Role of Nivolumab in the Modulation of PD-1 and PD-L1 Expression in Papillary and Clear Cell Renal Carcinoma (RCC)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. RNA Isolation/RT- and q-PCR
2.3. Western Blot Analysis
2.4. Cell Viability Assay
2.5. Scratch Assay
2.6. Spheroid Formation
2.7. Cath B Activity
3. Results
3.1. Intrinsic Expression of PD-1 and PD-L1
3.2. AKT and S6 Activation
3.3. Contribution of Nivolumab to Metabolic Activity
3.4. Motility of Renal Carcinoma Cell Lines
3.5. Spheroid Formation
3.6. Cath B Expression and Activity
3.7. AR Expression
4. Discussion
5. Conclusions
6. Limitations
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Muglia, V.F.; Prando, A. Renal cell carcinoma: Histological classification and correlation with imaging findings. Radiol. Bras. 2015, 48, 166–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ciarimboli, G.; Theil, G.; Bialek, J.; Edemir, B. Contribution and expression of organic cation transporters and aquaporin water channels in renal cancer. Rev. Physiol. Biochem. Pharmacol. 2020, 181, 81–104. [Google Scholar] [CrossRef]
- Johnson, D.B.; Sullivan, R.J.; Menzies, A.M. Immune checkpoint inhibitors in challenging populations. Cancer 2017, 123, 1904–1911. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferrara, R.; Mezquita, L.; Texier, M.; Lahmar, J.; Audigier-Valette, C.; Tessonnier, L.; Mazieres, J.; Zalcman, G.; Brosseau, S.; Le Moulec, S.; et al. Hyperprogressive disease in patients with advanced non-small cell lung cancer treated with PD-1/PD-L1 inhibitors or with single-agent chemotherapy. JAMA Oncol. 2018, 4, 1543–1552. [Google Scholar] [CrossRef]
- Kurman, J.S.; Murgu, S.D. Hyperprogressive disease in patients with non-small cell lung cancer on immunotherapy. J. Thorac. Dis. 2018, 10, 1124–1128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, Q.; Diao, Y.; Sun, X.; Zhou, Y.; Ran, J.; Zhang, J. Evaluation of tyrosine kinase inhibitors combined with antiprogrammed cell death protein 1 antibody in tyrosine kinase inhibitor-responsive patients with microsatellite stable/proficient mismatch repair metastatic colorectal adenocarcinoma: Protocol for open-label, single-arm trial. BMJ Open 2022, 12, e049992. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Yang, X.; Zhang, C.; Wang, Y.; Cheng, T.; Duan, L.; Tong, Z.; Tan, S.; Zhang, H.; Saw, P.E.; et al. Tumor cell-intrinsic PD-1 receptor is a tumor suppressor and mediates resistance to PD-1 blockade therapy. Proc. Natl. Acad. Sci. USA 2020, 117, 6640–6650. [Google Scholar] [CrossRef]
- Han, Y.; Liu, D.; Li, L. PD-1/PD-L1 pathway: Current researches in cancer. Am. J. Cancer Res. 2020, 10, 727–742. [Google Scholar]
- Czarnecka, A.M.; Niedzwiedzka, M.; Porta, C.; Szczylik, C. Hormone signaling pathways as treatment targets in renal cell cancer (Review). Int. J. Oncol. 2016, 48, 2221–2235. [Google Scholar] [CrossRef] [Green Version]
