Next Article in Journal
Recent Development of Nanomaterials for Transdermal Drug Delivery
Next Article in Special Issue
Whole Blood Spermine/Spermidine Ratio as a New Indicator of Sarcopenia Status in Older Adults
Previous Article in Journal
Assessment of Individual Radiosensitivity in Breast Cancer Patients Using a Combination of Biomolecular Markers
Previous Article in Special Issue
Changes in the Localization of Polyamine Spermidine in the Rat Retina with Age
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Biomedicines
Volume 11
Issue 4
10.3390/biomedicines11041123
biomedicines-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota

by
Hiromi Shimokawa
1,2,†,
Mikiyasu Sakanaka
1,†,‡,
Yuki Fujisawa
1,
Hirokazu Ohta
1,
Yuta Sugiyama
1,§ and
Shin Kurihara
1,2,*
1
Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, Nonoichi 921-8836, Ishikawa, Japan
2
Faculty of Biology-Oriented Science and Technology, Kindai University, Kinokawa 649-6493, Wakayama, Japan
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
‡
Current address: Graduate School of Biostudies, Kyoto University, Kyoto 606-8502, Kyoto, Japan.
§
Current address: Gunma University Center for Food Science and Wellness, Gunma University, Maebashi 371-8510, Gunma, Japan.
Biomedicines 2023, 11(4), 1123; https://doi.org/10.3390/biomedicines11041123
Submission received: 18 February 2023 / Revised: 15 March 2023 / Accepted: 22 March 2023 / Published: 7 April 2023
(This article belongs to the Special Issue The Role of Polyamines in Human Health and Disease)
Browse Figures
Versions Notes

Abstract

:
Polyamines are bioactive amines that play a variety of roles, such as promoting cell proliferation and protein synthesis, and the intestinal lumen contains up to several mM polyamines derived from the gut microbiota. In the present study, we conducted genetic and biochemical analyses of the polyamine biosynthetic enzyme N-carbamoylputrescine amidohydrolase (NCPAH) that converts N-carbamoylputrescine to putrescine, a precursor of spermidine in Bacteroides thetaiotaomicron, which is one of the most dominant species in the human gut microbiota. First, ncpah gene deletion and complemented strains were generated, and the intracellular polyamines of these strains cultured in a polyamine-free minimal medium were analyzed using high-performance liquid chromatography. The results showed that spermidine detected in the parental and complemented strains was depleted in the gene deletion strain. Next, purified NCPAH-(His)6 was analyzed for enzymatic activity and found to be capable of converting N-carbamoylputrescine to putrescine, with a Michaelis constant (Km) and turnover number (kcat) of 730 µM and 0.8 s−1, respectively. Furthermore, the NCPAH activity was strongly (>80%) inhibited by agmatine and spermidine, and moderately (≈50%) inhibited by putrescine. This feedback inhibition regulates the reaction catalyzed by NCPAH and may play a role in intracellular polyamine homeostasis in B. thetaiotaomicron.

