circRNAs May Be Involved in Dysfunction of Neutrophils of Type 2 Diabetic Mice through Regulation of Specific miRNAs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Microarray Analysis
2.3. Isolation of Neutrophils, Macrophages, T Cells, and B Cells
2.4. RNA Isolation for Real-Time Quantitative PCR
2.5. cDNA Synthesis for circRNA and microRNA, and Quantitative Real-Time PCR (qRT-PCR)
2.6. Statistical Analysis
3. Results
3.1. circRNA Expression Is Altered in Neutrophils from Diabetic Mice
3.2. miR-129-2-3p May Be Regulated by circRNAs in Diabetic-Derived Neutrophils
3.3. The Function of Diabetic-Derived Neutrophils May Be Regulated by miRNA-circRNA Axis other than miR-129-2-3p-circRNA Axis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wild, S.; Roglic, G.; Green, A.; Sicree, R.; King, H. Global Prevalence of Diabetes: Estimates for the year 2000 and projections for 2030. Diabetes Care 2004, 27, 1047–1053. [Google Scholar] [CrossRef] [Green Version]
- Amatruda, M.; Gembillo, G.; Giuffrida, A.E.; Santoro, D.; Conti, G. The Aggressive Diabetic Kidney Disease in Youth-Onset Type 2 Diabetes: Pathogenetic Mechanisms and Potential Therapies. Medicina 2021, 57, 868. [Google Scholar] [CrossRef] [PubMed]
- Brem, H.; Tomic-Canic, M. Cellular and molecular basis of wound healing in diabetes. J. Clin. Investig. 2007, 117, 1219–1222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Faselis, C.; Katsimardou, A.; Imprialos, K.; Deligkaris, P.; Kallistratos, M.S.; Dimitriadis, K. Microvascular Complications of Type 2 Diabetes Mellitus. Curr. Vasc. Pharmacol. 2020, 18, 117–124. [Google Scholar] [CrossRef]
- Javed, S.; Hayat, T.; Menon, L.; Alam, U.; Malik, R.A. Diabetic peripheral neuropathy in people with type 2 diabetes: Too little too late. Diabet. Med. 2020, 37, 573–579. [Google Scholar] [CrossRef]
- Zhou, T.; Hu, Z.; Yang, S.; Sun, L.; Yu, Z.; Wang, G. Role of Adaptive and Innate Immunity in Type 2 Diabetes Mellitus. J. Diabetes Res. 2018, 2018, 7457269. [Google Scholar] [CrossRef] [PubMed]
- Mahdipour, E.; Charnock, J.C.; Mace, K.A. Hoxa3 promotes the differentiation of hematopoietic progenitor cells into proangiogenic Gr-1+CD11b+ myeloid cells. Blood 2011, 117, 815–826. [Google Scholar] [CrossRef] [Green Version]
- Torbica, T.; Wicks, K.; Umehara, T.; Gungordu, L.; Alrdahe, S.; Wemyss, K.; Grainger, J.R.; Mace, K.A. Chronic Inflammation in Response to Injury: Retention of Myeloid Cells in Injured Tissue Is Driven by Myeloid Cell Intrinsic Factors. J. Investig. Dermatol. 2019, 139, 1583–1592. [Google Scholar] [CrossRef] [Green Version]
- Umehara, T.; Mori, R.; Mace, K.A.; Murase, T.; Abe, Y.; Yamamoto, T.; Ikematsu, K. Identification of Specific miRNAs in Neutrophils of Type 2 Diabetic Mice: Overexpression of miRNA-129-2-3p Accelerates Diabetic Wound Healing. Diabetes 2019, 68, 617–630. [Google Scholar] [CrossRef] [Green Version]
- Chen, L.-L.; Yang, L. Regulation of circRNA biogenesis. RNA Biol. 2015, 12, 381–388. [Google Scholar] [CrossRef]
- Ebbesen, K.K.; Kjems, J.; Hansen, T.B. Circular RNAs: Identification, biogenesis and function. Biochim. Biophys. Acta Gene Regul. Mech. 2016, 1859, 163–168. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Q.; Bao, C.; Guo, W.; Li, S.; Chen, J.; Chen, B.; Luo, Y.; Lyu, D.; Li, Y.; Shi, G.; et al. Circular RNA profiling reveals an abundant circHIPK3 that regulates cell growth by sponging multiple miRNAs. Nat. Commun. 2016, 7, 11215. [Google Scholar] [CrossRef] [Green Version]
