The Effects of IL-23/IL-18-Polarized Neutrophils on Renal Ischemia–Reperfusion Injury and Allogeneic-Skin-Graft Rejection in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mice
2.2. Reagents
2.3. Mouse Bone-Marrow Neutrophil Isolation
2.4. Polarization of the Neutrophils In Vitro
2.5. Skin Transplantation
2.6. Evaluation of Skin Necrosis
2.7. Isolation of Single Cells of Skin Tissue
2.8. IRI Mouse Model
2.9. Isolation of Single Cells in Kidneys
2.10. Assessment of Renal Function
2.11. Allogeneic Mixed-Lymphocyte Reaction Assay
2.12. Flow Cytometry
2.13. Quantitative PCR Analysis
2.14. RNA-Seq Analysis
2.15. Statistical Analysis
3. Results
3.1. Alleviation of Renal IRI in Mice with Myeloid-Cell-Specific IL-23R Deficiency
3.2. Alleviation of Renal IRI in IL-17-Deficient Mice
3.3. N(IL-23+IL-18) Neutrophils Promote Renal IRI Depending on IL-17
3.4. The Effect of Donor N(IL-23+IL-18) Neutrophils on Allogeneic-Skin-Graft Rejection
3.5. The Effect of Recipient N(IL-23+IL-18) Neutrophils on Allogeneic-Skin-Graft Rejection
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
CFSE | Carboxyfluorescein succinimidyl amino ester |
GC | Germinal center |
GFP | Green fluorescent protein |
KEGG | Kyoto Encyclopedia of Genes and Genomes |
KIM-1 | Kidney injury molecule-1 |
I/R | Ischemia–reperfusion |
IRI | Ischemia–reperfusion injury |
PCA | Principal component analysis |
PCR | Polymerase chain reaction |
PD-L1 | Programmed death-ligand 1 |
RNA-seq | Messenger ribonucleic acid sequencing |
Tfh | Follicular helper T cell |
References
- Kolaczkowska, E.; Kubes, P. Neutrophil recruitment and function in health and inflammation. Nat. Rev. Immunol. 2013, 13, 159–175. [Google Scholar] [CrossRef] [PubMed]
- Silvestre-Roig, C.; Fridlender, Z.G.; Glogauer, M.; Scapini, P. Neutrophil Diversity in Health and Disease. Trends Immunol. 2019, 40, 565–583. [Google Scholar] [CrossRef] [PubMed]
- Liew, P.X.; Kubes, P. The Neutrophil’s Role During Health and Disease. Physiol. Rev. 2019, 99, 1223–1248. [Google Scholar] [CrossRef]
- Bennouna, S.; Bliss, S.K.; Curiel, T.J.; Denkers, E.Y. Cross-talk in the innate immune system: Neutrophils instruct recruitment and activation of dendritic cells during microbial infection. J. Immunol. 2003, 171, 6052–6058. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, W.; Yang, F.; Xu, Y.; Feng, C.; Zhao, Y. The regulatory roles of neutrophils in adaptive immunity. Cell Commun. Signal. 2019, 17, 147. [Google Scholar] [CrossRef] [PubMed]
- Culshaw, S.; Millington, O.R.; Brewer, J.M.; McInnes, I.B. Murine neutrophils present Class II restricted antigen. Immunol. Lett. 2008, 118, 49–54. [Google Scholar] [CrossRef]
- Radsak, M.; Iking-Konert, C.; Stegmaier, S.; Andrassy, K.; Hansch, G.M. Polymorphonuclear neutrophils as accessory cells for T-cell activation: Major histocompatibility complex class II restricted antigen-dependent induction of T-cell proliferation. Immunology 2000, 101, 521–530. [Google Scholar] [CrossRef]
