Isolation and Identification of Coliform Bacteria and Multidrug-Resistant Escherichia coli from Water Intended for Drug Compounding in Community Pharmacies in Jordan
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling Plan
2.2. Collection of Water Samples
2.3. Bacterial Propagation and Identification
2.4. Detection and Enumeration of Total Viable Microorganisms, Total Coliforms and E. coli by Membrane Filtration
2.5. Identification of E. coli
2.6. Identification of E. coli by PCR
2.6.1. DNA Extraction
2.6.2. PCR for Isolates Identification
2.7. Antibiotic Susceptibility Test
2.8. Statistics
3. Results
3.1. Detection and Enumeration of Total Coliforms and E. coli
3.2. Identification of E. coli
3.3. Antibiotic Susceptibility
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kaper, J.; Nataro, J.; Mobley, H. Nature reviews. Microbiology. Nat. Rev. Microbiol. 2004, 2, 123–140. [Google Scholar] [CrossRef] [PubMed]
- WHO. Who Drug Information; WHO: Geneva, Switzerland, 2021; pp. 606–853.
- Mistry, H.; Patel, T.; Patel, A. Microbial analysis of water system for veterinary vaccine manufacturing facility. Int. J. Vet. Sci. Anim. Husb. 2018, 3, 24–29. [Google Scholar]
- European Pharmacopoeia. EDQM.226; Council of Europe: Strasbourg, France, 2011. [Google Scholar]
- Tyagi, S.; Sharma, B. Water Quality Assessment in Terms of Water Quality Index. Am. J. Water Resour. 2013, 1, 34–38. [Google Scholar] [CrossRef]
- WHO. Guidelines for Drinking-Water Quality; WHO: Geneva, Switzerland, 2008; p. 668.
- Aziz, H.M. The investigated microbiological (coliform) among different drinking water sources in Kalar city. IOSR-JESTFT 2016, 10, 56–58. [Google Scholar] [CrossRef]
- Mishra, M.; Patel, A.K.; Behera, N. Prevalence of multidrug resistant E. coli in the river Mahanadi of Sambalpur. Curr. Res. Microbiol. Biotechnol. 2013, 1, 239–244. [Google Scholar] [CrossRef] [Green Version]
- Shield, K.F.; Bain, R.E.; Cronk, R. Association of supply type with fecal contamination of source water and household stored drinking water in developing countries: A bivariate meta-analysis. Environ. Health Perspect. 2015, 123, 1222–1231. [Google Scholar] [CrossRef] [PubMed]
- Sharma, G.; Sharma, S.; Sharma, P. Escherichia coli biofilm: Development and therapeutic strategies. J. Appl. Microbiol. 2016, 121, 309–319. [Google Scholar] [CrossRef] [Green Version]
- Tarawneh, O.; Alwahsh, W.; Abul-Futouh, H.; Al-Samad, L.A.; Hamadneh, L.; Abu Mahfouz, H.; Fadhil Abed, A. Determination of Antimicrobial and Antibiofilm Activity of Combined LVX and AMP Impregnated in p (HEMA) Hydrogel. Appl. Sci. 2021, 11, 8345. [Google Scholar] [CrossRef]
- Korajkic, A.; McMinn, B.R.; Harwood, V.J. Relationships between microbial indicators and pathogens in recreational water settings. Int. J. Environ. Res. Public Health 2018, 15, 2842. [Google Scholar] [CrossRef] [Green Version]
- de Kraker, M.E.; Stewardson, A.J.; Harbarth, S. Will 10 million people die a year due to antimicrobial resistance by 2050? PLoS Med. 2016, 13, e1002184. [Google Scholar] [CrossRef] [Green Version]
- Roberts, R.R.; Hota, B.; Ahmad, I.; Scott, R.D.; Foster, S.D.; Abbasi, F.; Schabowski, S.; Kampe, L.M.; Ciavarella, G.G.; Supino, M.; et al. Hospital and societal costs of antimicrobial-resistant infections in a Chicago teaching hospital: Implications for antibiotic stewardship. Arch. Clin. Infect. Dis. 2009, 49, 1175–1184. [Google Scholar] [CrossRef]
- Kinge, C.N.W.; Ateba, C.N.; Kawadza, D.T. Antibiotic resistance profiles of Escherichia coli isolated from different water sources in the Mmabatho locality, North-West Province, South Africa. S. Afr. J. Sci. 2010, 106, 44–49. [Google Scholar] [CrossRef] [Green Version]
- Balasubramaniam, A.; Eswaran, M.A.; Suresh, P.; Sukumar, K. Detection of tetracycline resistance determinant tet A gene and antimicrobial resistance pattern in Escherichia coli isolates recovered from healthy layer chickens. Vet. World 2014, 7, 635–638. [Google Scholar] [CrossRef] [Green Version]
- Cotruvo, J.A. WHO Guidelines for Drinking Water Quality: First Addendum to the Fourth Edition. J.-Am. Water Work. Assoc. 2017, 109, 44–51. [Google Scholar] [CrossRef] [Green Version]
- Lin, S.; Evans, R.L. An Analysis of Coliform Bacteria In The Upper Illinois Waterway. JAWRA J. Am. Water Resour. Assoc. 1974, 10, 1198–1217. [Google Scholar] [CrossRef]
- APHA. Standard Methods for the Examination of Water and Wastewater, 21st ed.; American Public Health Association, American Water Works Association, Water Environment Federation: Washington, DC, USA, 2005. [Google Scholar]
- Tille, P.M. Bailey & Scott’s Diagnostic Microbiology, 14th ed.; Elsevier: St. Louis, MO, USA, 2017. [Google Scholar]