- Han, B.; Chao, J.; Yao, H. Circular RNA and its mechanisms in disease: From the bench to the clinic. Pharmacol. Ther. 2018, 187, 31–44. [Google Scholar] [CrossRef]
- Cen, J.; Liang, Y.; Huang, Y.; Pan, Y.; Shu, G.; Zheng, Z.; Liao, X.; Zhou, M.; Chen, D.; Fang, Y.; et al. Circular RNA circSDHC serves as a sponge for miR-127-3p to promote the proliferation and metastasis of renal cell carcinoma via the CDKN3/E2F1 axis. Mol. Cancer 2021, 20, 19. [Google Scholar] [CrossRef] [PubMed]
- Yang, J.; Li, Y.; Yu, Z.; Zhou, Y.; Tu, J.; Lou, J.; Wang, Y. Circular RNA Circ100084 functions as sponge of miR-23a-5p to regulate IGF2 expression in hepatocellular carcinoma. Mol. Med. Rep. 2020, 21, 2395–2404. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.-Y.; Chang, N.-B.; Rong, Z.-H.; Li, T.; Xiao, L.; Yao, Q.-P.; Jiang, R.; Jiang, J. circDiaph3 regulates rat vascular smooth muscle cell differentiation, proliferation, and migration. FASEB J. 2019, 33, 2659–2668. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fang, Y.; Wang, X.; Li, W.; Han, J.; Jin, J.; Su, F.; Zhang, J.; Huang, W.; Xiao, F.; Pan, Q.; et al. Screening of circular RNAs and validation of circANKRD36 associated with inflammation in patients with type 2 diabetes mellitus. Int. J. Mol. Med. 2018, 42, 1865–1874. [Google Scholar] [CrossRef] [Green Version]
- Altesha, M.; Ni, T.; Khan, A.; Liu, K.; Zheng, X. Circular RNA in cardiovascular disease. J. Cell. Physiol. 2019, 234, 5588–5600. [Google Scholar] [CrossRef]
- Panda, A.C.; Gorospe, M. Detection and Analysis of Circular RNAs by RT-PCR. Bio-protocol 2018, 8, e2775. [Google Scholar] [CrossRef] [Green Version]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative CT method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Hansen, T.B.; Jensen, T.I.; Clausen, B.H.; Bramsen, J.B.; Finsen, B.; Damgaard, C.K.; Kjems, J. Natural RNA circles function as efficient microRNA sponges. Nature 2013, 495, 384–388. [Google Scholar] [CrossRef]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef]
- Chien, Y.; Tsai, P.-H.; Lai, Y.-H.; Lu, K.-H.; Liu, C.-Y.; Lin, H.-F.; Huang, C.-S.; Wu, W.-W.; Wang, C.-Y. CircularRNA as novel biomarkers in liver diseases. J. Chin. Med. Assoc. 2020, 83, 15–17. [Google Scholar] [CrossRef] [PubMed]
- Qu, S.; Yang, X.; Li, X.; Wang, J.; Gao, Y.; Shang, R.; Sun, W.; Dou, K.; Li, H. Circular RNA: A new star of noncoding RNAs. Cancer Lett. 2015, 365, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Huang, W.; Wang, X.; Wang, T.; Chen, Y.; Chen, B.; Liu, R.; Bai, P.; Xing, J. Circular RNA CEP128 acts as a sponge of miR-145-5p in promoting the bladder cancer progression via regulating SOX11. Mol. Med. 2018, 24, 40. [Google Scholar] [CrossRef] [Green Version]
- Li, R.-C.; Ke, S.; Meng, F.-K.; Lu, J.; Zou, X.-J.; He, Z.-G.; Wang, W.-F.; Fang, M.-H. CiRS-7 promotes growth and metastasis of esophageal squamous cell carcinoma via regulation of miR-7/HOXB13. Cell Death Dis. 2018, 9, 838. [Google Scholar] [CrossRef] [Green Version]
- Zhu, G.; Chang, X.; Kang, Y.; Zhao, X.; Tang, X.; Ma, C.; Fu, S. CircRNA: A novel potential strategy to treat thyroid cancer (Review). Int. J. Mol. Med. 2021, 48, 201. [Google Scholar] [CrossRef] [PubMed]