- Matsushima, H.; Geng, S.; Lu, R.; Okamoto, T.; Yao, Y.; Mayuzumi, N.; Kotol, P.F.; Chojnacki, B.J.; Miyazaki, T.; Gallo, R.L.; et al. Neutrophil differentiation into a unique hybrid population exhibiting dual phenotype and functionality of neutrophils and dendritic cells. Blood 2013, 121, 1677–1689. [Google Scholar] [CrossRef]
- Davey, M.S.; Morgan, M.P.; Liuzzi, A.R.; Tyler, C.J.; Khan, M.W.A.; Szakmany, T.; Hall, J.E.; Moser, B.; Eberl, M. Microbe-specific unconventional T cells induce human neutrophil differentiation into antigen cross-presenting cells. J. Immunol. 2014, 193, 3704–3716. [Google Scholar] [CrossRef]
- Kalafati, L.; Hatzioannou, A.; Hajishengallis, G.; Chavakis, T. The role of neutrophils in trained immunity. Immunol. Rev. 2023, 314, 142–157. [Google Scholar] [CrossRef]
- Ngo Nyekel, F.; Pacreau, E.; Benadda, S.; Msallam, R.; Abrink, M.; Pejler, G.; Davoust, J.; Benhamou, M.; Charles, N.; Launay, P.; et al. Mast Cell Degranulation Exacerbates Skin Rejection by Enhancing Neutrophil Recruitment. Front. Immunol. 2018, 9, 2690. [Google Scholar] [CrossRef]
- Abboud, R.; Kim, S.; Staser, K.; Jayasinghe, R.G.; Lim, S.; Amatya, P.; Frye, C.C.; Kopecky, B.; Ritchey, J.; Gao, F.; et al. Baricitinib with cyclosporine eliminates acute graft rejection in fully mismatched skin and heart transplant models. Front. Immunol. 2023, 14, 1264496. [Google Scholar] [CrossRef] [PubMed]
- Tzeng, Y.S.; Peng, Y.J.; Tang, S.E.; Huang, K.L.; Chu, S.J.; Wu, S.Y.; Cheng, C.P. Intermittent Exposure of Hypercapnia Suppresses Allograft Rejection via Induction of Treg Differentiation and Inhibition of Neutrophil Accumulation. Biomedicines 2022, 10, 836. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Ludwig, N.; Thomas, K.; Mersmann, S.; Lehmann, M.; Vestweber, D.; Pittet, J.F.; Gomez, H.; Kellum, J.A.; Rossaint, J.; et al. The Pathogenesis of Ischemia-Reperfusion Induced Acute Kidney Injury Depends on Renal Neutrophil Recruitment Whereas Sepsis-Induced AKI Does Not. Front. Immunol. 2022, 13, 843782. [Google Scholar] [CrossRef]
- He, Y.; Li, H.; Yao, J.; Zhong, H.; Kuang, Y.; Li, X.; Bian, W. HO-1 knockdown upregulates the expression of VCAM-1 to induce neutrophil recruitment during renal ischemia-reperfusion injury. Int. J. Mol. Med. 2021, 48, 185. [Google Scholar] [CrossRef]
- Sagiv, J.Y.; Michaeli, J.; Assi, S.; Mishalian, I.; Kisos, H.; Levy, L.; Damti, P.; Lumbroso, D.; Polyansky, L.; Sionov, R.V.; et al. Phenotypic diversity and plasticity in circulating neutrophil subpopulations in cancer. Cell Rep. 2015, 10, 562–573. [Google Scholar] [CrossRef]
- Guglietta, S.; Chiavelli, A.; Zagato, E.; Krieg, C.; Gandini, S.; Ravenda, P.S.; Bazolli, B.; Lu, B.; Penna, G.; Rescigno, M. Coagulation induced by C3aR-dependent NETosis drives protumorigenic neutrophils during small intestinal tumorigenesis. Nat. Commun. 2016, 7, 11037. [Google Scholar] [CrossRef] [PubMed]
- Fridlender, Z.G.; Sun, J.; Kim, S.; Kapoor, V.; Cheng, G.; Ling, L.; Worthen, G.S.; Albelda, S.M. Polarization of tumor-associated neutrophil phenotype by TGF-beta: “N1” versus “N2” TAN. Cancer Cell 2009, 16, 183–194. [Google Scholar] [CrossRef]