- Pisano, C.; Tucci, M.; Di Stefano, R.F.; Turco, F.; Scagliotti, G.V.; Di Maio, M.; Buttigliero, C. Interactions between androgen receptor signaling and other molecular pathways in prostate cancer progression: Current and future clinical implications. Crit. Rev. Oncol. Hematol. 2021, 157, 103185. [Google Scholar] [CrossRef]
- Boorjian, S.; Ugras, S.; Mongan, N.P.; Gudas, L.J.; You, X.; Tickoo, S.K.; Scherr, D.S. Androgen receptor expression is inversely correlated with pathologic tumor stage in bladder cancer. Urology 2004, 64, 383–388. [Google Scholar] [CrossRef]
- Gonzalez, L.O.; Corte, M.D.; Vazquez, J.; Junquera, S.; Sanchez, R.; Alvarez, A.C.; Rodriguez, J.C.; Lamelas, M.L.; Vizoso, F.J. Androgen receptor expresion in breast cancer: Relationship with clinicopathological characteristics of the tumors, prognosis, and expression of metalloproteases and their inhibitors. BMC Cancer 2008, 8, 149. [Google Scholar] [CrossRef] [Green Version]
- Corbishley, T.P.; Iqbal, M.J.; Wilkinson, M.L.; Williams, R. Androgen receptor in human normal and malignant pancreatic tissue and cell lines. Cancer 1986, 57, 1992–1995. [Google Scholar] [CrossRef]
- Zhang, H.; Li, X.X.; Yang, Y.; Zhang, Y.; Wang, H.Y.; Zheng, X.F.S. Significance and mechanism of androgen receptor overexpression and androgen receptor/mechanistic target of rapamycin cross-talk in hepatocellular carcinoma. Hepatology 2018, 67, 2271–2286. [Google Scholar] [CrossRef] [Green Version]
- Zhu, H.; Zhu, X.; Zheng, L.; Hu, X.; Sun, L.; Zhu, X. The role of the androgen receptor in ovarian cancer carcinogenesis and its clinical implications. Oncotarget 2017, 8, 29395–29405. [Google Scholar] [CrossRef] [Green Version]
- Yuan, Y.; Lee, J.S.; Yost, S.E.; Frankel, P.H.; Ruel, C.; Egelston, C.A.; Guo, W.; Gillece, J.D.; Folkerts, M.; Reining, L.; et al. A Phase II Clinical Trial of Pembrolizumab and Enobosarm in Patients with Androgen Receptor-Positive Metastatic Triple-Negative Breast Cancer. Oncologist 2021, 26, 99-e217. [Google Scholar] [CrossRef]
- Bennett, N.C.; Rajandram, R.; Ng, K.L.; Gobe, G.C. Evaluation of steroid hormones and their receptors in development and progression of renal cell carcinoma. J. Kidney Cancer VHL 2014, 1, 17–25. [Google Scholar] [CrossRef] [Green Version]
- Zhu, G.; Liang, L.; Li, L.; Dang, Q.; Song, W.; Yeh, S.; He, D.; Chang, C. The expression and evaluation of androgen receptor in human renal cell carcinoma. Urology 2014, 83, 510.e19–510.e24. [Google Scholar] [CrossRef]
- Langner, C.; Ratschek, M.; Rehak, P.; Schips, L.; Zigeuner, R. Steroid hormone receptor expression in renal cell carcinoma: An immunohistochemical analysis of 182 tumors. J. Urol. 2004, 171, 611–614. [Google Scholar] [CrossRef]
- Bialek, J.; Piwonka, M.; Kawan, F.; Fornara, P.; Theil, G. Differential expression of the androgen receptor, splice variants and relaxin 2 in renal cancer. Life 2021, 11, 731. [Google Scholar] [CrossRef] [PubMed]
- Jiang, G.; Shi, L.; Zheng, X.; Zhang, X.; Wu, K.; Liu, B.; Yan, P.; Liang, X.; Yu, T.; Wang, Y.; et al. Androgen receptor affects the response to immune checkpoint therapy by suppressing PD-L1 in hepatocellular carcinoma. Aging 2020, 12, 11466–11484. [Google Scholar] [CrossRef] [PubMed]
