Effect of Soil and Root Extracts on the Innate Immune Response of American Ginseng (Panax quinquefolius) to Root Rot Caused by Ilyonectria mors-panacis
Abstract
:1. Introduction
2. Results
2.1. Effects of the Extracts on Root Rot Disease
2.2. Composition of Extracts
2.3. Effects of Extracts on Gene Expression
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Biological Materials
5.2. Root and Soil Extraction
5.3. Detached Root Assay
5.4. RNA Extraction
5.5. Primer Design Used in Relative RT-PCR
5.6. Semiquantitiive RT-PCR
5.7. HPLC-MS Analysis
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Westerveld, S.M.; Shi, F. The history, etiology, and management of ginseng replant disease: A Canadian perspective in review. Can. J. Plant Sci. 2021, 101, 886–901. [Google Scholar] [CrossRef]
- Reeleder, R.D.; Roy, R.; Capel, B. Seed and root rots of ginseng (Panax quinquefolius L.) caused by Cylindrocarpon destructans and Fusarium spp. J. Ginseng Res. 2002, 26, 151–158. [Google Scholar]
- Cabral, A.; Groenewald, J.Z.; Rego, C.; Oliveira, H.; Crous, P.W. Cylindrocarpon root rot: Multi-gene analysis reveals novel species within the Ilyonectria radicicola species complex. Mycol. Prog. 2012, 11, 655–688. [Google Scholar] [CrossRef] [Green Version]
- Seifert, K.A.; McMullen, C.R.; Yee, D.; Reeleder, R.D.; Dobinson, K.F. Molecular differentiation and detection of ginseng-adapted isolates of the root rot fungus Cylindrocarpon destructans. Phytopathology 2003, 93, 1533–1542. [Google Scholar] [CrossRef] [Green Version]
- Bischoff Nunes, I.; Goodwin, P.H. Interaction of ginseng with Ilyonectria root rot pathogens. Plants 2022, 11, 2152. [Google Scholar] [CrossRef] [PubMed]
- Bi, A.B.; Yang, J.X.; Gao, W.W. Autotoxicity of phenolic compounds from the soil of American ginseng (Panax quinquefolium L.). Allelopath. J. 2010, 2, 115–121. [Google Scholar]
- Xiang, W.; Chen, J.; Zhang, F.; Huang, R.; Li, L. Autotoxicity in Panax notoginseng of root exudates and their allelochemicals. Front. Plant Sci. 2022, 13, 1020626. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Zhang, X.; Xu, Y.; Mei, X.; Jiang, B.; Liao, J.; Yin, Z.; Zheng, J.; Zhao, Z.; Fan, L.; et al. Autotoxic ginsenosides in the rhizosphere contribute to the replant failure of Panax notoginseng. PLoS ONE 2015, 10, e0118555. [Google Scholar] [CrossRef] [Green Version]
- Zhang, A.H.; Lei, F.J.; Fang, S.W.; Jia, M.H.; Zhang, L.X. Effects of ginsenosides on the growth and activity of antioxidant enzymes in American ginseng seedlings. J. Med. Plant Res. 2011, 5, 3217–3223. [Google Scholar]
- Robert-Seilaniantz, A.; Grant, M.; Jones, J.D.G. Hormone crosstalk in plant disease and defense: More than just jasmonate-salicylate antagonism. Annu. Rev. Phytopathol. 2011, 49, 317–343. [Google Scholar] [CrossRef]
- Pieterse, C.M.J.; Van der Does, D.; Zamioudis, C.; Leon-Reyes, A.; Van Wees, S.C. Hormonal modulation of plant immunity. Annu. Rev. Cell Dev. Biol. 2012, 28, 489–521. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Okubara, P.A.; Paulitz, T.C. Root defense responses to fungal pathogens: A molecular perspective. Plant Soil 2005, 274, 215–226. [Google Scholar] [CrossRef]
- Pulla, R.K.; Lee, O.R.; In, J.G.; Parvin, S.; Kim, Y.J.; Shim, J.S.; Sun, H.; Kim, Y.J.; Senthil, K.; Yang, D.C. Identification and characterization of class I chitinase in Panax ginseng C. A. Meyer. Mol. Biol. Rep. 2011, 38, 95–102. [Google Scholar] [CrossRef] [PubMed]