1. Introduction

Polyamines are aliphatic amines with two or more amino groups and are found in almost all living organisms, from prokaryotes to higher plants and animals, and their intracellular concentrations are in the mM range [1]. The most common polyamines are putrescine, spermidine, and spermine.
In recent years, it has become clear that polyamines contribute significantly to extending the healthy life span of various organisms. The first report on the extension of animal lifespan through polyamine ingestion was a 2009 study using mice [2]. The study reported that feeding diets containing high concentrations of putrescine, spermine, and spermidine increased blood polyamine levels and reduced aging in the kidneys and liver, resulting in an extension of the lifespan [2]. In the same year, experiments with Caenorhabditis elegans, Drosophila melanogaster, and mice showed that the administration of spermidine was effective in extending the lifespan, and an enhancement in histone acetylation and induction of autophagy was observed in these animals [3]. In 2011, it was reported that the administration of Bifidobacterium to mice increased spermidine levels in the intestinal tract and decreased haptoglobin levels, an inflammatory signal, in the urine, resulting in an extension of the lifespan [4]. Furthermore, in a 2013 study, the oral administration of polyamines suppressed inflammation and abnormal DNA methylation throughout the body in mice [5]. In mice, CD11a cells present in the blood were compared between those in the low- and high-polyamine-diet groups, revealing a significant decrease in the high-polyamine-diet group [5]. In addition, research reported in 2014 that the simultaneous oral intake of probiotics and arginine increased putrescine concentrations in the intestinal tract, which simultaneously improved brain function and reduced inflammation in the colon [6]. Furthermore, the levels of the inflammatory cytokines IL-6 and MIP-2 in the blood were significantly reduced in the group that received probiotics and arginine simultaneously [6].
The health-promoting effects of polyamines are not limited to extending life expectancy. In 2013, it was reported that the oral administration of spermidine to 30-day-old D. melanogaster inhibited age-related memory loss and promoted autophagy in the brain [7]. In addition, a 2016 study showed that mice orally administered spermidine had improved cardiac function, increased lifespan, and induced autophagy in cardiomyocytes [8]. Furthermore, in a 2021 study, gnotobiotic mice were inoculated with wild-type Escherichia coli or a polyamine-biosynthesis-deficient isogenic mutant (ΔspeAB ΔspeC ΔspeF), and the results showed that polyamines derived from gut bacteria were important for the proliferation of intestinal epithelial cells and the proper differentiation of macrophages in the mouse colon [9]. Moreover, in mice with experimentally induced colitis, we compared those with established wild-type E. coli to those with established polyamine-non-producing bacteria. The results showed a decrease in colitis pathology scores and a significant increase in survival rates [9]. The most recent study, conducted in 2022, reported that supplying spermidine to T cells in ageing mice with mitochondrial failure restored and enhanced T cell mitochondrial function by binding to the mitochondrial trifunctional protein, which is responsible for fatty acid oxidation in T cell mitochondria [10].
Polyamines are essential for cell proliferation and are present in high concentrations in actively proliferating cells [11], such as cancer cells [12]. In recent years, attempts have been made to treat cancer by lowering elevated polyamine levels in cancer cells, and some of these attempts have advanced to clinical trials [13].
Polyamines present in the colonic lumen are derived from gut bacteria [14] and are reported to be absorbed by the host through the colonic epithelium [6,9], making it one of the most important sources of polyamines for the host. In order to optimize polyamine concentrations in the human intestinal lumen, it is necessary to elucidate the mechanism of polyamine biosynthesis in the gut microbiota. To understand this mechanism, it is important to determine the polyamine metabolic pathways and transporters, and these have been extensively studied in the model intestinal bacterium E. coli [15,16].
Putrescine is synthesized in E. coli cells through two different pathways. The first pathway involves the conversion of ornithine to putrescine by the enzyme ornithine decarboxylase (SpeC). The second pathway involves the sequential reaction of two enzymes, arginine decarboxylase (SpeA) and agmatinase (SpeB) [17], which convert arginine to putrescine. Furthermore, putrescine is converted to spermidine, another polyamine, through the action of spermidine synthase (SpeE) [18]. In this reaction, an aminopropyl group derived from decarboxylated S-adenosylmethionine, which is generated by the reaction catalyzed by S-adenosylmethionine decarboxylase (SpeD), is transferred to putrescine.
Four transporters that can take up extracellular putrescine into E. coli cells have been identified. PotFGHI [19] is an ATP-dependent putrescine transporter that belongs to the ATP-binding cassette (ABC) transporter family and PotABCD [20] is a spermidine transporter and is also a member of the ABC transporter family, but it can take up putrescine with lower affinity. PuuP [21] and PlaP [22] are putrescine transporters that utilize the proton-motive force. SapBCDF [23] is an ABC transporter that exports putrescine out of the bacterial cell. PotE is active in both the uptake and export of putrescine [24,25]. Then, export occurs through a putrescine–ornithine antiporter activity [24], while the uptake is dependent on the membrane potential [25]. The spermidine transporter MdtJI has also been reported in E. coli to prevent toxicity from the accumulation of excess spermidine in the bacteria [26].
E. coli has two pathways to metabolize putrescine to succinate via GABA. The first is a pathway with γ-aminobutyraldehyde as a reaction intermediate. In this pathway, putrescine is metabolized to GABA without γ-glutamylation [27]. One other pathway is called the Puu pathway [28], in which putrescine is γ-glutamylated and metabolized to γ-Glu-GABA via γ-glutamyl-γ-aminobutyraldehyde, followed by hydrolysis of the γ-glutamyl bond to GABA and Glu by PuuD [29]. In this pathway, putrescine in the medium is imported to the cell through the transporter PuuP [21]. First, PuuA uses ATP to bind glutamate to one amino group of putrescine, producing γ-glutamylputrescine [30]. Next, γ-glutamylputrescine is oxidized by PuuB to γ-glutamylγ-aminobutyraldehyde. It is then believed to be further oxidized by PuuC to γ-glutamyl-GABA. The γ-glutamyl group is then cleaved by PuuD, releasing glutamate and GABA [31]. GABA is then deaminated by PuuE to form succinate semialdehyde [32]. Finally, succinate semialdehyde is oxidized by YneI to form succinate [32].
In contrast to polyamine metabolic pathways and transporters being well studied in E. coli, which is not the dominant species in the human gut, few studies have examined polyamine biosynthetic pathways in the predominant gut bacterial species. Furthermore, the polyamine biosynthetic pathway in E. coli differs from the pathway predicted to be present in the most predominant gut microbiota species [33]. In Enterococcus faecalis, ranked 54th among the 56 most abundant species of commensal gut microbiota in Europeans [34], an agmatine–putrescine antiporter (AguD [35]) takes up agmatine into bacterial cells. Then, agmatine is hydrolyzed into N-carbamoylputrescine and ammonia-catalyzed by agmatine deiminase (AguA [36]), and N-carbamoylputrescine is converted to putrescine via a reaction catalyzed by putrescine transcarbamylase (AguB [36]). Putrescine produced from a series of biosynthetic pathways within the bacterial cell is exported by AguD to the outside of the bacterial cell [35].
Bacteroides thetaiotaomicron is ranked 8th among the 56 most abundant species of commensal gut microbiota in Europeans [34]. Phylogenetically, the phylum Bacteroidota accounts for approximately 43% of the 56 most abundant species of human commensal gut microbiota, and the genus Bacteroides accounts for approximately 36% [34]. Therefore, analysis of B. thetaiotaomicron can significantly help to understand polyamine metabolism throughout the human commensal gut microbiota. In addition, B. thetaiotaomicron has been reported to possess anti-inflammatory properties, enhance mucosal barrier function, and restrict pathogen invasion [37]. The administration of B. thetaiotaomicron in autoimmune inflammatory bowel disease mouse models protects against weight loss, histological changes in the colon, and inflammatory markers [38]. B. thetaiotaomicron has been reported to induce NF-κB-relaxed aspartate-auxotrophic-PPARγ complexes in colon cancer cell line (Caco-2) cells in vitro and to downregulate NF-κB-induced inflammatory genes such as TNFα [39]. Furthermore, the NF-κB pathway regulates T cell differentiation in asthma by controlling the expression of inflammatory genes [40], especially those encoding IL-6 and TNF-α, suggesting the potential role of B. thetaiotaomicron in this regulation [41]. However, the genus Bacteroides has been reported to have potentially detrimental effects on health. The proportion of genus Bacteroides increased in the gut microbiota of immigrants to the U.S., and a decrease in bacterial enzymes is related to the breakdown of plant fibre and obesity [42]. In addition, the Bacteroides enterotype is more common in patients with depression [43].
A polyamine biosynthetic pathway via N-carbamoylputrescine, previously reported in C. jejuni [33], is predicted to be present in B. thetaiotaomicron by the BLAST analyses. In the predicted pathway (Figure 1) arginine is decarboxylated by SpeA to form agmatine. Next, agmatine is converted to N-carbamoylputrescine with the liberation of ammonia by a reaction catalyzed by agmatine iminohydrolase (AIH [33]). Then, N-carbamoylputrescine is converted to putrescine with the liberation of ammonia and carbon dioxide by N-carbamoylputrescine amidohydrolase (NCPAH [33]). The synthesized putrescine is converted to carboxyspermidine by the reductive condensation of putrescine and aspartate-β-semialdehyde catalyzed by carboxyspermidine dehydrogenase (CASDH [33]). Finally, carboxyspermidine is decarboxylated by carboxyspermidine decarboxylase (CASDC) to form spermidine. Additionally, B. thetaiotaomicron is also predicted to take up extracellular spermidine by PotABCD, a homolog of the E. coli spermidine transporter [44].
In a previous study, we revealed that B. thetaiotaomicron accumulates spermidine as its sole polyamine and that CASDC is essential for converting carboxyspermidine to spermidine [45], but NCPAH, which is predicted to biosynthesize putrescine, the precursor of spermidine, remains unstudied. Here, we performed biochemical and genetic analyses of predicted NCPAH of B. thetaiotaomicron. As the genus Bacteroides is predominant and represents 30% of all bacteria in the human intestinal lumen, the results of this study provide a better understanding of total gut bacterial polyamine production.