- Molina, F.; Lopez-Acedo, E.; Tabla, R.; Roe, I.; Gomez, A.; Rebollo, J.E. Improved detection of Escherichia coli and coliform bacteria by multiplex PCR. BMC Biotechnol. 2015, 15, 48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clinical and Laboratory Standards Institute (CLSI). M100-ED30:2020 Performance Standards for Antimicrobial Susceptibility Testing; Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2020. [Google Scholar]
- Santos, N.V.; Moura, A.C.; Baptista, J.G.; Filho, A.F. Avaliação da qualidade de águas purificadas utilizadas em farmácias de manipulação (Assessing the quality of purified water used in compounding pharmacies). Rev. Ciênc. Farm. Básica Apl. 2014, 35, 419–423. [Google Scholar]
- Kassenga, G.R. The health-related microbiological quality of bottled drinking water sold in Dar es Salaam, Tanzania. J. Water Health 2007, 5, 179–185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Webster, L.F.; Thompson, B.C.; Fulton, M.H.; Chestnut, D.E.; Van Dolah, R.F.; Leight, A.K.; Scott, G.I. Identification of sources of Escherichia coli in South Carolina estuaries using antibiotic resistance analysis. J. Exp. Mar. Biol. Ecol. 2004, 298, 179–195. [Google Scholar] [CrossRef]
- Burjaq, S.Z.; Abu-Romman, S.M.; Haddad, M.A. Molecular characterization of virulence genes and antibiotic resistance among fecal Escherichia coli isolated from surface water of Wadi Shueib-Jordan. Int. Arab. J. Antimicrob. Agents 2017, 7, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Swedan, S.; Abu Alrub, H. Antimicrobial resistance, virulence factors, and pathotypes of Escherichia coli isolated from drinking water sources in Jordan. Pathogens 2019, 8, 86. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ghanem, B.; Haddadin, R.N. Multiple drug resistance and biocide resistance in Escherichia coli environmental isolates from hospital and household settings. Antimicrob. Resist. Infect. Control 2018, 7, 47. [Google Scholar] [CrossRef] [PubMed]
- Abu Salah, M.A.; Badran, E.F.; Shehabi, A.A. High incidence of multidrug resistant Escherichia coli producing CTX-M-type ESBLs colonizing the intestine of Jordanian infants. Int. Arab. J. Antimicrob. Agents 2017, 7, 5. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence | Target Gene | Product Size | Reference |
---|---|---|---|---|
lacZ3 | F: 5′ TTGAAAATGGTCTGCTGCTG 3′ R: 5′ TATTGGCTTCATCCACCACA 3′ | β-galactosidase | 243bp | [21] |
Total Coliform Count (CFU/100 mL) | Total Escherichia coli Count (CFU/100 mL) | Number of Samples (%) |
---|---|---|
TNTC | TNTC | 1 (2%) |
TNTC | 1–10 | 8 (16%) |
5–15 | 1–8 | 4 (8%) |
3–30 | Negative | 11 (22%) |
TNTC | Negative | 20 (40%) |
Negative | Negative | 6 (12%) |
Total | 50 (100%) |
Group Number | Water Source | Number of Samples (%) | Number (and %) of Samples Containing Escherichia coli | Percentage of Contamination (mean%; ±se) | Z-Score | p-Values |
---|---|---|---|---|---|---|
1 | Cooler water | 31 (62%) | 8 (16%) | 8/31 (25.8%; 7.9) | Between groups 1 & 2: −0.371406 | 0.355167 |
2 | Bottled water | 10 (20%) | 2 (4%) | 2/10 (20%; 12.7) | Between groups 2 & 3: −0.823688 | 0.205058 |
3 | Boiled tap water | 8 (16%) | 3 (6%) | 3/8 (37.5%; 17.1) | Between groups 3 & 1: 0.655681 | 0.256015 |
4 | Tap water | 1 (2%) | 0 (0%) | 0 | ||
Total (%) | 50 (100%) | 13 (26%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abu-Sini, M.K.; Maharmah, R.A.; Abulebdah, D.H.; Al-Sabi, M.N.S. Isolation and Identification of Coliform Bacteria and Multidrug-Resistant Escherichia coli from Water Intended for Drug Compounding in Community Pharmacies in Jordan. Healthcare 2023, 11, 299. https://doi.org/10.3390/healthcare11030299
Abu-Sini MK, Maharmah RA, Abulebdah DH, Al-Sabi MNS. Isolation and Identification of Coliform Bacteria and Multidrug-Resistant Escherichia coli from Water Intended for Drug Compounding in Community Pharmacies in Jordan. Healthcare. 2023; 11(3):299. https://doi.org/10.3390/healthcare11030299
Chicago/Turabian StyleAbu-Sini, Mohammad K., Rafeef A. Maharmah, Dina H. Abulebdah, and Mohammad N. S. Al-Sabi. 2023. "Isolation and Identification of Coliform Bacteria and Multidrug-Resistant Escherichia coli from Water Intended for Drug Compounding in Community Pharmacies in Jordan" Healthcare 11, no. 3: 299. https://doi.org/10.3390/healthcare11030299
APA StyleAbu-Sini, M. K., Maharmah, R. A., Abulebdah, D. H., & Al-Sabi, M. N. S. (2023). Isolation and Identification of Coliform Bacteria and Multidrug-Resistant Escherichia coli from Water Intended for Drug Compounding in Community Pharmacies in Jordan. Healthcare, 11(3), 299. https://doi.org/10.3390/healthcare11030299