Carlavirus Species Infecting Hop Plants in Italy: Molecular Identification and Phylogenetic Analyses of the Detected Isolates
Abstract
:1. Introduction
2. Results
2.1. Identification of Carlavirus Species
2.2. Nucleotide Sequence and Phylogenetic Analyses of ORF5s (CP)
2.3. Virome Analysis and Viral Genomes Assembly
3. Discussion
4. Materials and Methods
4.1. Source of Plant Material
4.2. Total RNA Extraction
4.3. RT-PCR Amplification
4.4. Cloning, Sequencing and Phylogenetic Analysis
4.5. High Throughput Sequencing (HTS) and Bioinformatic Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Verzele, M. Centenary Review–100 Years of Hop Chemistry and Its Relevance to Brewing. J. Inst. Brew. 1986, 92, 32–48. [Google Scholar] [CrossRef]
- Olšovská, J.; Boštíková, V.; Dušek, M.; Jandovská, V.; Bogdanová, K.; Čermák, P.; Boštík, P.; Mikyska, A.; Kolář, M. Humulus lupulus L. (hops)-A valuable source of compounds with bioactive effects for future therapies. Mil. Med. Sci. Lett. 2016, 85, 19–30. [Google Scholar] [CrossRef]
- Pethybridge, S.J.; Wilson, C.R.; Hay, F.S.; Leggett, G.W.; Sherriff, L.J. Effect of Viruses on Agronomic and Brewing Characteristics of Four Hop (Humulus Lupulus) Cultivars in Australia. Ann. Appl. Biol. 2002, 140, 97–105. [Google Scholar] [CrossRef]
- Pethybridge, S.J.; Hay, F.S.; Barbara, D.J.; Eastwell, K.C.; Wilson, C.R. Viruses and Viroids Infecting Hop: Significance, Epidemiology, and Management. Plant Dis. 2008, 92, 324–338. [Google Scholar] [CrossRef]
- Adams, A.N.; Barbara, D.J. Host Range, Purification and Some Properties of Hop Mosaic Virus. Ann. Appl. Biol. 1980, 96, 201–208. [Google Scholar] [CrossRef]
- Barbara, D.; Adams, A. Hop Mosaic Virus. AAB Descr. Plant Viruses 1981, 241. [Google Scholar]
- Thresh, J.M. Hop Latent Virus. Rep. East Malling Res. Stn. 1969, 41. [Google Scholar]
- Barbara, D.J.; Adams, A.N. American Hop Latent Virus. CMI/AAB Descr. Plant Viruses 1983, 262. [Google Scholar]
- Barbara, D.J.; Adams, A.N. Hop Latent Virus. CMI/AAB Descr. Plant Viruses 1983, 261. [Google Scholar]
- Probasco, E.G.; Skotland, C.B. Host Range, General Properties, Purification and Electron Microscopy of Hop Latent Virus. Phytopathology 1978, 68, 277–281. [Google Scholar] [CrossRef]
- Thresh, J.M.; Adams, A.N. Hop Mosaic Disease. Rep. East. Malling Res. Stn. 1983, 173–175. [Google Scholar]
- Schmidt, H.E.; Schmidt, H.B.; Eisbein, K. Die Mechanische Übertragung Eines Stäbschenformingen Hopfenvirus Auf Krautige Testpflanzen. Zentbl. Bakt. ParasitKole 1966, 461–466. [Google Scholar]
- Eppler, A. Presence of Viruses in the Hop Growing Region of Alsace (France). In Proceedings of the International Workshop on Hop Virus Diseases, Rauischholzhausen Castle, Germany, 27 June–2 July 1989; p. 209. [Google Scholar]