- O’Connell, T.J.; Dadafarin, S.; Jones, M.; Rodríguez, T.; Gupta, A.; Shin, E.; Moscatello, A.; Iacob, C.; Islam, H.; Tiwari, R.K.; et al. Androgen Activity Is Associated With PD-L1 Downregulation in Thyroid Cancer. Front. Cell Dev. Biol. 2021, 9, 663130. [Google Scholar] [CrossRef] [PubMed]
- Guan, X.; Polesso, F.; Wang, C.; Sehrawat, A.; Hawkins, R.M.; Murray, S.E.; Thomas, G.V.; Caruso, B.; Thompson, R.F.; Wood, M.A.; et al. Androgen receptor activity in T cells limits checkpoint blockade efficacy. Nature 2022, 606, 791–796. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.H.; Bhasin, S.; Khanna, P.; Joshi, M.; Joslin, P.M.; Saxena, R.; Amin, S.; Liu, S.; Sindhu, S.; Walker, S.R.; et al. Study of cathepsin B inhibition in VEGFR TKI treated human renal cell carcinoma xenografts. Oncogenesis 2019, 8, 15. [Google Scholar] [CrossRef] [Green Version]
- Gondi, C.S.; Rao, J.S. Cathepsin B as a cancer target. Expert Opin. Ther. Targets 2013, 17, 281–291. [Google Scholar] [CrossRef] [Green Version]
- Shree, T.; Olson, O.C.; Elie, B.T.; Kester, J.C.; Garfall, A.L.; Simpson, K.; Bell-McGuinn, K.M.; Zabor, E.C.; Brogi, E.; Joyce, J.A. Macrophages and cathepsin proteases blunt chemotherapeutic response in breast cancer. Genes Dev. 2011, 25, 2465–2479. [Google Scholar] [CrossRef] [Green Version]
- Antonarakis, S.E.; Lu, C.; Wang, H.; Luber, B.; Nakazawa, M.; Roeser, J.C.; Chen, Y.; Mohammad, T.A.; Chen, Y.; Fedor, H.L.; et al. AR-V7 and resistance to enzalutamide and abiraterone in prostate cancer. N. Engl. J. Med. 2014, 371, 1028–1038. [Google Scholar] [CrossRef] [Green Version]
- Xia, H.; Hu, C.; Bai, S.; Lyu, J.; Zhang, B.Y.; Yu, X.; Zhan, Y.; Zhao, L.; Dong, Y. Raddeanin A down-regulates androgen receptor and its splice variants in prostate cancer. J. Cell. Mol. Med. 2019, 23, 3656–3664. [Google Scholar] [CrossRef]
- Motzer, R.J.; Escudier, B.; McDermott, D.F.; George, S.; Hammers, H.J.; Srinivas, S.; Tykodi, S.S.; Sosman, J.A.; Procopio, G.; Plimack, E.R.; et al. Nivolumab versus everolimus in advanced renal-cell carcinoma. N. Engl. J. Med. 2015, 373, 1803–1813. [Google Scholar] [CrossRef] [Green Version]
- Ishida, Y.; Agata, Y.; Shibahara, K.; Honjo, T. Induced expression of PD-1, a novel member of the immunoglobulin gene superfamily, upon programmed cell death. EMBO J. 1992, 11, 3887–3895. [Google Scholar] [CrossRef]
- Kleffel, S.; Posch, C.; Barthel, S.R.; Mueller, H.; Schlapbach, C.; Guenova, E.; Elco, C.P.; Lee, N.; Juneja, V.R.; Zhan, Q.; et al. Melanoma cell-intrinsic PD-1 receptor functions promote tumor growth. Cell 2015, 162, 1242–1256. [Google Scholar] [CrossRef] [Green Version]
- Du, S.; McCall, N.; Park, K.; Guan, Q.; Fontina, P.; Ertel, A.; Zhan, T.; Dicker, A.P.; Lu, B. Blockade of Tumor-Expressed PD-1 promotes lung cancer growth. Oncoimmunology 2018, 7, e1408747. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Li, X.; Liu, S.; Guo, L.; Zhang, B.; Zhang, J.; Ye, Q. Programmed cell death-1 (PD-1) checkpoint blockade in combination with a mammalian target of rapamycin inhibitor restrains hepatocellular carcinoma growth induced by hepatoma cell-intrinsic PD-1. Hepatology 2017, 66, 1920–1933. [Google Scholar] [CrossRef] [Green Version]
