Saikosaponin-b2 Inhibits Primary Liver Cancer by Regulating the STK4/IRAK1/NF-κB Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Drugs and Reagents
2.2. Animals and Ethics Statement
2.3. Cell Culture
2.4. Cell Viability Assay
2.5. Nitrite Detection
2.6. Establishment of Primary Liver Cancer Model in Mice
2.7. Serum Liver Function Test
2.8. Hematoxylin and Eosin Staining (H&E)
2.9. Immunohistochemistry Staining
2.10. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
2.11. HepG2 Cell Culture and siRNA Transfection
2.12. Western Blot Analysisblot Analysis
2.13. Statistical Analysis
3. Results
3.1. Effect of Saikosaponin-b2 on Liver Function in Primary Liver Cancer Mice
3.2. Antitumor Effect of Saikosaponin-b2 in Primary Liver Cancer Mice
3.3. Effect of Saikosaponin-b2 on Ki67 in Primary Liver Cancer Mice
3.4. Effect of Saikosaponin-b2 on the Expressions of STK4 and IRAK1 in Primary Liver Cancer Mice
3.5. Effect of Saikosaponin-b2 on STK4 Expression and IRAK1/NF-κB Signaling Axis In Vivo
3.6. Effect of Saikosaponin-b2 on the Expressions of STK4, IRAK1 and NF-κB Proteins in HepG2 Cells
3.7. Effects of Saikosaponin-b2 on the IRAK1/NF-κB Signaling Axis by Targeting STK4
3.8. Effect of Saikosaponin-b2 on LPS-Induced Viability and Nitric Oxide Secretion in RAW 264.7 Macrophages
3.9. Anti-Inflammatory Effect of Saikosaponin-b2 on LPS-Stimulated RAW 264.7 Macrophages
3.10. Effect of SS-b2 on the Expressions of STK4, IRAK1, and NF-κB Proteins in LPS-Stimulated RAW 264.7 Macrophages
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jiang, D.; Zhang, L.; Liu, W.; Ding, Y.; Yin, J.; Ren, R.; Li, Q.; Chen, Y.; Shen, J.; Tan, X.; et al. Trends in cancer mortality in China from 2004 to 2018: A nationwide longitudinal study. Cancer Commun. 2021, 41, 1024–1036. [Google Scholar] [CrossRef] [PubMed]
- Rumgay, H.; Arnold, M.; Ferlay, J.; Lesi, O.; Cabasag, C.J.; Vignat, J.; Laversanne, M.; McGlynn, K.A.; Soerjomataram, I. Global burden of primary liver cancer in 2020 and predictions to 2040. J. Hepatol. 2022, 77, 1598–1606. [Google Scholar] [CrossRef]
- Samant, H.; Amiri, H.S.; Zibari, G.B. Addressing the worldwide hepatocellular carcinoma: Epidemiology, prevention and management. J. Gastrointest. Oncol. 2021, 12 (Suppl. 2), S361–S373. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Wu, L.; Yan, G.; Chen, Y.; Zhou, M.; Wu, Y.; Li, Y. Inflammation and tumor progression: Signaling pathways and targeted intervention. Signal Transduct. Target. Ther. 2021, 6, 263. [Google Scholar] [CrossRef] [PubMed]
- Xun, Y.; Yang, H.; Kaminska, B.; You, H. Toll-like receptors and toll-like receptor-targeted immunotherapy against glioma. J. Hematol. Oncol. 2021, 14, 176. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Qiao, Q.; Ferrao, R.; Shen, C.; Hatcher, J.M.; Buhrlage, S.J.; Gray, N.S.; Wu, H. Crystal structure of human IRAK1. Proc. Natl. Acad. Sci. USA 2017, 114, 13507–13512. [Google Scholar] [CrossRef] [PubMed]
- Xiong, Y.; Tang, R.; Xu, J.; Jiang, W.; Gong, Z.; Zhang, L.; Ning, Y.; Huang, P.; Xu, J.; Chen, G.; et al. Tongxinluo-pretreated mesenchymal stem cells facilitate cardiac repair via exosomal transfer of miR-146a-5p targeting IRAK1/NF-κB p65 pathway. Stem Cell Res. Ther. 2022, 13, 289. [Google Scholar] [CrossRef]