2. Material and Methods

2.1. Chemicals

Agmatine and cadaverine were purchased from Tokyo Chemical Industry (Tokyo, Japan). N-carbamoylputrescine was synthesized by Life Chemical (Kiev, Ukraine). The chemicals 1,4-butanediammonium dichloride and L(+)-arginine hydrochloride were purchased from Fujifilm Wako Pure Chemical (Osaka, Japan). Spermidine trihydrochloride and spermine tetrahydrochloride were purchased from Nacalai Tesque (Kyoto, Japan). All other reagents were of analytical grade.

2.2. Bacterial Strains, Culture, Medium

Bacterial strains, plasmids, and primers used in this study are listed in Table 1 and Table 2. B. thetaiotaomicron Δtdk was a kind gift from Dr. Thomas J. Smith (Donald Danforth Plant Science Center, USA) and Dr. Nicole M. Koropatkin (University of Michigan Medical School, USA), while B. thetaiotaomicron JCM 5827T was from Japan Collection of Microorganisms (Tsukuba, Japan). These strains were anoxically cultured at 37 °C in Gifu anaerobic medium (GAM; Nissui Pharmaceutical, Tokyo, Japan) or polyamine-free minimal medium (pH7.2) [45,46], in which dissolved oxygen was eliminated from the media beforehand, as in previous reports [47]. The polyamine-free minimal medium was composed of the following nutrients: 0.5% (w/v) glucose, 100 mM KH2PO4, 15 mM NaCl, 8.5 mM (NH4)2SO4, 4 mM l-cysteine, 1.9 μM hematin, 200 μM l-histidine, 1 μg/mL vitamin K3, 5 ng/mL vitamin B12, 100 μM MgCl2, 1.4 μM FeSO4, and 50 μM CaCl2 [45]. The anoxic culture was conducted in an InvivO2 400 chamber (10% H2, 10% CO2, and 80% N2; Ruskinn Technology, Bridgend, UK). E. coli strains DH5α and CC118 λpir were used for genetic manipulation, while S17-1 λpir was used as a donor host in bacterial conjugation. E. coli was cultured at 37 °C in Luria–Bertani (LB) medium. Where necessary, ampicillin (final concentration: 100 μg/mL), chloramphenicol (15 μg/mL), erythromycin (25 μg/mL), gentamycin (200 μg/mL), and 5-fluoro-2′-deoxyuridine (200 μg/mL) were added to the media.

2.3. Disruption and Complementation of Ncpah in B. thetaiotaomicron

Gene disruption of ncpah in B. thetaiotaomicron was performed using the previously established method [46]. DNA cloning was conducted with the In-Fusion cloning HD kit (Takara Bio USA, Mountain View, San Jose, CA, USA). The upstream and downstream regions (750 bp each) of ncpah were PCR-amplified from the JCM 5827T genome as template using the primer pairs Pr-MS46/47 and Pr-MS48/49, respectively. The resulting two DNA fragments were ligated by overlap PCR using a primer pair Pr-MS46/49 and inserted into the SalI site of pExchange-tdk [46]. The resulting plasmid pMSK5 of MS108 was transferred by bacterial conjugation to B. thetaiotaomicron Δtdk, and then ncpah knockout (Δncpah) was obtained by the double-crossover event as described previously [45,46]. Introduction of the gene disruption into the target locus was verified by Sanger sequencing of DNA fragment PCR-amplified from the genome of the disruptant as template.
The ncpah-complemented strain was generated as follows. The rpoD (sigma 70 factor gene) promoter and ncpah gene were PCR-amplified from JCM 5827T genome as template using the primer pairs Pr-MS52/53 and Pr-MS50/51, respectively. These two DNA fragments were inserted into the PstI and NotI site of pNBU2-bla-ermGb [46], and then the resulting plasmid pMSK6 of MS110 was inserted into the NBU2 att1 site on the chromosome of B. thetaiotaomicron Δtdk Δncpah as described previously [45,46] to obtain the ncpah-complemented strain (Δncpah att1::ncpah+). The insertion of the plasmid into the targeted locus was verified by genomic PCR.