- Hay, F.S. Studies on the Viruses of Hop (Humulus Lupulus L.) in New Zealand; Lincoln University: Christchurch, New Zealand, 1989. [Google Scholar]
- Munro, D. Viruses Infecting Hop, Humulus Lupulus, in Australia. Aust. J. Agric. Res. 1987, 38, 83. [Google Scholar] [CrossRef]
- Pethybridge, S.J.; Wilson, C.R.; Sherriff, L.J.; Legget, G.W.; Munro, D. Virus Incidence in Australian Hop (Humulus Lupulus L.) Gardens and Cultivar Differences in Susceptibility to Infection. Aust. J. Agric. Res. 2000, 51, 685–689. [Google Scholar] [CrossRef]
- Yu, J.; Liu, Y. The Occurrence of Three Viruses in Hop (Humulus Lupulus) in China. Plant Pathol. 1987, 36, 38–44. [Google Scholar] [CrossRef]
- Wade, G.C. Hop Diseases in Tasmania. Tasman. J. Agric. 1962, 7, 261–268. [Google Scholar]
- Kanno, Y.; Yoshikawa, N.; Takahashi, T. Some Properties of Hop Latent and Apple Mosaic Viruses Isolated from Hop Plants and Their Distributions in Japan. Jpn. J. Phytopathol. 1993, 59, 651–658. [Google Scholar] [CrossRef]
- Hay, F.S.; Close, R.C.; Fletcher, J.D.; Ashby, J.W. Incidence and Spread of Viruses in Hop (Humulus Lupulus L.) in New Zealand. New Zealand J. Crop Hortic. Sci. 1992, 20, 319–327. [Google Scholar] [CrossRef]
- Adams, A.N.; Morton, A.; Barbara, D.J.; Ridout, M.S. The Distribution and Spread of Hop Latent Viroid within Two Commercial Plantings of Hop Humulus Lupulus. Ann. Appl. Biol. 1992, 121, 585–592. [Google Scholar] [CrossRef]
- Hillman, B.I.; Lawrence, D.M. Carlaviruses. In Pathogenesis and Host Specificity in Plant Diseases: Histopathological, Biochemical, Genetic and Molecular Bases; Singh, R.P., Singh, U.S., Kohmoto, K., Eds.; Elsevier: New York, NY, USA, 1995; Volume III, pp. 35–50. [Google Scholar]
- Henderson, J.; Gibbs, M.J.; Edwards, M.L.; Clarke, V.A.; Gardner, K.A.; Cooper, J.I. Partial Nucleotide Sequence of Poplar Mosaic Virus RNA Confirms Its Classification as a Carlavirus. J. Gen. Virol. 1992, 73, 1887–1890. [Google Scholar] [CrossRef]
- Hataya, T.; Arimoto, R.; Suda, N.; Uyeda, I. Molecular Characterization of Hop Mosaic Virus: Its Serological and Molecular Relationships to Hop Latent Virus. Arch. Virol. 2001, 146, 1935–1948. [Google Scholar] [CrossRef] [PubMed]
- Crowle, D.R.; Pethybridge, S.J.; Wilson, C.R. Transmission of Hop Latent and Hop Mosaic Carlaviruses by Macrosiphum Euphorbiae and Myzus Persicae. J. Phytopathol. 2006, 154, 745–747. [Google Scholar] [CrossRef]
- Gargani, E.; Faggioli, F.; Haegi, A. A Survey on Pests and Diseases of Italian Hop Crops. Italus Hortus 2017, 24, 1–17. [Google Scholar] [CrossRef]
- Probasco, E.G.; Murphey, J.M. The Effects of Hop Viruses on Brewing and Agronomic Characteristics in the Hop Variety Chinook. MBAA Tech. Quart. 1996, 33, 160–165. [Google Scholar]