- Kiselev, K.V.; Kusaykin, M.I.; Dubrovina, A.S.; Bezverbny, D.A.; Zvyagintseva, T.N.; Bulgakov, V.P. The rolC gene induces expression of a pathogenesis-related b-1,3-glucanase in transformed ginseng cells. Phytochemistry 2006, 67, 2225–2231. [Google Scholar] [CrossRef]
- Farh, M.E.; Kim, Y.J.; Abbai, R.; Singh, P.; Jung, K.H.; Kim, Y.J.; Yang, D.C. Pathogenesis strategies and regulation of ginsenosides by two species of Ilyonectria in Panax ginseng: Power of speciation. J. Ginseng Res. 2020, 4, 332–340. [Google Scholar] [CrossRef]
- Kim, Y.J.; Lee, J.H.; Jung, D.Y.; Sathiyaraj, G.; Shim, J.S.; In, J.G.; Yang, D.C. Isolation and characterization of pathogenesis related protein 5 (PgPR5) gene from Panax ginseng. Plant Pathol. J. 2009, 25, 400–407. [Google Scholar] [CrossRef] [Green Version]
- Jung, D.Y.; Lee, O.R.; Kim, Y.J.; Lee, J.H.; Pulla, R.K.; Sathiyaraj, G.; Shim, J.S.; Yang, D.C. Molecular characterization of a cysteine proteinase inhibitor, PgCPI, from Panax ginseng C. A. Meyer. Acta Physiol. Plant. 2010, 32, 961–970. [Google Scholar] [CrossRef]
- Pulla, R.K.; Lee, O.R.; In, J.G.; Kim, Y.J.; Senthil, K.; Yang, D.C. Expression and functional characterization of pathogenesis-related protein family 10 gene, PgPR10-2, from Panax ginseng C.A. Meyer. Physiol. Mol. Plant Pathol. 2010, 74, 323–329. [Google Scholar] [CrossRef]
- Parvin, S.; Kim, Y.J.; Pulla, R.K.; Sathiyamoorthy, S.; Miah, G.; Kim, Y.J.; Wasnik, N.G.; Yang, D.C. Identification and characterization of spermidine synthase gene from Panax ginseng. Mol. Biol. Rep. 2010, 37, 923–932. [Google Scholar] [CrossRef]
- Wang, A.; Wang, C.Z.; Wu, J.A.; Osinski, J.; Yuan, C.S. Determination of major ginsenosides in Panax quinquefolius (American ginseng) using high-performance liquid chromatography. Phytochem. Anal. 2005, 16, 272–277. [Google Scholar] [CrossRef]
- Nicol, R.W.; Yousef, L.; Traquair, J.A.; Bernards, M.A. Ginsenosides stimulate the growth of soilborne pathogens of American ginseng. Phytochemistry 2003, 64, 257–264. [Google Scholar] [CrossRef]
- Cheng, L.Q.; Kim, M.K.; Lee, J.W.; Lee, Y.J.; Yang, D.C. Conversion of major ginsenoside Rb1 to ginsenoside F2 by Caulobacter leidyia. Biotechnol. Lett. 2006, 28, 1121–1127. [Google Scholar] [CrossRef]
- Cheng, L.Q.; Na, J.R.; Kin, M.K.; Bang, M.H.; Yang, D.C. Microbial conversion of ginsenoside Rb1 to minor ginsenoside F2 and gypenoside XVII by Intrasporangium sp. GS603 isolated from soil. J. Microbiol. Biotechnol. 2007, 17, 1937–1943. [Google Scholar] [PubMed]
- Kim, E.M.; Kim, J.; Seo, J.H.; Park, J.S.; Kim, D.H.; Kim, B.G. Identification and characterization of the Rhizobium sp. Strain GIN611 glycoside oxidoreductase resulting in the deglycosylation of ginsenosides. Appl. Environ. Microbiol. 2012, 78, 242–249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, L.; An, D.S.; Kim, S.G.; Jin, F.X.; Lee, S.T.; Im, W.T. Rhodanobacter panaciterrae sp. nov., a bacterium with ginsenoside-converting activity isolated from soil of a ginseng field. Int. J. Syst. Evol. Microbiol. 2011, 61, 3028–3032. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shin, H.Y.; Park, S.Y.; Sung, J.H.; Kim, D.H. Purification and characterization of alpha-L-arabinopyranosidase and alpha-L-arabinofuranosidase from Bifidobacterium breve K-110, a human intestinal anaerobic bacterium metabolizing ginsenoside Rb2 and Rc. Appl. Environ. Microbiol. 2003, 69, 7116–7123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Broglie, R.; Broglie, K. Chitinase gene expression in transgenic plants: A molecular approach to understanding plant defence responses. Philos. Trans. R. Soc. Lond. B Biol. Sci. 1993, 342, 265–270. [Google Scholar]