2.4. High-Performance Liquid Chromatography (HPLC) Analysis of Polyamines in Cells and Culture Supernatant

Polyamines in the cells and culture supernatant of B. thetaiotaomicron were analyzed as reported previously [45]. Specifically, cells of B. thetaiotaomicron strains (parental strain, Δncpah, and Δncpah att1::ncpah+) were grown overnight in liquid GAM and harvested with centrifugation at 3400× g for 3 min. After washing once with the polyamine-free minimal medium, the cells were inoculated into 20 mL of the same fresh minimal medium to give an initial optical density at 600 nm (OD600) of 0.03. The bacterial strains were then grown at 37 °C for 30 h, during which the growth was monitored by measuring OD600 with a spectrophotometer. Cultures were collected at the appropriate times, after which cells and supernatants were obtained by centrifugation at 18,700× g for 5 min at 4 °C.
The cells and supernatants were used for polyamine analysis. Supernatants were mixed with trichloroacetic acid at a final concentration of 10% (w/v) and centrifuged twice at 18,700× g for 5 min at 4 °C, after which the resulting supernatants were filtered through a Cosmonice filter W (Nacalai Tesque Inc., Kyoto, Japan) and used for subsequent HPLC analysis. Similarly, the cells were washed once with phosphate-buffered saline (18,700× g, 4 °C, 5 min), resuspended in 300 μL of 5% (w/v) trichloroacetic acid, and incubated in boiling water for 15 min. The samples were then centrifuged at 18,700× g, 4 °C for 5 min to separate cell debris and supernatants, the latter of which were filtered through a Cosmonice filter W (Nacalai Tesque Inc., Kyoto, Japan) and used for subsequent HPLC analysis. Cell debris, which was dissolved in 300 μL of 0.1 N NaOH, was used to measure protein concentration by the Bradford method using bovine serum albumin as a standard (Bio-Rad protein assay kit; Bio-Rad Laboratories, Inc., Hercules, CA, USA).
For HPLC analysis, a cation exchange column (#2619PH, 4.6 × 50 mm; Hitachi, Tokyo, Japan) was used as in our previous report [45]. The polyamines were derivatized with o-phthalaldehyde with the postcolumn method and were detected with a fluorescence detector at λex 340 nm and λem 435 nm. The concentration of each polyamine was calculated based on a standard curve created using standards of known concentrations. The standards used and their retention times were as follows: agmatine, 33.7 min; cadaverine, 20.5 min; N-carbamoylputrescine, 6.2 min; putrescine, 15.2 min; spermidine, 26.0 min; and spermine, 38.1 min. As a result, the concentration of polyamines in the culture supernatant was shown as μM, while that of intracellular polyamines was expressed as nmol/mg cellular protein.

2.5. Expression, Purification, and Characterization of Recombinant NCPAH

Recombinant NCPAH of B. thetaiotaomicron was expressed as a C-terminal His6-tagged form. The ncpah gene was PCR-amplified from JCM 5827T genome as template using the primer pair Pr-MS435/436 and inserted into the NdeI and XhoI site of pET23b (Novagen). The resulting plasmid pMSK106 was introduced into E. coli BL21(DE3). This strain was designated MS821.
MS821, an E. coli strain for His6-tagged NCPAH overexpression (Table 1), was grown in LB medium supplemented with ampicillin at 25 °C with shaking at 140 rpm. When OD600 reached to ~0.5, a final concentration of 0.1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) was added to the culture. After further 24 h incubation, the cells were harvested by centrifugation, resuspended in 50 mM potassium phosphate buffer (pH 8.0) containing 8 mM imidazole, and disrupted by sonication and centrifuged to obtain cell-free extract. The cell-free extract was applied to a Ni-NTA spin column (Qiagen, Hilden, Germany) equilibrated with lysis buffer (NPI-10 buffer containing 50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0). The spin column was washed twice with wash buffer (NPI-20 buffer containing 50 mM NaH2PO4, 300 mM NaCl, and 20 mM imidazole, with pH 8.0) and eluted with elution buffer (NPI-500 buffer containing 50 mM NaH2PO4, 300 mM NaCl, 500 mM imidazole, pH 8.0) to yield recombinant NCPAH. The buffer of the resulting eluate was replaced with 50 mM potassium phosphate buffer (pH 8) using an Amicon Ultra-0.5 centrifugal filter unit (30 kDa cut off; Millipore, Billerica, MA, USA), in which addition of 400 µL of the same buffer followed by centrifugation (14,000× g for 10 min at 4 °C) was repeated five times. The purity of the protein was verified using SDS-polyacrylamide gel electrophoresis (Supplementary Figure S2). The protein concentration was determined with a Bradford assay using bovine serum albumin as a standard.

2.6. Enzymatic Assay Using Recombinant NCPAH

An enzymatic assay was performed at 50 °C for 40 min in a 400 µL reaction mixture containing 50 mM MES-NaOH buffer (pH 7.0), 20 ng/µL NCPAH, and 0–1.5 mM N-carbamoylputrescine. The reaction was started by adding different concentrations of N-carbamoylputrescine. Then, 100 µL aliquots were taken at 0, 20, and 40 min and the reactions were stopped by heating for 3 min at 95 °C. Activity was measured by quantifying ammonia released from N-carbamoylputrescine using indophenol blue method (calorimetric method) as described previously [48]. The standard curve was created by measuring the absorbance at 640 nm using known concentrations of NH4Cl. The kinetic parameters were determined by curve fitting the experimental data under different concentrations of N-carbamoylputrescine to Michaelis–Menten equation (GraphPad Prism v8.4.3).
The optimal temperature was determined by changing the reaction temperature within 20–60 °C. The enzymatic assay was performed for 60 min in a 400 µL reaction mixture containing 50 mM MES-NaOH buffer (pH 6.5), 20 ng/µL NCPAH, and 1 mM N-carbamoylputrescine, and the activity was measured with the indophenol blue method as mentioned above.
The optimal pH was determined by using different buffers (MES-NaOH buffer for pH 5.5–7.0; HEPES-NaOH buffer for pH 7.0–8.0; and TAPS-NaOH buffer for pH 8.0–9.0). The assay was conducted at 50 °C for 60 min in a 100 µL reaction mixture containing 50 mM buffer, 20 ng/µL NCPAH, and 1 mM N-carbamoylputrescine. The reaction was stopped by adding 100% (w/v) trichloroacetic acid to give a final concentration of 10% (w/v). After centrifugation at 21,487× g for 10 min, the supernatant was filtered using Cosmonice filter W (Nacalai Tesque Inc.) and subjected to HPLC, in which the activity was measured by quantifying the concentration of putrescine. The standard curve was created based on known concentrations of putrescine.
The effect of polyamines and their derivative compounds on the enzymatic activity was examined by adding 1 mM arginine, agmatine, putrescine, or spermidine into the reaction mixture. The assay was conducted at 50 °C for 40 min in a 100 µL reaction mixture containing 50 mM MES-NaOH buffer (pH 7.0), 5 ng/µL NCPAH, and 1 mM N-carbamoylputrescine. The activity was measured by quantifying putrescine using HPLC.