- Kimura, M. A Simple Method for Estimating Evolutionary Rates of Base Substitutions through Comparative Studies of Nucleotide Sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- Poke, F.S.; Crowle, D.R.; Whittock, S.P.; Wilson, C.R. Molecular Variation of Hop Mosaic Virus Isolates. Arch. Virol. 2010, 155, 1721–1724. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: New York, NY, USA, 2000. [Google Scholar]
- Dann, A.L.; Hössel, S.E.; Cross, P.A.; Whittock, S.P. Phylogenetic Analysis of American Hop Latent Virus in Humulus Lupulus Surveyed in Tasmania and Victoria, Australia. Australas. Plant Dis. Notes 2014, 9, 140. [Google Scholar] [CrossRef]
- Choi, S.A.; Ryu, K.H. The Complete Nucleotide Sequence of the Genome RNA of Lily Symptomless Virus and Its Comparison with That of Other Carlaviruses. Arch. Virol. 2003, 148, 1943–1955. [Google Scholar] [CrossRef]
- MacKenzie, D.J.; McLean, M.A.; Mukerji, S.; Green, M. Improved RNA Extraction from Woody Plants for the Detection of Viral Pathogens by Reverse Transcription-Polymerase Chain Reaction. Plant Dis. 1997, 81, 222–226. [Google Scholar] [CrossRef]
- Eastwell, K.C.; Druffel, K.L. Complete Genome Organization of American Hop Latent Virus and Its Relationship to Carlaviruses. Arch. Virol. 2012, 157, 1403–1406. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.T.K. MEGA 7: Molecular Evolutionary Genetics Analysis. Mol. Biol. Evol. 2016, 34, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.; Madan, A. CAP3: A DNA Sequence Assembly Program. Genome Res. 1999, 9, 868–877. [Google Scholar] [CrossRef] [PubMed]
Cultivar | Sample Code | Identified Virus (No. Infected Samples/Analysed) | Sequenced Isolates | |
---|---|---|---|---|
Sanger (Acc. n. ORF5) | HTS (Acc. n. Full Genome) | |||
Chinook Columbus Cascade Hallertauer Magnum Nugget Opal | C1, C2, C3 C4, C5 C6 C10 C11 C12 | HpLV (3/3) HpLV (2/2) HpLV HpLV HpLV HpLV | ||
Columbus Yeoman | RM4, RM5 RM6, RM7 | HpLV (2/2) HpLV (2/2) | ||
Spalter Hallertauer Magnum Spalt Mittlefruh Saaz | RI2 RI3 RI4, RI5 RI6 RI8 | HpLV HpLV HpLV (2/2) HpLV HpLV | ||
RI6 (MT251188) | RI6 (ON409683) | |||
Cascade Centennial | SUB1, SUB2, SUB3 SUB4 | HpLV (3/3) HpLV | ||
Cascade | CA2, CA4, OB1 | HpLV (3/3) | OB1 (MT251191) | |
Perle | PE | HpLV | ||
Centennial | CEN1, CEN2, CEN3, CEN5 | HpLV (3/4), | CEN2 (ON409680) | |
HpMV (2/4) | CEN1 (MT251193) CEN2 (MT251194) | CEN2 (ON409684) | ||
Cascade Nugget Centennial | RN2 TDF1 TDF3 | HpLV HpLV HpLV | RN2 (MT251184) | |
TDF3 (MT251185) | ||||
Wild hop | RN1 | HpMV | RN1 (MT251195) | RN1 (ON409685) |
Mounth Hood Centenial Fuggle Sorachi Ace | FZ1 FZ3 FZ4 FZ5 | HpLV, AHLV HpLV, AHLV HpLV HpLV | ||
FZ3 (MT251183) | FZ3 (ON409681) | |||
FZ3 (MT251192) | FZ3 (ON409686) | |||
FZ5 (MT251187) | FZ5 (ON409682) | |||
Nugget Hallertauer Magnum Cascade | CS1 CS2 CS3 | HpLV HpLV HpLV | ||