- Yimlamai, D.; Fowl, B.H.; Camargo, F.D. Emerging evidence on the role of the Hippo/YAP pathway in liver physiology and cancer. J. Hepatol. 2015, 63, 1491–1501. [Google Scholar] [CrossRef]
- Lu, L.; Li, Y.; Kim, S.M.; Bossuyt, W.; Liu, P.; Qiu, Q.; Wang, Y.; Halder, G.; Finegold, M.J.; Lee, J.-S.; et al. Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. Proc. Natl. Acad. Sci. USA 2010, 107, 1437–1442. [Google Scholar] [CrossRef]
- Kim, W.; Khan, S.K.; Liu, Y.; Xu, R.; Park, O.; He, Y.; Cha, B.; Gao, B.; Yang, Y. Hepatic Hippo signaling inhibits protumoural microenvironment to suppress hepatocellular carcinoma. Gut 2018, 67, 1692–1703. [Google Scholar] [CrossRef]
- Li, W.; Xiao, J.; Zhou, X.; Xu, M.; Hu, C.; Xu, X.; Lu, Y.; Liu, C.; Xue, S.; Nie, L.; et al. STK4 regulates TLR pathways and protects against chronic inflammation–related hepatocellular carcinoma. J. Clin. Investig. 2015, 125, 4239–4254. [Google Scholar] [CrossRef] [PubMed]
- Song, C.; Gu, X.; Li, R. Expression of IRAK1 in Hepatocellular Carcinoma, Its Clinical Significance, and Docking Characteristics with Selected Natural Compounds. Curr. Oncol. 2022, 29, 8904–8916. [Google Scholar] [CrossRef] [PubMed]
- Chang, G.-R.; Lin, W.-L.; Lin, T.-C.; Liao, H.-J.; Lu, Y.-W. The Ameliorative Effects of Saikosaponin in Thioacetamide-Induced Liver Injury and Non-Alcoholic Fatty Liver Disease in Mice. Int. J. Mol. Sci. 2021, 22, 11383. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Shi, W.; He, X.-Y.; Du, Q.-Y.; Wang, F.; Guo, J. Saikosaponin D: Review on the antitumour effects, toxicity and pharmacokinetics. Pharm. Biol. 2021, 59, 1478–1487. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.-Y.; Chen, J.-B.; Liu, Y.-Y.; Zhou, X.-M.; Zhang, M.; Jiang, Y.-M.; Ma, Q.-Y.; Xue, Z.; Zhao, Z.-Y.; Li, X.-J.; et al. Saikosaponin D exerts antidepressant effect by regulating Homer1-mGluR5 and mTOR signaling in a rat model of chronic unpredictable mild stress. Chin. Med. 2022, 17, 60. [Google Scholar] [CrossRef]
- Li, X.; Li, X.; Huang, N.; Liu, R.; Sun, R. A comprehensive review and perspectives on pharmacology and toxicology of saikosaponins. Phytomedicine 2018, 50, 73–87. [Google Scholar] [CrossRef]
- Chen, Y.; Que, R.; Zhang, N.; Lin, L.; Zhou, M.; Li, Y. Saikosaponin-d alleviates hepatic fibrosis through regulating GPER1/autophagy signaling. Mol. Biol. Rep. 2021, 48, 7853–7863. [Google Scholar] [CrossRef]
- You, M.; Fu, J.; Lv, X.; Wang, L.; Wang, H.; Li, R. Saikosaponin b2 inhibits tumor angiogenesis in liver cancer via down-regulation of VEGF/ERK/HIF-1α signaling. Oncol. Rep. 2023, 50, 136. [Google Scholar] [CrossRef]
- Shang, N.; Bank, T.; Ding, X.; Breslin, P.; Li, J.; Shi, B.; Qiu, W. Caspase-3 suppresses diethylnitrosamine-induced hepatocyte death, compensatory proliferation and hepatocarcinogenesis through inhibiting p38 activation. Cell Death Dis. 2018, 9, 558. [Google Scholar] [CrossRef]
- Gomaa, A.I.; Al-Khatib, A.; Abdel-Razek, W.; Hashim, M.S.; Waked, I. Ascites and alpha-fetoprotein improve prognostic performance of Barcelona Clinic Liver Cancer staging. World J. Gastroenterol. 2015, 21, 5654–5662. [Google Scholar] [CrossRef]