- Li, Y.; Zhu, L.; Chu, Z.; Yang, T.; Sun, H.X.; Yang, F.; Wang, W.; Hou, Y.; Wang, P.; Zhao, Q.; et al. Characterization and biological significance of IL-23-induced neutrophil polarization. Cell. Mol. Immunol. 2018, 15, 518–530. [Google Scholar] [CrossRef]
- Chen, Y.; Li, Y.; Guo, H.; Zhang, Z.; Zhang, J.; Dong, X.; Liu, Y.; Zhuang, Y.; Zhao, Y. The Effects of Adoptively Transferred IL-23/IL-18-Polarized Neutrophils on Tumor and Collagen-Induced Arthritis in Mice. J. Inflamm. Res. 2021, 14, 4669–4686. [Google Scholar] [CrossRef]
- Sun, B.; Zhu, L.; Tao, Y.; Sun, H.X.; Li, Y.; Wang, P.; Hou, Y.; Zhao, Y.; Zhang, X.; Zhang, L.; et al. Characterization and allergic role of IL-33-induced neutrophil polarization. Cell. Mol. Immunol. 2018, 15, 782–793. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Walsh, M.; Villarino, A.V.; Cervi, L.; Hunter, C.A.; Choi, Y.; Pearce, E.J. TLR ligands can activate dendritic cells to provide a MyD88-dependent negative signal for Th2 cell development. J. Immunol. 2005, 174, 742–751. [Google Scholar] [CrossRef] [PubMed]
- Re, F.; Strominger, J.L. Heterogeneity of TLR-induced responses in dendritic cells: From innate to adaptive immunity. Immunobiology 2004, 209, 191–198. [Google Scholar] [CrossRef] [PubMed]
- Sanchez, A.P.; da Costa, A.; Del Rey, C.; Silva, B.; Romiti, R. The Overview of the Immunobiology of Interleukin-23 Associated with Immune-Mediated Inflammatory Disorders: A Narrative Review. J. Drugs Dermatol. 2023, 22, 375–385. [Google Scholar]
- Liu, T.; Li, S.; Ying, S.; Tang, S.; Ding, Y.; Li, Y.; Qiao, J.; Fang, H. The IL-23/IL-17 Pathway in Inflammatory Skin Diseases: From Bench to Bedside. Front. Immunol. 2020, 11, 594735. [Google Scholar] [CrossRef]
- Fragoulis, G.E.; Siebert, S. The role of IL-23 and the use of IL-23 inhibitors in psoriatic arthritis. Musculoskelet. Care 2022, 20 (Suppl. S1), S12–S21. [Google Scholar] [CrossRef]
- Schinocca, C.; Rizzo, C.; Fasano, S.; Grasso, G.; La Barbera, L.; Ciccia, F.; Guggino, G. Role of the IL-23/IL-17 Pathway in Rheumatic Diseases: An Overview. Front. Immunol. 2021, 12, 637829. [Google Scholar] [CrossRef]
- Moschen, A.R.; Tilg, H.; Raine, T. IL-12, IL-23 and IL-17 in IBD: Immunobiology and therapeutic targeting. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 185–196. [Google Scholar] [CrossRef]
- Pastor-Fernandez, G.; Mariblanca, I.R.; Navarro, M.N. Decoding IL-23 Signaling Cascade for New Therapeutic Opportunities. Cells 2020, 9, 2044. [Google Scholar] [CrossRef]
- Gaffen, S.L.; Jain, R.; Garg, A.V.; Cua, D.J. The IL-23-IL-17 immune axis: From mechanisms to therapeutic testing. Nat. Rev. Immunol. 2014, 14, 585–600. [Google Scholar] [CrossRef]
- Awasthi, A.; Riol-Blanco, L.; Jager, A.; Korn, T.; Pot, C.; Galileos, G.; Bettelli, E.; Kuchroo, V.K.; Oukka, M. Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells. J. Immunol. 2009, 182, 5904–5908. [Google Scholar] [CrossRef] [PubMed]