Saazer Magnum Hersbruker Prima Domus Nugget King Goldwin Fuggle | H1 H2 H3 W1 W2 W3 W4 | HpLV HpLV HpLV HpLV HpLV HpLV HpLV | H1 (MT251189) | |
W2 (MT251190) | ||||
unknown | Abr1 | HpLV | Abr1 (MT251186) | |
unknown | Ma1 | HpLV | ||
Commercial cvs. Wild hop | 49 HpLV, 2 HpMV, 2 AHLV 1 HpMV | |||
Total | 49/51 HpLV (96.1%), 3/51 HpMV (5.9%), 2/51 AHLV (3.9%) |
Isolate | ORF1 | ORF2 | ORF3 | ORF4 | ORF5 | ORF6 | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
(Virus) | Lenght | % | ID | Lenght | % | ID | Lenght | % | ID | Lenght | % | ID | Lenght | % | ID | Lenght | % | ID |
FZ3 | 5934 nt | 98.06% | KR185345.1 | 705 nt | 99.01% | JQ245696.1 | 321 nt | 99.38% | JQ728538.1 | 201 nt | 98.01% | KR185345.1 | 933 nt | 98.07% | JQ728538.1 | 345 nt | 98.84% | KR185345.1 |
(AHLV) | 1977 aa | 98.63% | YP006297586.1 | 234 aa | 98.72% | YP006297587.1 | 106 aa | 100% | ALJ56055.1 | 66 aa | 100% | ALJ56056.1 | 310 aa | 98.71% | ALJ56057.1 | 114 aa | 98.25% | AFI61530.1 |
CEN2 | 5946 nt | 95.44% | AB032469.1 | 696 nt | 96.41% | KP861891.1 | 327 nt | 96.94% | AB032469.1 | 183 nt | 97.81% | KP861891.1 | 921 nt | 98.26% | EF202599.1 | 315 nt | 97.78% | KP861891.1 |
(HpLV) | 1981 aa | 97.73% | NP066258.1 | 231 aa | 97.04% | CDK36472.1 | 108 aa | 99.07% | NP_066260.1 | 60 aa | 98.33% | CDK36474.1 | 306 aa | 99.35% | NP066262.1 | 104 aa | 100% | AJR19308.1 |
FZ3 | 5946 nt | 95.14% | AB032469.1 | 696 nt | 96.84% | AB032469.1 | 327 nt | 96.74% | AB032469.1 | 183 nt | 98.36% | HG793797.1 | 921 nt | 98.81% | EF202599.1 | 315 nt | 97.78% | KP861891.1 |
(HpLV) | 1981 aa | 97.38% | NP066258.1 | 231 aa | 98.27% | AJR19304.1 | 108 aa | 99.07% | NP066260.1 | 60 aa | 98.33% | CDK36474.1 | 306 aa | 99.67% | ABN68950.1 | 104 aa | 100% | AJR19308.1 |
FZ5 | 5946 nt | 96.82% | AB032469.1 | 696 nt | 96.98% | KP861891.1 | 327 nt | 95.11% | AB032469.1 | 183 nt | 97.81% | HG793797.1 | 921 nt | 99.35% | EF202599.1 | 315 nt | 97.14% | KP861891.1 |
(HpLV) | 1981 aa | 98.99% | NP066258.1 | 231 aa | 98.27% | AJR19304.1 | 108 aa | 97.22% | NP_066260.1 | 60 aa | 98.33% | CDK36474.1 | 306 aa | 99.67% | ABN68950.1 | 104 aa | 98.08% | AJR19308.1 |
RI6 | 5946 nt | 97.70% | KP861891.1 | 696 nt | 99.14% | KP861891.1 | 327 nt | 99.08% | KP861891.1 | 183 nt | 98.91% | KP861891.1 | 921 nt | 98.91% | KP861891.1 | 315 nt | 99.68% | KP861891.1 |
(HpLV) | 1981 aa | 98.54% | NP066258.1 | 231 aa | 100% | AJR19304.1 | 108 aa | 100% | AJR19305.1 | 60 aa | 100% | CDK36474.1 | 306 aa | 100% | AJR19307.1 | 104 aa | 100% | AJR19308.1 |
CEN2 | 5891 nt | 93.81% | EU527979.1 | 689 nt | 94.78% | EU527979.1 | 326 nt | 93.58% | EU527979.1 | 206 nt | 93.72% | FJ463807.1 | 923 nt | 95.56% | FJ463804.1 | 308 nt | 97.73% | FJ463802.1 |
(HpMV) | 1963 aa | 96.99% | YP001798592.1 | 229 aa | 97.38% | YP001798593.1 | 108 aa | 100% | YP001798593.1 | 68 aa | 92.65% | ACS45270.1 | 307 aa | 100% | QKY12192.1 | 102 aa | 99.02% | ACS45257.1 |