- Kim, Y.-I.; Kim, H.S.; Park, J.-W. Higher Ratio of Serum Alpha-Fetoprotein Could Predict Outcomes in Patients with Hepatitis B Virus-Associated Hepatocellular Carcinoma and Normal Alanine Aminotransferase. PLoS ONE 2016, 11, e0157299. [Google Scholar] [CrossRef] [PubMed]
- Sawong, S.; Pekthong, D.; Suknoppakit, P.; Winitchaikul, T.; Kaewkong, W.; Somran, J.; Intapa, C.; Parhira, S.; Srisawang, P. Calotropis gigantea stem bark extracts inhibit liver cancer induced by diethylnitrosamine. Sci. Rep. 2022, 12, 12151. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Luo, C.; Wang, P.; He, Q.; Zhou, J.; Peng, H. Saikosaponin A mediates the inflammatory response by inhibiting the MAPK and NF-κB pathways in LPS-stimulated RAW 264.7 cells. Exp. Ther. Med. 2013, 5, 1345–1350. [Google Scholar] [CrossRef] [PubMed]
- Grivennikov, S.I.; Greten, F.R.; Karin, M. Immunity, inflammation, and cancer. Cell 2010, 140, 883–899. [Google Scholar] [CrossRef]
- Changizi, Z.; Moslehi, A.; Rohani, A.H.; Eidi, A. Chlorogenic acid induces 4T1 breast cancer tumor’s apoptosis via p53, Bax, Bcl-2, and caspase-3 signaling pathways in BALB/c mice. J. Biochem. Mol. Toxicol. 2021, 35, e22642. [Google Scholar] [CrossRef]
- Gao, M.; Li, X.; He, L.; Yang, J.; Ye, X.; Xiao, F.; Wei, H. Diammonium Glycyrrhizinate Mitigates Liver Injury Via Inhibiting Proliferation Of NKT Cells And Promoting Proliferation Of Tregs. Drug Des. Dev. Ther. 2019, 13, 3579–3589. [Google Scholar] [CrossRef]
- Singh, N.; Baby, D.; Rajguru, J.P.; Patil, P.B.; Thakkannavar, S.S.; Pujari, V.B. Inflammation and cancer. Ann. Afr. Med. 2019, 18, 121–126. [Google Scholar] [CrossRef]
- Ritter, B.; Greten, F.R. Modulating inflammation for cancer therapy. J. Exp. Med. 2019, 216, 1234–1243. [Google Scholar] [CrossRef]
- Yang, C.; Zhang, J.; Ding, M.; Xu, K.; Li, L.; Mao, L.; Zheng, J. Ki67 targeted strategies for cancer therapy. Clin. Transl. Oncol. 2018, 20, 570–575. [Google Scholar] [CrossRef]
- Wang, X.; Wang, Q. Alpha-Fetoprotein and Hepatocellular Carcinoma Immunity. Can. J. Gastroenterol. Hepatol. 2018, 2018, 9049252. [Google Scholar] [CrossRef]
- Zhang, W.; Zhangyuan, G.; Wang, F.; Jin, K.; Shen, H.; Zhang, L.; Yuan, X.; Wang, J.; Zhang, H.; Yu, W.; et al. The zinc finger protein Miz1 suppresses liver tumorigenesis by restricting hepatocyte-driven macrophage activation and inflammation. Immunity 2021, 54, 1168–1185.e8. [Google Scholar] [CrossRef] [PubMed]
- Zhou, D.; Conrad, C.; Xia, F.; Park, J.-S.; Payer, B.; Yin, Y.; Lauwers, G.Y.; Thasler, W.; Lee, J.T.; Avruch, J.; et al. Mst1 and Mst2 Maintain Hepatocyte Quiescence and Suppress Hepatocellular Carcinoma Development through Inactivation of the Yap1 Oncogene. Cancer Cell 2009, 16, 425–438. [Google Scholar] [CrossRef] [PubMed]
- Singer, J.W.; Fleischman, A.; Al-Fayoumi, S.; Mascarenhas, J.O.; Yu, Q.; Agarwal, A. Inhibition of interleukin-1 receptor-associated kinase 1 (IRAK1) as a therapeutic strategy. Oncotarget 2018, 9, 33416–33439. [Google Scholar] [CrossRef] [PubMed]
- Galan, J.A.; Avruch, J. MST1/MST2 Protein Kinases: Regulation and Physiologic Roles. Biochemistry 2016, 55, 5507–5519. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Liu, C.; Tan, H.; Li, Y.; Nguyen, T.-L.M.; Dhungana, Y.; Guy, C.; Vogel, P.; Neale, G.; Rankin, S.; et al. Hippo Kinases Mst1 and Mst2 Sense and Amplify IL-2R-STAT5 Signaling in Regulatory T Cells to Establish Stable Regulatory Activity. Immunity 2018, 49, 899–914.e6. [Google Scholar] [CrossRef]