- Aychek, T.; Mildner, A.; Yona, S.; Kim, K.W.; Lampl, N.; Reich-Zeliger, S.; Boon, L.; Yogev, N.; Waisman, A.; Cua, D.J.; et al. IL-23-mediated mononuclear phagocyte crosstalk protects mice from Citrobacter rodentium-induced colon immunopathology. Nat. Commun. 2015, 6, 6525. [Google Scholar] [CrossRef] [PubMed]
- Cua, D.J.; Tato, C.M. Innate IL-17-producing cells: The sentinels of the immune system. Nat. Rev. Immunol. 2010, 10, 479–489. [Google Scholar] [CrossRef]
- Korn, T.; Bettelli, E.; Oukka, M.; Kuchroo, V.K. IL-17 and Th17 Cells. Annu. Rev. Immunol. 2009, 27, 485–517. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.T.; Kim, M.; Kim, J.Y.; Brown, K.M.; Ham, A.; D’Agati, V.D.; Mori-Akiyama, Y. Critical role of interleukin-17A in murine intestinal ischemia-reperfusion injury. Am. J. Physiol. Gastrointest. Liver Physiol. 2013, 304, G12–G25. [Google Scholar] [CrossRef] [PubMed]
- Hu, X.; Xu, W.; Jiang, H. HMGB1/IL-17A axis: An important mechanism for myocardial ischemia-reperfusion injury. Int. J. Cardiol. 2014, 174, 447–448. [Google Scholar] [CrossRef] [PubMed]
- Cortvrindt, C.; Speeckaert, R.; Moerman, A.; Delanghe, J.R.; Speeckaert, M.M. The role of interleukin-17A in the pathogenesis of kidney diseases. Pathology 2017, 49, 247–258. [Google Scholar] [CrossRef]
- Yamada, Y.; Vandermeulen, E.; Heigl, T.; Somers, J.; Vaneylen, A.; Verleden, S.E.; Bellon, H.; De Vleeschauwer, S.; Verbeken, E.K.; Van Raemdonck, D.E.; et al. The role of recipient derived interleukin-17A in a murine orthotopic lung transplant model of restrictive chronic lung allograft dysfunction. Transpl. Immunol. 2016, 39, 10–17. [Google Scholar] [CrossRef]
- Chen, Q.R.; Wang, L.F.; Xia, S.S.; Zhang, Y.M.; Xu, J.N.; Li, H.; Ding, Y.Z. Role of interleukin-17A in early graft rejection after orthotopic lung transplantation in mice. J. Thorac. Dis. 2016, 8, 1069–1079. [Google Scholar] [CrossRef]
- Fan, L.; Benson, H.L.; Vittal, R.; Mickler, E.A.; Presson, R.; Fisher, A.J.; Cummings, O.W.; Heidler, K.M.; Keller, M.R.; Burlingham, W.J.; et al. Neutralizing IL-17 prevents obliterative bronchiolitis in murine orthotopic lung transplantation. Am. J. Transpl. 2011, 11, 911–922. [Google Scholar] [CrossRef]
- Kwan, T.; Chadban, S.J.; Ma, J.; Bao, S.; Alexander, S.I.; Wu, H. IL-17 deficiency attenuates allograft injury and prolongs survival in a murine model of fully MHC-mismatched renal allograft transplantation. Am. J. Transpl. 2015, 15, 1555–1567. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhao, C.; Guo, H.; Zou, W.; Zhang, Z.; Wei, D.; Lu, H.; Zhang, L.; Zhao, Y. Wip1 inhibits neutrophil extracellular traps to promote abscess formation in mice by directly dephosphorylating Coronin-1a. Cell. Mol. Immunol. 2023, 20, 941–954. [Google Scholar] [CrossRef] [PubMed]
- Mayumi, H.; Nomoto, K.; Good, R.A. A surgical technique for experimental free skin grafting in mice. Jpn. J. Surg. 1988, 18, 548–557. [Google Scholar] [CrossRef]
- Tian, Q.; Zhang, Z.; Tan, L.; Yang, F.; Xu, Y.; Guo, Y.; Wei, D.; Wu, C.; Cao, P.; Ji, J.; et al. Skin and heart allograft rejection solely by long-lived alloreactive T(RM) cells in skin of severe combined immunodeficient mice. Sci. Adv. 2022, 8, eabk0270. [Google Scholar] [CrossRef]