- Vogelzang, N.J.; Olsen, M.R.; McFarlane, J.J.; Arrowsmith, E.; Bauer, T.M.; Jain, R.K.; Somer, B.; Lam, E.T.; Kochenderfer, M.D.; Molina, A.; et al. Safety and Efficacy of Nivolumab in Patients With Advanced Non-Clear Cell Renal Cell Carcinoma: Results From the Phase IIIb/IV CheckMate 374 Study. Clin. Genitourin. Cancer 2020, 18, 461–468.e3. [Google Scholar] [CrossRef]
- Tykodi, S.S.; Gordan, L.N.; Alter, R.S.; Arrowsmith, E.; Harrison, M.R.; Percent, I.; Singal, R.; Van Veldhuizen, P.; George, D.J.; Hutson, T.; et al. Safety and efficacy of nivolumab plus ipilimumab in patients with advanced non-clear cell renal cell carcinoma: Results from the phase 3b/4 CheckMate 920 trial. J. Immunother. Cancer 2022, 10, e003844. [Google Scholar] [CrossRef]
- Denize, T.; Hou, Y.; Pignon, J.C.; Walton, E.; West, D.J.; Freeman, G.J.; Braun, D.A.; Wu, C.J.; Gupta, S.; Motzer, R.J.; et al. Transcriptomic correlates of tumor cell PD-L1 expression and response to nivolumab monotherapy in metastatic clear cell renal cell carcinoma. Clin. Cancer Res. 2022, 28, 4045–4055. [Google Scholar] [CrossRef]
- Yao, H.; Wang, H.; Li, C.; Fang, J.Y.; Xu, J. Cancer cell-intrinsic PD-1 and implications in combinatorial immunotherapy. Front. Immunol. 2018, 9, 1774. [Google Scholar] [CrossRef] [Green Version]
- Sun, S.Y. Searching for the real function of mTOR signaling in the regulation of PD-L1 expression. Transl. Oncol. 2020, 13, 100847. [Google Scholar] [CrossRef]
- Hager, M.; Haufe, H.; Alinger, B.; Kolbitsch, C. pS6 expression in normal renal parenchyma, primary renal cell carcinomas and their metastases. Pathol. Oncol. Res. 2012, 18, 277–283. [Google Scholar] [CrossRef]
- Jung, E.J.; Suh, J.H.; Kim, W.H.; Kim, H.S. Clinical significance of PI3K/Akt/mTOR signaling in gastric carcinoma. Int. J. Clin. Exp. Pathol. 2020, 13, 995–1007. [Google Scholar] [PubMed]
- Muñoz-Cordero, M.G.; López, F.; García-Inclán, C.; López-Hernández, A.; Potes-Ares, S.; Fernández-Vañes, L.; Llorente, J.L.; Hermsen, M. Predictive value of EGFR-PI3K-pAKT-mTOR-pS6 pathway in sinonasal squamous cell carcinomas. Acta Otorrinolaringol. Esp. (Engl. Ed.) 2019, 70, 16–24. [Google Scholar] [CrossRef] [PubMed]
- Yun, F.; Jia, Y.; Li, X.; Yuan, L.; Sun, Q.; Yu, H.; Shi, L.; Yuan, H. Clinicopathological significance of PTEN and PI3K/AKT signal transduction pathway in non-small cell lung cancer. Int. J. Clin. Exp. Pathol. 2013, 6, 2112–2120. [Google Scholar] [PubMed]
- Mukohara, T.; Kudoh, S.; Matsuura, K.; Yamauchi, S.; Kimura, T.; Yoshimura, N.; Kanazawa, H.; Hirata, K.; Inoue, K.; Wanibuchi, H.; et al. Activated Akt expression has significant correlation with EGFR and TGF-alpha expressions in stage I NSCLC. Anticancer Res. 2004, 24, 11–17. [Google Scholar] [PubMed]