- Hansen, T.B.; Kjems, J.; Damgaard, C.K. Circular RNA and miR-7 in Cancer. Cancer Res. 2013, 73, 5609–5612. [Google Scholar] [CrossRef] [Green Version]
- Jin, X.; Feng, C.-Y.; Xiang, Z.; Chen, Y.-P.; Li, Y.-M. CircRNA expression pattern and circRNA-miRNA-mRNA network in the pathogenesis of nonalcoholic steatohepatitis. Oncotarget 2016, 7, 66455–66467. [Google Scholar] [CrossRef] [Green Version]
- Zahari Sham, S.Y.; Abdullah, M.; Osman, M.; Seow, H.F. An insight of dysregulation of microRNAs in the pathogenesis of diabetic kidney disease. Malays. J. Pathol. 2022, 44, 187–201. [Google Scholar]
- Li, X.; Diao, H. Circular RNA circ_0001946 acts as a competing endogenous RNA to inhibit glioblastoma progression by modulating miR-671-5p and CDR1. J. Cell. Physiol. 2019, 234, 13807–13819. [Google Scholar] [CrossRef]
- Hu, W.; Han, Q.; Zhao, L.; Wang, L. Circular RNA circRNA_15698 aggravates the extracellular matrix of diabetic nephropathy mesangial cells via miR-185/TGF-β1. J. Cell. Physiol. 2019, 234, 1469–1476. [Google Scholar] [CrossRef]
- Tu, C.; Wang, L.; Wei, L.; Jiang, Z. The role of circular RNA in Diabetic Nephropathy. Int. J. Med. Sci. 2022, 19, 916–923. [Google Scholar] [CrossRef]
- Zhao, Z.; Li, X.; Jian, D.; Hao, P.; Rao, L.; Li, M. Hsa_circ_0054633 in peripheral blood can be used as a diagnostic biomarker of pre-diabetes and type 2 diabetes mellitus. Acta Diabetol. 2017, 54, 237–245. [Google Scholar] [CrossRef] [Green Version]
- Shi, R.; Jin, Y.; Hu, W.; Lian, W.; Cao, C.; Han, S.; Zhao, S.; Yuan, H.; Yang, X.; Shi, J.; et al. Exosomes derived from mmu_circ_0000250-modified adipose-derived mesenchymal stem cells promote wound healing in diabetic mice by inducing miR-128-3p/SIRT1-mediated autophagy. Am. J. Physiol. Cell Physiol. 2020, 318, C848–C856. [Google Scholar] [CrossRef]
- Yang, Z.-G.; Awan, F.M.; Du, W.W.; Zeng, Y.; Lyu, J.; Wu, D.; Gupta, S.; Yang, W.; Yang, B.B. The Circular RNA Interacts with STAT3, Increasing Its Nuclear Translocation and Wound Repair by Modulating Dnmt3a and miR-17 Function. Mol. Ther. 2017, 25, 2062–2074. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, D.; Liu, W.; Li, G.; Liu, L. Circ_PRKDC knockdown promotes skin wound healing by enhancing keratinocyte migration via miR-31/FBN1 axis. J. Mol. Histol. 2021, 52, 681–691. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Li, X.; Wang, H.; Wen, R.; He, J.; Tang, J. Epigenetic regulation of miR-129-2 and its effects on the proliferation and invasion in lung cancer cells. J. Cell. Mol. Med. 2015, 19, 2172–2180. [Google Scholar] [CrossRef] [PubMed]
- Wicks, K.; Torbica, T.; Umehara, T.; Amin, S.; Bobola, N.; Mace, K.A. Diabetes Inhibits Gr-1+ Myeloid Cell Maturation via Cebpa Deregulation. Diabetes 2015, 64, 4184–4197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, T.; Li, L.; Ye, B.; Chen, W.; Zheng, G.; Xie, H.; Guo, Y. Knockdown of hsa_circ_0005699 attenuates inflammation and apoptosis induced by ox-LDL in human umbilical vein endothelial cells through regulation of the miR-450b-5p/NFKB1 axis. Mol. Med. Rep. 2022, 26, 290. [Google Scholar] [CrossRef]
- Gao, L.; Shao, X.; Yue, Q.; Wu, W.; Yang, X.; He, X.; Li, L.; Hou, F.; Zhang, R. circAMOTL1L Suppresses Renal Cell Carcinoma Growth by Modulating the miR-92a-2-5p/KLLN Pathway. Oxidative Med. Cell. Longev. 2021, 2021, 9970272. [Google Scholar] [CrossRef] [PubMed]