- Laluk, K.; Mengiste, T. Necrotroph attacks on plants: Wanton destruction or covert extortion? Arab. Book 2010, 8, 136. [Google Scholar] [CrossRef] [Green Version]
- Liu, J.J.; Sturrock, R.; Ekramoddoullah, A.K. The superfamily of thaumatin-like proteins: Its origin, evolution, and expression towards biological function. Plant Cell Rep. 2010, 29, 419–436. [Google Scholar] [CrossRef]
- Velazhahan, R.; Datta, S.K.; Muthukrishnan, S. The PR-5 family: Thaumatin-like proteins. In Pathogenesis-Related Proteins in Plants; Datta, S.K., Muthukrishnan, S., Eds.; CRC Press: Boca Raton, FL, USA, 1999; pp. 107–129. [Google Scholar]
- Yamamoto, T.; Yoshida, Y.; Nakajima, K.; Tominaga, M.; Gyohda, A.; Suzuki, H.; Okamoto, T.; Nishimura, T.; Yokotani, N.; Minami, E.; et al. Expression of RSOsPR10 in rice roots is antagonistically regulated by jasmonate/ethylene and salicylic acid via the activator OsERF87 and the repressor OsWRKY76, respectively. Plant Direct 2018, 2, e00049. [Google Scholar] [CrossRef]
- Kaur-Sawhney, R.; Tiburcio, A.F.; Altabella, T.; Galston, A.W. Polyamines in plants: An overview. J. Cell Mol. Biol. 2003, 2, 1–12. [Google Scholar]
- Leubner-Metzger, G.; Meins, F. Functions and regulation of plant ß-1, 3-glucanases (PR-2). In Pathogenesis-Related Proteins in Plants; Datta, S.K., Muthukrishnan, S., Eds.; CRC Press: Boca Raton, FL, USA, 1999; pp. 49–76. [Google Scholar]
- Hennig, J.; Dewey, R.E.; Cutt, J.R.; Klessig, D.F. Pathogen, salicylic acid and developmental dependent expression of a β-1, 3-glucanase/GUS gene fusion in transgenic tobacco plants. Plant J. 1993, 4, 481–493. [Google Scholar] [CrossRef]
- Zhang, L.; Zhang, F.; Melotto, M.; Yao, J.; He, S.Y. Jasmonate signaling and manipulation by pathogens and insects. J. Exp. Bot. 2017, 68, 1371–1385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Solomon, M.; Belenghi, B.; Delledonne, M.; Menachem, E.; Levine, A. The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. Plant Cell 1999, 11, 431–443. [Google Scholar] [CrossRef]
- Kunkel, B.N.; Brooks, D.M. Cross talk between signaling pathways in pathogen defense. Curr. Opin. Plant Biol. 2002, 5, 325–331. [Google Scholar] [CrossRef]
- El Oirdi, M.; El Rahman, T.A.; Rigano, L.; El Hadrami, A.; Rodriguez, M.C.; Daayf, F.; Vojnov, A.; Bouarab, K. Botrytis cinerea manipulates the antagonistic effects between immune pathways to promote disease development in tomato. Plant Cell 2011, 23, 2405–2421. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goodwin, P.H.; Best, M.A. Ginsenosides and biotic stress responses of ginseng. Plants 2023, 12, 1091. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Jiang, J. Analysis of specific metabolites in rhizosphere soil of Panax quinquefolius L. with root rot diseases based on metabolomics. J. Med. Plant Res. 2002, 12, 1–8. [Google Scholar] [CrossRef]
- Felix, G.; Regenass, M.; Boller, T. Specific perception of subnanomolar concentrations of chitin fragments by tomato cells: Induction of extracellular alkalinization, changes in protein phosphorylation, and establishment of a refractory state. Plant J. 1993, 4, 307–316. [Google Scholar] [CrossRef]
- Buttner, D.; He, S.Y. Type III protein secretion in plant pathogenic bacteria. Plant Physiol. 2009, 150, 1656–1664. [Google Scholar] [CrossRef] [Green Version]