- Shi, L.; Tian, H.; Wang, P.; Li, L.; Zhang, Z.; Zhang, J.; Zhao, Y. Spaceflight and simulated microgravity suppresses macrophage development via altered RAS/ERK/NFkappaB and metabolic pathways. Cell. Mol. Immunol. 2021, 18, 1489–1502. [Google Scholar] [CrossRef]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Wu, J.; Mao, X.; Cai, T.; Luo, J.; Wei, L. KOBAS server: A web-based platform for automated annotation and pathway identification. Nucleic Acids Res. 2006, 34, W720–W724. [Google Scholar] [CrossRef]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
- McKenzie, B.S.; Kastelein, R.A.; Cua, D.J. Understanding the IL-23-IL-17 immune pathway. Trends Immunol. 2006, 27, 17–23. [Google Scholar] [CrossRef]
- Olatunde, A.C.; Hale, J.S.; Lamb, T.J. Cytokine-skewed Tfh cells: Functional consequences for B cell help. Trends Immunol. 2021, 42, 536–550. [Google Scholar] [CrossRef]
- Schofield, Z.V.; Woodruff, T.M.; Halai, R.; Wu, M.C.; Cooper, M.A. Neutrophils—A key component of ischemia-reperfusion injury. Shock 2013, 40, 463–470. [Google Scholar] [CrossRef]
- Zhang, J.; Li, Q.; Zou, Y.R.; Wu, S.K.; Lu, X.H.; Li, G.S.; Wang, J. HMGB1-TLR4-IL-23-IL-17A axis accelerates renal ischemia-reperfusion injury via the recruitment and migration of neutrophils. Int. Immunopharmacol. 2021, 94, 107433. [Google Scholar] [CrossRef]
- Li, L.; Huang, L.; Vergis, A.L.; Ye, H.; Bajwa, A.; Narayan, V.; Strieter, R.M.; Rosin, D.L.; Okusa, M.D. IL-17 produced by neutrophils regulates IFN-gamma-mediated neutrophil migration in mouse kidney ischemia-reperfusion injury. J. Clin. Investig. 2010, 120, 331–342. [Google Scholar] [CrossRef]
- Jablonska, J.; Granot, Z. Neutrophil, quo vadis? J. Leukoc. Biol. 2017, 102, 685–688. [Google Scholar] [CrossRef]
- Ashtekar, A.R.; Saha, B. Poly’s plea: Membership to the club of APCs. Trends Immunol. 2003, 24, 485–490. [Google Scholar] [CrossRef]
- Scapini, P.; Nardelli, B.; Nadali, G.; Calzetti, F.; Pizzolo, G.; Montecucco, C.; Cassatella, M.A. G-CSF-stimulated neutrophils are a prominent source of functional BLyS. J. Exp. Med. 2003, 197, 297–302. [Google Scholar] [CrossRef] [PubMed]
- Mhawech-Fauceglia, P.; Kaya, G.; Sauter, G.; McKee, T.; Donze, O.; Schwaller, J.; Huard, B. The source of APRIL up-regulation in human solid tumor lesions. J. Leukoc. Biol. 2006, 80, 697–704. [Google Scholar] [CrossRef] [PubMed]
- Zindl, C.L.; Lai, J.F.; Lee, Y.K.; Maynard, C.L.; Harbour, S.N.; Ouyang, W.; Chaplin, D.D.; Weaver, C.T. IL-22-producing neutrophils contribute to antimicrobial defense and restitution of colonic epithelial integrity during colitis. Proc. Natl. Acad. Sci. USA 2013, 110, 12768–12773. [Google Scholar] [CrossRef]
- Scozzi, D.; Ibrahim, M.; Menna, C.; Krupnick, A.S.; Kreisel, D.; Gelman, A.E. The Role of Neutrophils in Transplanted Organs. Am. J. Transpl. 2017, 17, 328–335. [Google Scholar] [CrossRef]
- Ferrari, R.S.; Andrade, C.F. Oxidative Stress and Lung Ischemia-Reperfusion Injury. Oxidative Med. Cell. Longev. 2015, 2015, 590987. [Google Scholar] [CrossRef] [PubMed]