- Wu, H.; Wei, L.; Fan, F.; Ji, S.; Zhang, S.; Geng, J.; Hong, L.; Fan, X.; Chen, Q.; Tian, J.; et al. Integration of Hippo signalling and the unfolded protein response to restrain liver overgrowth and tumorigenesis. Nat. Commun. 2015, 6, 6239. [Google Scholar] [CrossRef]
- Lee, I.Y.; Lim, J.M.; Cho, H.; Kim, E.; Kim, Y.; Oh, H.-K.; Yang, W.S.; Roh, K.-H.; Park, H.W.; Mo, J.-S.; et al. MST1 Negatively Regulates TNFα-Induced NF-κB Signaling through Modulating LUBAC Activity. Mol. Cell 2019, 73, 1138–1149.e6. [Google Scholar] [CrossRef]
- Wee, Z.N.; Yatim, S.M.J.M.; Kohlbauer, V.K.; Feng, M.; Goh, J.Y.; Bao, Y.; Lee, P.L.; Zhang, S.; Wang, P.P.; Lim, E.; et al. IRAK1 is a therapeutic target that drives breast cancer metastasis and resistance to paclitaxel. Nat. Commun. 2015, 6, 8746. [Google Scholar] [CrossRef]
- Cutolo, M.; Campitiello, R.; Gotelli, E.; Soldano, S. The Role of M1/M2 Macrophage Polarization in Rheumatoid Arthritis Synovitis. Front. Immunol. 2022, 13, 867260. [Google Scholar] [CrossRef]
- Goldberg, E.L.; Shaw, A.C.; Montgomery, R.R. How Inflammation Blunts Innate Immunity in Aging. In Vaccines for Older Adults: Current Practices and Future Opportunities; Interdisciplinary Topics in Gerontology and Geriatrics Series; Karger Publishers: Basel, Switzerland, 2020; Volume 43, pp. 1–17. [Google Scholar] [CrossRef]
- Haabeth, O.A.W.; Lorvik, K.B.; Hammarström, C.; Donaldson, I.M.; Haraldsen, G.; Bogen, B.; Corthay, A. Inflammation driven by tumour-specific Th1 cells protects against B-cell cancer. Nat. Commun. 2011, 2, 240. [Google Scholar] [CrossRef]
- Noy, R.; Pollard, J.W. Tumor-associated macrophages: From mechanisms to therapy. Immunity 2014, 41, 49–61. [Google Scholar] [CrossRef] [PubMed]
- Franklin, R.A.; Li, M.O. Ontogeny of Tumor-Associated Macrophages and Its Implication in Cancer Regulation. Trends Cancer 2016, 2, 20–34. [Google Scholar] [CrossRef] [PubMed]
Primer Names | Sequences (5′–3′) |
---|---|
IL-1β | F: TCTCGCAGCAGCACATCAAC |
R: ACCAGCAGGTTATCATCATCATCC | |
IL-6 | F: TCACAGAAGGAGTGGCTAAGG |
R: GCTTAGGCATAGCACACTAGG | |
TNF-α | F: CATCTTCTCAAAACTCGAGTGACAA |
R: TGGGAGTAGATAAGGTACAGCCC | |
STK4 | F: TCCGAGTAGCCAGCACGATGAG |
R: GGTTCCTTCCTCTTCCTCGTCCTC | |
IRAK1 | F: GCGTAGCTGACCTCGTTCACATC |
R: GGAGAGGAAGGTGGAGGCAGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lei, C.; Gao, Z.; Lv, X.; Zhu, Y.; Li, R.; Li, S. Saikosaponin-b2 Inhibits Primary Liver Cancer by Regulating the STK4/IRAK1/NF-κB Pathway. Biomedicines 2023, 11, 2859. https://doi.org/10.3390/biomedicines11102859
Lei C, Gao Z, Lv X, Zhu Y, Li R, Li S. Saikosaponin-b2 Inhibits Primary Liver Cancer by Regulating the STK4/IRAK1/NF-κB Pathway. Biomedicines. 2023; 11(10):2859. https://doi.org/10.3390/biomedicines11102859
Chicago/Turabian StyleLei, Chanhao, Zihan Gao, Xingzhi Lv, Yanxue Zhu, Ruifang Li, and Sanqiang Li. 2023. "Saikosaponin-b2 Inhibits Primary Liver Cancer by Regulating the STK4/IRAK1/NF-κB Pathway" Biomedicines 11, no. 10: 2859. https://doi.org/10.3390/biomedicines11102859