3. Results

3.1. Disruption of Ncpah Abolishes Accumulation of Intracellular Spermidine in B. thetaiotaomicron

To examine the physiological role of ncpah in the bacterial growth and polyamine production of B. thetaiotaomicron, we generated a ncpah deletion strain (Δncpah) and a ncpah-complemented strain of B. thetaiotaomicron. Growth of the Δncpah strain was slower in polyamine-free medium compared with those of parental and ncpah-complemented strains (Figure 2A). The generation time was longer in the Δncpah mutant strain (144.4 ± 0.3 min) compared to parental strain and ncpah-complemented strains (112.7 ± 0.4 and 116.8 ± 0.7 min), but was indistinguishable between the parental and ncpah-complemented strains. We also confirmed that the parental strain produced intracellular spermidine as the sole polyamine, and the concentration of spermidine was decreased from exponential to stationary phases (from 56.7 to 36.2 nmol/mg cellular protein) (Figure 2B; Supplementary Figure S1). While the ability of Δncpah to produce spermidine was severely decreased (<6 nmol/mg cellular protein), the complementation of ncpah restored the production of spermidine (36.1–55.7 nmol/mg cellular protein). These results indicate that ncpah is involved in spermidine biosynthesis and contributes to growth in B. thetaiotaomicron. Another finding was that the Δncpah strain intracellularly produced the two unidentified putative amine compounds (Figure 2C,D), which were neither N-carbamoylputrescine, putrescine, cadaverine, spermidine, agmatine, nor spermine (Supplementary Figure S1).

3.2. NCPAH Converts N-carbamoylputrescine to Putrescine and the Activity Is Regulated by Polyamines and the Polyamine Precursor Agmatine

NCPAH was characterized using the purified recombinant NCPAH-(His)6 (Supplementary Figure S2). An enzymatic assay using indophenol blue method showed that NCPAH converts N-carbamoylputrescine to putrescine (Supplementary Figure S3). Next, the effect of reaction temperature (20–90 °C) on the enzymatic activity was examined using indophenol blue method, and the result showed the optimal temperature was 50 °C (Figure 3A), in which the activity was 10 µmol NH3/min/mg, and the enzymatic activity was decreased at over 70 °C, probably due to the heat denaturation. Additionally, the effect of pH (5.5–9.0) on the activity was examined using HPLC to measure putrescine levels, and the results showed the optimal pH was 7.0, at which the activity was 11.6 µmol putrescine/min/mg (Figure 3B), and the activity was decreased to less than 40% either under pH 6.0 or over pH 8.5. The kinetic analysis, in which the NCPAH reactions were performed with varying concentrations of N-carbamoylputrescine and the initial velocity of NH3 formation was analyzed with the indophenol blue method (Supplementary Figure S3), showed that NCPAH has a substrate–saturation curve with N-carbamoylputrescine as a substrate (fitting to the Michaelis–Menten equation) (Figure 3C). The Michaelis constant (Km) and turnover number (kcat) were 730 µM and 0.8 s−1, respectively, resulting in 1.0 s−1 mM −1 of the catalytic activity (kcat/Km). Furthermore, the effect of polyamines and their derivatives on the enzymatic activity was examined, and the addition of agmatine and spermidine at a final concentration of 1 mM inhibited the NCPAH reaction by over 80%, with the greatest extent of inhibition. In addition, the inhibitory effect of putrescine on the NCPAH reaction is approximately 50%, and there was no obvious inhibitory effect of arginine on the NCPAH reaction (Figure 3D).

4. Discussion

In this study, we aimed to demonstrate the importance of NCPAH, an enzyme involved in the polyamine biosynthetic pathway in B. thetaiotaomicron. We cultured the parental strain, the Δncpah and the ncpah-complemented strain of B. thetaiotaomicron in polyamine-free minimal medium and compared the intracellular polyamine profiles and growth. Only spermidine was present in the parental strain (Supplementary Figure S1), which is consistent with previous studies on polyamines produced by B. thetaiotaomicron [45,49,50]. In contrast, intracellular spermidine was significantly reduced in the Δncpah strain, whereas reduced spermidine levels in the ncpah-complemented strain were restored to levels similar to those in the parental strain (Figure 2B). These results suggested that ncpah plays an important role in spermidine biosynthesis in B. thetaiotaomicron.
The activity of NCPAH of B. thetaiotaomicron was found to be inhibited by the addition of polyamines or the polyamine precursor agmatine belonging to the polyamine biosynthetic pathway of B. thetaiotaomicron (Figure 3D). Putrescine, a product of NCPAH, inhibited moderately (by approximately 50%) the activity of NCPAH. It is noteworthy that the reaction catalyzed by NCPAH was inhibited significantly more strongly (over 80%) by spermidine, the product of a two-step later reaction than by putrescine, the direct product. Threonine dehydrogenase is known to be 50% feedback inhibited by its reaction products [51]. However, NCPAH was more inhibited by the reaction product compared to threonine dehydrogenase. Note that such feedback inhibition has not been reported in previous reports on NCPAH from other organisms. For example, NCPAH from P. aeruginosa was not inhibited by 1 mM of arginine, ornithine, putrescine, or spermidine [52]. Of note, biochemical analyses of NCPAH have been reported in Arabidopsis thaliana [53], Selenomonas ruminatium [54], C. jejuni [33], and Medicago truncatula [55], but feedback inhibition studies of NCPAH derived from these species have not been reported. Spermidine has stronger physiological activity than putrescine and is known to have adverse effects on the organism when accumulated in excessive amounts. This suggests that feedback inhibition of B. thetaiotaomicron in the cells prevents the excessive accumulation of spermidine. On the other hand, the kinetic parameters of NCAPH in B. thetaiotaomicron are comparable to those of NCPAH in P. aeruginosa [52] and Selenomonas ruminatium [54], which have been reported in previous studies (Table 3). Taken together, the results suggest that the activity of the polyamine biosynthetic enzyme NCPAH, whose enzyme activity is comparable to NCPAH in other organisms, is tightly controlled by intracellular polyamines and the polyamine precursor agmatine, supporting the existence of an in vivo polyamine homeostasis employing a feedback mechanism so far identified only in B. thetaiotaomicron cells.
ncpah deletion strains accumulated two unidentified compounds whose retention times differed from those of N-carbamoylputrescine, putrescine, agmatine, carboxyspermidine, spermidine, and spermine (Supplementary Figure S1). These are not found in the parental and ncpah complementary strains. The purification and structural determination of these molecules could lead to the identification of a novel spermidine biosynthetic pathway in B. thetaiotaomicron. In the ncpah deletion strain, a trace amount of spermidine was present in the cells despite the deletion of ncpah (Supplementary Figure S1). In this experiment, the strains were precultured in medium containing polyamines, washed once with main culture medium containing no polyamines, and then their suspensions were added to the main culture medium, so it is thought that almost no spermidine was brought in from the preculture. It is also unlikely that spermidine was brought in from cells of the ncpah deletion strain that were precultured in the GAM medium (containing polyamines). Since the intracellular spermidine concentration of ncpah deletion strains precultured in the GAM medium was unknown, we used the intracellular spermidine concentration of wild-type B. thetaiotaomicron when cultured in the GAM medium for 24 h [56] for discussion. For the washed bacterial suspension obtained from the preculture solution, the spermidine in the bacteria corresponding to OD600 = 0.03, the turbidity of the first outbreak of the main culture, was roughly estimated to be 0.47 nmol/mg. In contrast, the intracellular spermidine concentrations found in the ncpah deletion strains ranged from 2 nmol/mg to 6 nmol/mg, suggesting that more spermidine was detected in the ncpah deletion strains than was brought in from the preculture. It has been reported that P. aeruginosa ncpah mutants grew slightly on media supplemented with N-carbamoylputrescine as the sole carbon source [57]. Furthermore, another paper reported that crude extracts of ncpah mutants exhibit a slight N-carbamoylputrescine amidohydrolase activity [58]. Taken together, it was suggested that an alternative pathway in P. aeruginosa converts N-carbamoylputrescine to putrescine. In fact, it has been reported that in ncpah-deficient strains of P. aeruginosa, the accumulated N-carbamoylputrescine induces acetylpolyamine amidohydrolase, which in turn activates a pathway that converts N-carbamoylputrescine, not the original substrate, into putrescine [59]. However, a homology search for acetylpolyamine amidohydrolase revealed that there is no corresponding enzyme in B. thetaiotaomicron (data not shown). Therefore, in B. thetaiotaomicron, it is suggested that there is a different pathway to that reported in P. aeruginosa [59], which uses N-carbamoylputrescine as a substrate to produce putrescine through a side reaction of acetylpolyamine amidohydrolase. It has also been reported that in C. jejuni, a deficiency of the enzyme CASDH, which converts putrescine to carboxyspermidine, results in a significant accumulation of the downstream product spermidine [33]. In C. jejuni, the deletion of casdh is thought to activate the alternative pathway, and similarly, in B. thetaiotaomicron, the subject of this paper, the deletion of ncpah may activate the alternative pathway. This activation could be due to unidentified compound(s) that accumulate in ncpah-deficient strains.
B. thetaiotaomicron does not export polyamines in vitro [45]; there are no data on the production of polyamines in the gut. To clarify this, it is necessary to generate gnotobiotic mice monocolonized with B. thetaiotaomicron and analyse the production of polyamines by B. thetaiotaomicron in the intestinal lumen.