- Dong, L.; Lv, H.; Li, W.; Song, Z.; Li, L.; Zhou, S.; Qiu, L.; Qian, Z.; Liu, X.; Feng, L.; et al. Co-expression of PD-L1 and p-AKT is associated with poor prognosis in diffuse large B-cell lymphoma via PD-1/PD-L1 axis activating intracellular AKT/mTOR pathway in tumor cells. Oncotarget 2016, 7, 33350–33362. [Google Scholar] [CrossRef] [PubMed]
- Niture, S.; Tricoli, L.; Qi, Q.; Gadi, S.; Hayes, K.; Kumar, D. MicroRNA-99b-5p targets mTOR/AR axis, induces autophagy and inhibits prostate cancer cell proliferation. Tumour Biol. 2022, 44, 107–127. [Google Scholar] [CrossRef]
- Mijanović, O.; Branković, A.; Panin, A.N.; Savchuk, S.; Timashev, P.; Ulasov, I.; Lesniak, M.S. Cathepsin B: A sellsword of cancer progression. Cancer Lett. 2019, 449, 207–214. [Google Scholar] [CrossRef] [Green Version]
- Rudzinska-Radecka, M.; Frolova, A.S.; Balakireva, A.V.; Gorokhovets, N.V.; Pokrovsky, V.S.; Sokolova, D.V.; Korolev, D.O.; Potoldykova, N.V.; Vinarov, A.Z.; Parodi, A.; et al. In silico, in vitro, and clinical investigations of cathepsin B and stefin A mRNA expression and a correlation analysis in kidney cancer. Cells 2022, 11, 1455. [Google Scholar] [CrossRef]
- Fontes-Sousa, M.; Magalhães, H.; Oliveira, A.; Carneiro, F.; Dos Reis, F.P.; Madeira, P.S.; Meireles, S. Reviewing Treatment Options for Advanced Renal Cell Carcinoma: Is There Still a Place for Tyrosine Kinase Inhibitor (TKI) Monotherapy? Adv. Ther. 2022, 39, 1107–1125. [Google Scholar] [CrossRef]
- Lim, A.R.; Vincent, B.G.; Weaver, A.M.; Rathmell, W.K. Sunitinib and Axitinib increase secretion and glycolytic activity of small extracellular vesicles in renal cell carcinoma. Cancer Gene Ther. 2022, 29, 683–696. [Google Scholar] [CrossRef]
Target | Primer | Product Length (bp) |
---|---|---|
AR-FL * | F: CAGCCTATTGCGAGAGAGCTG | 73 |
R: GAAAGGATCTTGGGCACTTGC | ||
AR-V1 | F: AGGGAAAAAGGGCCGAGCTA | 185 |
R: TCCTCCGAGTCTTTAGCAGC | ||
AR-V3 | F: AAGAGCCGCTGAAGGGAAAC | 199 |
R: AGGCAAGTCAGCCTTTCTTCA | ||
AR-V4 | F: CTCTCAGCTGCTCATCCACA | 74 |
R: GGTTTTCAAATGCAGCCAGGA | ||
AR-V7 ** | F: AAAAGAGCCGCTGAAGGGAA | 150 |
R: GCCAACCCGGAATTTTTCTCC | ||
β-Actin | F: ATTGCCGACAGGATGCAGAA | 150 |
R: GCTGATCCACATCTGCTGGAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bialek, J.; Yankulov, S.; Kawan, F.; Fornara, P.; Theil, G. Role of Nivolumab in the Modulation of PD-1 and PD-L1 Expression in Papillary and Clear Cell Renal Carcinoma (RCC). Biomedicines 2022, 10, 3244. https://doi.org/10.3390/biomedicines10123244
Bialek J, Yankulov S, Kawan F, Fornara P, Theil G. Role of Nivolumab in the Modulation of PD-1 and PD-L1 Expression in Papillary and Clear Cell Renal Carcinoma (RCC). Biomedicines. 2022; 10(12):3244. https://doi.org/10.3390/biomedicines10123244
Chicago/Turabian StyleBialek, Joanna, Stefan Yankulov, Felix Kawan, Paolo Fornara, and Gerit Theil. 2022. "Role of Nivolumab in the Modulation of PD-1 and PD-L1 Expression in Papillary and Clear Cell Renal Carcinoma (RCC)" Biomedicines 10, no. 12: 3244. https://doi.org/10.3390/biomedicines10123244