] |
? | C(195)T | 195 | 1 | S | McCammon M.T. | [10] |
? | T(202)C | 202 | 1 | R | Somoskovi A. | [12] |
? | T(202)C | 202 | 3 | R | Louw G.E. | [15] |
N | T(202)C | 202 | 2 | R | Lee K.W. | [9] |
? | T(202)G | 202 | 7 | R | Louw G.E. | [15] |
N | T(202)G | 202 | 1 | R | Lee K.W. | [9] |
? | A(212)G | 212 | 1 | R | Somoskovi A. | [12] |
? | A(212)G | 212 | 3 | R | Louw G.E. | [15] |
N | T(214)C | 214 | 1 | R | Hirano K. | [17] |
N | A(410)C | 410 | 1 | R | Lee K.W. | [9] |
? | T(515)C | 515 | 3 | R | Somoskovi A. | [12] |
N | T(515)C | 515 | 1 | R | Lee K.W. | [9] |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kahbazi, M.; Sarmadian, H.; Ahmadi, A.; Didgar, F.; Sadrnia, M.; Poolad, T.; Arjomandzadegan, M. Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis. Sci. Pharm. 2018, 86, 15. https://doi.org/10.3390/scipharm86020015
Kahbazi M, Sarmadian H, Ahmadi A, Didgar F, Sadrnia M, Poolad T, Arjomandzadegan M. Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis. Scientia Pharmaceutica. 2018; 86(2):15. https://doi.org/10.3390/scipharm86020015
Chicago/Turabian StyleKahbazi, Manijeh, Hossein Sarmadian, Azam Ahmadi, Farshideh Didgar, Maryam Sadrnia, Toktam Poolad, and Mohammad Arjomandzadegan. 2018. "Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis" Scientia Pharmaceutica 86, no. 2: 15. https://doi.org/10.3390/scipharm86020015