5. Conclusions

Δncpah and complemented strains were generated, and the intracellular polyamines of these strains were cultured in a polyamine-free minimal medium. Spermidine, which was detected in the parental and complemented strains, was depleted in the gene deletion strain. The purified NCPAH-(His)6 was characterised and observed to be capable of converting N-carbamoylputrescine to putrescine. In addition, we observed that agmatine and spermidine, which are produced in the polyamine biosynthetic pathway, strongly inhibited the activity of NCPAH. This feedback inhibition is suggested to regulate the reaction catalysed by NCPAH and may play a role in the intracellular polyamine homeostasis of B. thetaiotaomicron. Bacteria of the genus Bacteroides occupy >30% of the lumen of the human colon. Therefore, the findings on B. thetaiotaomicron may explain a significant part of the polyamine dynamics in the human intestinal lumen.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/biomedicines11041123/s1, Figure S1: Polyamine profiles in the cells of parental and Δncpah mutant strains of B. thetaiotaomicron; Figure S2. SDS-PAGE analysis of purified recombinant NCPAH-(His)6; Figure S3. Determination of reaction rates of NCPAH at different substrate concentrations.

Author Contributions

S.K. conceived the study and designed the experimental design; M.S., Y.F. and Y.S. contributed to the bacterial growth experiment; Y.F. and H.O. performed the purification and characterization of NCPAH; H.S. and M.S. drafted the manuscript. All authors discussed the data and contributed to completing the manuscript. S.K. edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was partly supported by Grants-in-Aids from the Institute for Fermentation, Osaka (K-25-04 to MS and SK), JSPS-KAKENHI (17H05026 and 20H02908 to SK), Novozymes Japan Research Fund 2016.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the main article and Supplementary Materials.