- Reeleder, R.D.; Brammall, R.A. Pathogenicity of Pythium species, Cylindrocarpon destructans, and Rhizoctonia solani to ginseng seedlings in Ontario. Can. J. Plant Pathol. 1994, 16, 311–316. [Google Scholar] [CrossRef]
- Singh, S.; Sharma, B. Immunodeficiency and microbial infections. J. Microbiol. Mod. Tech. 2015, 1, 102. [Google Scholar]
- Dai, J.; Orsat, V. Extraction of ginsenosides from American Ginseng (Panax quinquefolium L.) root. Int. J. Food Eng. 2010, 6. [Google Scholar] [CrossRef]
- Wang, M.; Lu, S. Validation of suitable reference genes for quantitative gene expression analysis in Panax ginseng. Front. Plant Sci. 2016, 6, 1259. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dean, J.D.; Goodwin, P.H.; Hsiang., T. Comparison of relative RT-PCR and northern blot analyses to measure expression of β-l,3-glucanase in Nicotiana benthamiana infected with Colltotrichum destructivum. Plant Mol. Biol. Rep 2002, 20, 347–356. [Google Scholar] [CrossRef]
- Ivanov, D.A.; Georgakopoulos, J.R.C.; Bernards, M.A. The chemoattractant potential of ginsenosides in the ginseng—Pythium irregulare pathosystem. Phytochemistry 2015, 122, 56–64. [Google Scholar] [CrossRef]
Ginsenoside | Type | Root (AU a) | Previous Ginseng Soil (AU) | Hopyard Soil (AU) |
---|---|---|---|---|
R1 | PDD b | 6.62 × 106 | ND d | ND |
Rb1 | PDD | 1.55 × 107 | ND | ND |
Rc + Rb2 | PDD | 3.48 × 106 | ND | ND |
Rd | PDD | 8.16 × 106 A | 2.69 × 104 B | ND |
GXVII | PDD | 4.55 × 106 A | 1.78 × 104 A | ND |
F2 | PDD | 2.04 × 106 A | 5.04 × 103 B | ND |
Total | PDD | 4.04 × 107 A | 4.97 × 104 B | ND |
Rg1 | PTT c | 1.11 × 107 A | 3.28 × 103 B | ND |
Re | PTT | 4.75 × 107 A | 1.18 × 104 B | ND |
Rf | PTT | 3.28 × 107 A | 5.08 × 104 B | ND |
Total | PTT | 9.14 × 107 A | 6.59 × 104 B | ND |
Total | PDD + PTT | 1.32 × 108 A | 1.16 × 105 B | ND |
Target Gene | Primer Name | Forward (F) and Reverse (R) Primer Sequences, 5′-3′ | Product Size |
---|---|---|---|
PqCHI-1 | PQChi-F1 PQChi-R1 | CACTAATTGCCAAAGCCAGTG GGGTTGTTTATTAGGTCCACTCC | 493 bp |
PqGLU | PQgluc-F1 PQgluc-R1 | TCCTCCATCACTTGGTTCCTT TCATCAAACATAGCAAACAGATAAGT | 438 bp |
PqCPI | PQCPI-F1 PQCPI-R2 |
TCAGAACAGTGCCGAGATTG AGTTGGACCTCTGTTGGATGG | 383 bp |
PqSPD | PQSPD-F1 PQSPD-R1 | GCCGGGAGAAGCACACTC GCTCTTGTGCTGGACCTATGG | 470 bp |
PqPR10-2 | PQPR10-2-F1 PQPR10-2-R1 | TCCAAAAGACCGAAACCCAGG GATGCCACCGATAAGTCAATCC | 417 bp |
PqPR5 | PQPR5-F1 PQPR5-R1 | TAGCCGAATACGCCCTAAACC GGGCAAGTAAATGTGCTGGTT | 329 bp |
PqIF3G1 | PQIF3G1-F1 PQIF3G1-R1 | GGTGCTGTTCTCATGGTATGC GGGTATGACAATTTAATCCTTCGTGT | 451 bp |
PqIF3G1 | PQIF3G1-F2 PQIF3G1-R2 | CCAAGCATGAGAGCAGGTG AAGGAAGATGCAGAGAGAGCC | 237 bp |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Behdarvandi, B.; Goodwin, P.H. Effect of Soil and Root Extracts on the Innate Immune Response of American Ginseng (Panax quinquefolius) to Root Rot Caused by Ilyonectria mors-panacis. Plants 2023, 12, 2540. https://doi.org/10.3390/plants12132540
Behdarvandi B, Goodwin PH. Effect of Soil and Root Extracts on the Innate Immune Response of American Ginseng (Panax quinquefolius) to Root Rot Caused by Ilyonectria mors-panacis. Plants. 2023; 12(13):2540. https://doi.org/10.3390/plants12132540
Chicago/Turabian StyleBehdarvandi, Behrang, and Paul H. Goodwin. 2023. "Effect of Soil and Root Extracts on the Innate Immune Response of American Ginseng (Panax quinquefolius) to Root Rot Caused by Ilyonectria mors-panacis" Plants 12, no. 13: 2540. https://doi.org/10.3390/plants12132540