RN1 | 5891 nt | 98.93% | EU527979.1 | 689 nt | 98.99% | EU527979.1 | 326 nt | 99.39% | EU527979.1 | 206 nt | 100% | FJ463810.1 | 923 nt | 99.13% | FJ463804.1 | 308 nt | 99.35% | FJ463810.1 |
(HpMV) | 1963 aa | 99.08% | YP001798592.1 | 229 aa | 99.56% | YP001798593.1 | 108 aa | 100% | YP001798593.1 | 68 aa | 100% | YP_001798595.1 | 307 aa | 100% | ACS45220.1 | 102 aa | 99.02% | YP001798597.1 |
Region | Sampling Site | No. of Samples | Cultivar | No. of Samples/Cultivar | Sample Code |
---|---|---|---|---|---|
Lazio | LAZ1 | 9 | Chinook Columbus Cascade Hallertauer Magnum Nugget Opal | 3 2 1 1 1 1 | C1, C2, C3 C4, C5 C6 C10 C11 C12 |
LAZ2 | 4 | Columbus Yeoman | 2 2 | RM4, RM5 RM6, RM7 | |
LAZ3 | 6 | Spalter Hallertauer Magnum Spalt Mittlefruh Saaz | 1 1 2 1 1 | RI2 RI3 RI4, RI5 RI6 RI8 | |
LAZ4 | 4 | Cascade Centennial | 3 1 | SUB1, SUB2, SUB3, SUB4 | |
Tuscany | TOS1 | 8 | Cascade Perle Centennial | 3 1 4 | CA2, CA4, OB1 PE CEN1, CEN2, CEN3, CEN5 |
Emilia- Romagna | EMI6 | 3 | Cascade Nugget Centennial | 1 1 1 | RN2 TDF1 TDF3 |
1 | Wild hop | 1 | RN1 | ||
EMI3 | 4 | Mounth Hood Centenial Fuggle Sorachi Ace | 1 1 1 1 | FZ1 FZ3 FZ4 FZ5 | |
EMI1 | 3 | Nugget Hallertauer Magnum Cascade | 1 1 1 | CS1 CS2 CS3 | |
Abruzzo | ABR1 | 7 | Saazer Magnum Hersbruker Prima Domus Nugget King Goldwin Fuggle | 1 1 1 1 1 1 1 | H1 H2 H3 W1 W2 W3 W4 |
ABR2 | 1 | unknown | Abr1 | ||
Marche | MAR1 | 1 | unknown | Ma1 | |
Total | 50 1 | Commercial cvs. Wild hop | |||
51 |
Target Virus | Sequence (5′-3′) | Amplicon Size (bp) | Reference |
---|---|---|---|
AHLV | Rev—TCAGTGCGCTTGTCGAAACTC Fw—ATGTCGAACGTTGAAAGG | 931 | [34] |
HpLV | Rev—AGTCAACAGCAAAGCGACAC Fw—AGCAGTAGATGCAAGTTGAAG | 1.538 | This work |
HpMV | Rev—AGCACGCCACCAGTGCAT Fw—AAGTCCCTTGGGGGTTGTGG | 998 | This work |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luigi, M.; Donati, L.; Sciarroni, R.; Gentili, A.; Taglienti, A.; Tiberini, A.; Faggioli, F.; Ferretti, L. Carlavirus Species Infecting Hop Plants in Italy: Molecular Identification and Phylogenetic Analyses of the Detected Isolates. Plants 2023, 12, 3514. https://doi.org/10.3390/plants12193514
Luigi M, Donati L, Sciarroni R, Gentili A, Taglienti A, Tiberini A, Faggioli F, Ferretti L. Carlavirus Species Infecting Hop Plants in Italy: Molecular Identification and Phylogenetic Analyses of the Detected Isolates. Plants. 2023; 12(19):3514. https://doi.org/10.3390/plants12193514
Chicago/Turabian StyleLuigi, Marta, Livia Donati, Renato Sciarroni, Andrea Gentili, Anna Taglienti, Antonio Tiberini, Francesco Faggioli, and Luca Ferretti. 2023. "Carlavirus Species Infecting Hop Plants in Italy: Molecular Identification and Phylogenetic Analyses of the Detected Isolates" Plants 12, no. 19: 3514. https://doi.org/10.3390/plants12193514