Acknowledgments

We thank Thomas J. Smith (Donald Danforth Plant Science Center, St. Louis, MO, USA) and Nicole Koropatkin (University of Michigan Medical School, Ann Arbor, MI, USA) for providing the genetic tools for B. thetaiotaomicron, the National BioResource Project (NIG, Mishima, Japan) for providing E. coli S17-1 λpir, and the Japan Collection of Microorganisms, RIKEN BRC which is participating in the National BioResource Project of the MEXT, Japan for providing B. thetaiotaomicron JCM 5827T.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Igarashi, K.; Kashiwagi, K. Polyamines: Mysterious modulators of cellular functions. Biochem. Biophys. Res. Commun. 2000, 271, 559–564. [Google Scholar] [CrossRef]
  2. Soda, K.; Dobashi, Y.; Kano, Y.; Tsujinaka, S.; Konishi, F. Polyamine-rich food decreases age-associated pathology and mortality in aged mice. Exp. Gerontol. 2009, 44, 727–732. [Google Scholar] [CrossRef]
  3. Eisenberg, T.; Knauer, H.; Schauer, A.; Buttner, S.; Ruckenstuhl, C.; Carmona-Gutierrez, D.; Ring, J.; Schroeder, S.; Magnes, C.; Antonacci, L.; et al. Induction of autophagy by spermidine promotes longevity. Nat. Cell. Biol. 2009, 11, 1305–1314. [Google Scholar] [CrossRef]
  4. Matsumoto, M.; Kurihara, S.; Kibe, R.; Ashida, H.; Benno, Y. Longevity in mice is promoted by probiotic-induced suppression of colonic senescence dependent on upregulation of gut bacterial polyamine production. PLoS ONE 2011, 6, e23652. [Google Scholar] [CrossRef] [Green Version]
  5. Soda, K.; Kano, Y.; Chiba, F.; Koizumi, K.; Miyaki, Y. Increased polyamine intake inhibits age-associated alteration in global DNA methylation and 1,2-dimethylhydrazine-induced tumorigenesis. PLoS ONE 2013, 8, e64357. [Google Scholar] [CrossRef] [Green Version]
  6. Kibe, R.; Kurihara, S.; Sakai, Y.; Suzuki, H.; Ooga, T.; Sawaki, E.; Muramatsu, K.; Nakamura, A.; Yamashita, A.; Kitada, Y.; et al. Upregulation of colonic luminal polyamines produced by intestinal microbiota delays senescence in mice. Sci. Rep. 2014, 4, 4548. [Google Scholar] [CrossRef] [Green Version]
  7. Gupta, V.K.; Scheunemann, L.; Eisenberg, T.; Mertel, S.; Bhukel, A.; Koemans, T.S.; Kramer, J.M.; Liu, K.S.; Schroeder, S.; Stunnenberg, H.G.; et al. Restoring polyamines protects from age-induced memory impairment in an autophagy-dependent manner. Nat. Neurosci. 2013, 16, 1453–1460. [Google Scholar] [CrossRef]
  8. Eisenberg, T.; Abdellatif, M.; Schroeder, S.; Primessnig, U.; Stekovic, S.; Pendl, T.; Harger, A.; Schipke, J.; Zimmermann, A.; Schmidt, A.; et al. Cardioprotection and lifespan extension by the natural polyamine spermidine. Nat. Med. 2016, 22, 1428–1438. [Google Scholar] [CrossRef]
  9. Nakamura, A.; Kurihara, S.; Takahashi, D.; Ohashi, W.; Nakamura, Y.; Kimura, S.; Onuki, M.; Kume, A.; Sasazawa, Y.; Furusawa, Y.; et al. Symbiotic polyamine metabolism regulates epithelial proliferation and macrophage differentiation in the colon. Nat. Commun. 2021, 12, 2105. [Google Scholar] [CrossRef]
  10. Al-Habsi, M.; Chamoto, K.; Matsumoto, K.; Nomura, N.; Zhang, B.; Sugiura, Y.; Sonomura, K.; Maharani, A.; Nakajima, Y.; Wu, Y.; et al. Spermidine activates mitochondrial trifunctional protein and improves antitumor immunity in mice. Science 2022, 378, eabj3510. [Google Scholar] [CrossRef]
  11. Wirth, M.; Schwarz, C.; Benson, G.; Horn, N.; Buchert, R.; Lange, C.; Kobe, T.; Hetzer, S.; Maglione, M.; Michael, E.; et al. Effects of spermidine supplementation on cognition and biomarkers in older adults with subjective cognitive decline (SmartAge)-study protocol for a randomized controlled trial. Alzheimers Res. Ther. 2019, 11, 36. [Google Scholar] [CrossRef]
  12. Gerner, E.W.; Meyskens, F.L., Jr. Polyamines and cancer: Old molecules, new understanding. Nat. Rev. Cancer 2004, 4, 781–792. [Google Scholar] [CrossRef] [Green Version]
  13. Casero, R.A., Jr.; Murray Stewart, T.; Pegg, A.E. Polyamine metabolism and cancer: Treatments, challenges and opportunities. Nat. Rev. Cancer 2018, 18, 681–695. [Google Scholar] [CrossRef]
  14. Matsumoto, M.; Kibe, R.; Ooga, T.; Aiba, Y.; Kurihara, S.; Sawaki, E.; Koga, Y.; Benno, Y. Impact of intestinal microbiota on intestinal luminal metabolome. Sci. Rep. 2012, 2, 233. [Google Scholar] [CrossRef] [Green Version]
  15. Tabor, C.W.; Tabor, H. Polyamines in microorganisms. Microbiol. Rev. 1985, 49, 81–99. [Google Scholar] [CrossRef]
  16. Michael, A.J. Biosynthesis of Polyamines in Eukaryotes, Archaea, and Bacteria. In Polyamines: A Universal Molecular Nexus for Growth, Survival, and Specialized Metabolism; Tomonobu Kusano, H.S., Ed.; Springer: Berlin/Heidelberg, Germany, 2015; pp. 3–14. [Google Scholar]
  17. Boyle, S.M.; Markham, G.D.; Hafner, E.W.; Wright, J.M.; Tabor, H.; Tabor, C.W. Expression of the cloned genes encoding the putrescine biosynthetic enzymes and methionine adenosyltransferase of Escherichia coli (speA, speB, speC and metK). Gene 1984, 30, 129–136. [Google Scholar] [CrossRef]
  18. Tabor, C.W.; Tabor, H.; Xie, Q.W. Spermidine synthase of Escherichia coli: Localization of the speE gene. Proc. Natl. Acad. Sci. USA 1986, 83, 6040–6044. [Google Scholar] [CrossRef] [Green Version]
  19. Pistocchi, R.; Kashiwagi, K.; Miyamoto, S.; Nukui, E.; Sadakata, Y.; Kobayashi, H.; Igarashi, K. Characteristics of the operon for a putrescine transport system that maps at 19 minutes on the Escherichia coli chromosome. J. Biol. Chem. 1993, 268, 146–152. [Google Scholar] [CrossRef]
  20. Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 2000, 97, 6640–6645. [Google Scholar] [CrossRef] [Green Version]