- Kreisel, D.; Sugimoto, S.; Zhu, J.; Nava, R.; Li, W.; Okazaki, M.; Yamamoto, S.; Ibrahim, M.; Huang, H.J.; Toth, K.A.; et al. Emergency granulopoiesis promotes neutrophil-dendritic cell encounters that prevent mouse lung allograft acceptance. Blood 2011, 118, 6172–6182. [Google Scholar] [CrossRef]
- Kish, D.D.; Gorbachev, A.V.; Parameswaran, N.; Gupta, N.; Fairchild, R.L. Neutrophil expression of Fas ligand and perforin directs effector CD8 T cell infiltration into antigen-challenged skin. J. Immunol. 2012, 189, 2191–2202. [Google Scholar] [CrossRef]
- Saini, D.; Angaswamy, N.; Tiriveedhi, V.; Fukami, N.; Ramachandran, S.; Hachem, R.; Trulock, E.; Meyers, B.; Patterson, A.; Mohanakumar, T. Synergistic effect of antibodies to human leukocyte antigens and defensins in pathogenesis of bronchiolitis obliterans syndrome after human lung transplantation. J. Heart Lung Transpl. 2010, 29, 1330–1336. [Google Scholar] [CrossRef]
- Wasowska, B.A. Mechanisms involved in antibody- and complement-mediated allograft rejection. Immunol. Res. 2010, 47, 25–44. [Google Scholar] [CrossRef]
- Oracki, S.A.; Walker, J.A.; Hibbs, M.L.; Corcoran, L.M.; Tarlinton, D.M. Plasma cell development and survival. Immunol. Rev. 2010, 237, 140–159. [Google Scholar] [CrossRef]
- Zotos, D.; Coquet, J.M.; Zhang, Y.; Light, A.; D’Costa, K.; Kallies, A.; Corcoran, L.M.; Godfrey, D.I.; Toellner, K.M.; Smyth, M.J.; et al. IL-21 regulates germinal center B cell differentiation and proliferation through a B cell-intrinsic mechanism. J. Exp. Med. 2010, 207, 365–378. [Google Scholar] [CrossRef]
Genes | Primer Sequence (5′–3′) | |
---|---|---|
HPRT | Forward primer: | AGTACAGCCCCAAAATGGTTAAG |
Reverse primer: | CTTAGGCTTTGTATTTGGCTTTTC | |
IL-1β | Forward primer: | TGGGAAACAACAGTGGTCAGG |
Reverse primer: | CCATCAGAGGCAAGGAGGAA | |
IL-6 | Forward primer: | AACCGCTATGAAGTTCCTCTC |
Reverse primer: | AATTAAGCCTCCGACTTGTGAA | |
IL-17A | Forward primer: | CTCAGACTACCTCAACCGTTCC |
Reverse primer: | ATGTGGTGGTCCAGCTTTCC | |
IL-23A | Forward primer: | CTGAGAAGCAGGGAACAAGATG |
Reverse primer: | GAAGATGTCAGAGTCAAGCAGGTG | |
Tnf-α | Forward primer: | GAGTGACAAGCCTGTAGCC |
Reverse primer: | CTCCTGGTATGAGATAGCAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, C.; Xu, J.; Zhang, Z.; Wei, D.; Xu, Y.; Zhao, Y. The Effects of IL-23/IL-18-Polarized Neutrophils on Renal Ischemia–Reperfusion Injury and Allogeneic-Skin-Graft Rejection in Mice. Biomedicines 2023, 11, 3148. https://doi.org/10.3390/biomedicines11123148
Wu C, Xu J, Zhang Z, Wei D, Xu Y, Zhao Y. The Effects of IL-23/IL-18-Polarized Neutrophils on Renal Ischemia–Reperfusion Injury and Allogeneic-Skin-Graft Rejection in Mice. Biomedicines. 2023; 11(12):3148. https://doi.org/10.3390/biomedicines11123148
Chicago/Turabian StyleWu, Changhong, Jinglin Xu, Zhaoqi Zhang, Dong Wei, Yanan Xu, and Yong Zhao. 2023. "The Effects of IL-23/IL-18-Polarized Neutrophils on Renal Ischemia–Reperfusion Injury and Allogeneic-Skin-Graft Rejection in Mice" Biomedicines 11, no. 12: 3148. https://doi.org/10.3390/biomedicines11123148