Target gene | Primer | Sequence (5′-3′) | Base |
---|---|---|---|
mmu_circRNA_36800 | forward | GGGCGCTTTCTAGAAGAAGT | 20 |
reverse | CCAGAAGAATCATAAGCACATGG | 23 | |
mmu_circRNA_28348 | forward | TAGTTCACCGGCGGATTTAC | 20 |
reverse | TCTCAGGTGTTCCTTCTGACC | 21 | |
mmu_circRNA_29357 | forward | TTGCCTGTGATGAGTGTGGT | 20 |
reverse | TGGTTCAGCTGTAGCAGGAG | 20 | |
mmu_circRNA_37649 | forward | AGGTGCTGGTCCTACAGAGG | 20 |
reverse | TCTGTCCAGAAGCCCTTGTT | 20 | |
mmu_circRNA_20033 | forward | AGCCAATATAGCCTGGATGG | 20 |
reverse | CACTTCATGAGAACGGCTGA | 20 | |
mmu_circRNA_19765 | forward | CCCTCGCCAAACATTTTTAT | 20 |
reverse | GAGTGCAAAGGAAATGCCATA | 21 | |
mmu_circRNA_26402 | forward | CAGCAGCTGGAAAAGGATCT | 20 |
reverse | ATTTCTTCCATGGCAGCTTG | 20 |
circRNA | Source | Chrom | circRNA_Type | GeneSymbol | FC (abs) | Regulation | p-Value |
---|---|---|---|---|---|---|---|
mmu_circRNA_015487 | circBase | chr7 | exonic | Tead2 | 1.5407217 | up | 0.00990479 |
mmu_circRNA_41782 | 25714049 | chr7 | exonic | Hdgfrp3 | 1.7063881 | up | 0.04996231 |
mmu_circRNA_43177 | 25714049 | chr8 | exonic | Elmod2 | 1.5117275 | up | 0.04014974 |
mmu_circRNA_001389 | circBase | chr19 | antisense | Malat1 | 1.5153945 | down | 0.04172861 |
mmu_circRNA_34763 | 25714049 | chr2 | exonic | Syndig1 | 1.5506074 | down | 0.030088466 |
mmu_circRNA_41665 | 25714049 | chr7 | exonic | Chd2 | 1.6456881 | down | 0.013881577 |
mmu_circRNA_19188 | 25070500 | chr17 | intronic | 1.6756403 | down | 0.039428327 | |
mmu_circRNA_22278 | 25714049 | chr10 | exonic | Dot1l | 1.5997135 | down | 0.005037364 |
mmu_circRNA_28776 | 25714049 | chr15 | sense overlapping | Mroh4 | 1.5055119 | down | 0.034069477 |
circRNA | MRE1 | MRE2 | MRE3 | MRE4 | MRE5 |
---|---|---|---|---|---|
mmu_circRNA_001389 | mmu-miR-7085-3p | mmu-miR-450b-5p | mmu-miR-7664-3p | mmu-miR-6982-3p | mmu-miR-1948-3p |
mmu_circRNA_34763 | mmu-miR-7656-3p | mmu-miR-6926-3p | mmu-miR-3077-3p | mmu-miR-7033-5p | mmu-miR-7017-3p |
mmu_circRNA_41665 | mmu-miR-6932-3p | mmu-miR-6946-3p | mmu-miR-6908-3p | mmu-miR-6961-3p | mmu-miR-6957-3p |
mmu_circRNA_19188 | mmu-miR-5110 | mmu-miR-6953-5p | mmu-miR-1249-5p | mmu-miR-6981-5p | mmu-miR-346-3p |
mmu_circRNA_22278 | mmu-miR-6931-5p | mmu-miR-7048-5p | mmu-miR-7682-3p | mmu-miR-92a-2-5p | mmu-miR-7036b-5p |
mmu_circRNA_28776 | mmu-miR-6896-3p | mmu-miR-7000-5p | mmu-miR-5615-5p | mmu-miR-6989-5p | mmu-miR-6987-5p |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Umehara, T.; Mori, R.; Mace, K.A.; Tanaka, K.; Sakamoto, N.; Ikematsu, K.; Sato, H. circRNAs May Be Involved in Dysfunction of Neutrophils of Type 2 Diabetic Mice through Regulation of Specific miRNAs. Biomedicines 2022, 10, 3129. https://doi.org/10.3390/biomedicines10123129
Umehara T, Mori R, Mace KA, Tanaka K, Sakamoto N, Ikematsu K, Sato H. circRNAs May Be Involved in Dysfunction of Neutrophils of Type 2 Diabetic Mice through Regulation of Specific miRNAs. Biomedicines. 2022; 10(12):3129. https://doi.org/10.3390/biomedicines10123129
Chicago/Turabian StyleUmehara, Takahiro, Ryoichi Mori, Kimberly A. Mace, Katsumi Tanaka, Noriho Sakamoto, Kazuya Ikematsu, and Hiroaki Sato. 2022. "circRNAs May Be Involved in Dysfunction of Neutrophils of Type 2 Diabetic Mice through Regulation of Specific miRNAs" Biomedicines 10, no. 12: 3129. https://doi.org/10.3390/biomedicines10123129