  21. Kurihara, S.; Tsuboi, Y.; Oda, S.; Kim, H.G.; Kumagai, H.; Suzuki, H. The putrescine Importer PuuP of Escherichia coli K-12. J. Bacteriol. 2009, 191, 2776–2782. [Google Scholar] [CrossRef] [Green Version]
  22. Kurihara, S.; Suzuki, H.; Oshida, M.; Benno, Y. A novel putrescine importer required for type 1 pili-driven surface motility induced by extracellular putrescine in Escherichia coli K-12. J. Biol. Chem. 2011, 286, 10185–10192. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  23. Sugiyama, Y.; Nakamura, A.; Matsumoto, M.; Kanbe, A.; Sakanaka, M.; Higashi, K.; Igarashi, K.; Katayama, T.; Suzuki, H.; Kurihara, S. A Novel Putrescine Exporter SapBCDF of Escherichia coli. J. Biol. Chem. 2016, 291, 26343–26351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Kashiwagi, K.; Miyamoto, S.; Suzuki, F.; Kobayashi, H.; Igarashi, K. Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli. Proc. Natl. Acad. Sci. USA 1992, 89, 4529–4533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Kashiwagi, K.; Shibuya, S.; Tomitori, H.; Kuraishi, A.; Igarashi, K. Excretion and uptake of putrescine by the PotE protein in Escherichia coli. J. Biol. Chem. 1997, 272, 6318–6323. [Google Scholar] [CrossRef] [Green Version]
  26. Higashi, K.; Ishigure, H.; Demizu, R.; Uemura, T.; Nishino, K.; Yamaguchi, A.; Kashiwagi, K.; Igarashi, K. Identification of a spermidine excretion protein complex (MdtJI) in Escherichia coli. J. Bacteriol. 2008, 190, 872–878. [Google Scholar] [CrossRef] [Green Version]
  27. Shaibe, E.; Metzer, E.; Halpern, Y.S. Metabolic pathway for the utilization of L-arginine, L-ornithine, agmatine, and putrescine as nitrogen sources in Escherichia coli K-12. J. Bacteriol. 1985, 163, 933–937. [Google Scholar] [CrossRef] [Green Version]
  28. Kurihara, S.; Oda, S.; Kato, K.; Kim, H.G.; Koyanagi, T.; Kumagai, H.; Suzuki, H. A novel putrescine utilization pathway involves gamma-glutamylated intermediates of Escherichia coli K-12. J. Biol. Chem. 2005, 280, 4602–4608. [Google Scholar] [CrossRef] [Green Version]
  29. Schneider, B.L.; Reitzer, L. Pathway and enzyme redundancy in putrescine catabolism in Escherichia coli. J. Bacteriol. 2012, 194, 4080–4088. [Google Scholar] [CrossRef] [Green Version]
  30. Kurihara, S.; Oda, S.; Tsuboi, Y.; Kim, H.G.; Oshida, M.; Kumagai, H.; Suzuki, H. gamma-Glutamylputrescine synthetase in the putrescine utilization pathway of Escherichia coli K-12. J. Biol. Chem. 2008, 283, 19981–19990. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  31. Kurihara, S.; Oda, S.; Kumagai, H.; Suzuki, H. Gamma-glutamyl-gamma-aminobutyrate hydrolase in the putrescine utilization pathway of Escherichia coli K-12. FEMS Microbiol. Lett. 2006, 256, 318–323. [Google Scholar] [CrossRef] [PubMed]
  32. Kurihara, S.; Kato, K.; Asada, K.; Kumagai, H.; Suzuki, H. A putrescine-inducible pathway comprising PuuE-YneI in which gamma-aminobutyrate is degraded into succinate in Escherichia coli K-12. J. Bacteriol. 2010, 192, 4582–4591. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Hanfrey, C.C.; Pearson, B.M.; Hazeldine, S.; Lee, J.; Gaskin, D.J.; Woster, P.M.; Phillips, M.A.; Michael, A.J. Alternative spermidine biosynthetic route is critical for growth of Campylobacter jejuni and is the dominant polyamine pathway in human gut microbiota. J. Biol. Chem. 2011, 286, 43301–43312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Qin, J.; Li, R.; Raes, J.; Arumugam, M.; Burgdorf, K.S.; Manichanh, C.; Nielsen, T.; Pons, N.; Levenez, F.; Yamada, T.; et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 2010, 464, 59–65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  35. Llacer, J.L.; Polo, L.M.; Tavarez, S.; Alarcon, B.; Hilario, R.; Rubio, V. The gene cluster for agmatine catabolism of Enterococcus faecalis: Study of recombinant putrescine transcarbamylase and agmatine deiminase and a snapshot of agmatine deiminase catalyzing its reaction. J. Bacteriol. 2007, 189, 1254–1265. [Google Scholar] [CrossRef] [Green Version]
  36. Suarez, C.; Espariz, M.; Blancato, V.S.; Magni, C. Expression of the agmatine deiminase pathway in Enterococcus faecalis is activated by the AguR regulator and repressed by CcpA and PTS(Man) systems. PLoS ONE 2013, 8, e76170. [Google Scholar] [CrossRef] [Green Version]
  37. Wrzosek, L.; Miquel, S.; Noordine, M.L.; Bouet, S.; Joncquel Chevalier-Curt, M.; Robert, V.; Philippe, C.; Bridonneau, C.; Cherbuy, C.; Robbe-Masselot, C.; et al. Bacteroides thetaiotaomicron and Faecalibacterium prausnitzii influence the production of mucus glycans and the development of goblet cells in the colonic epithelium of a gnotobiotic model rodent. BMC Biol. 2013, 11, 61. [Google Scholar] [CrossRef] [Green Version]
  38. Delday, M.; Mulder, I.; Logan, E.T.; Grant, G. Bacteroides thetaiotaomicron Ameliorates Colon Inflammation in Preclinical Models of Crohn’s Disease. Inflamm. Bowel Dis. 2019, 25, 85–96. [Google Scholar] [CrossRef] [Green Version]
  39. Kelly, D.; Campbell, J.I.; King, T.P.; Grant, G.; Jansson, E.A.; Coutts, A.G.; Pettersson, S.; Conway, S. Commensal anaerobic gut bacteria attenuate inflammation by regulating nuclear-cytoplasmic shuttling of PPAR-gamma and RelA. Nat. Immunol. 2004, 5, 104–112. [Google Scholar] [CrossRef]
  40. Mishra, V.; Banga, J.; Silveyra, P. Oxidative stress and cellular pathways of asthma and inflammation: Therapeutic strategies and pharmacological targets. Pharmacol. Ther. 2018, 181, 169–182. [Google Scholar] [CrossRef]
  41. Alsharairi, N.A. The Role of Short-Chain Fatty Acids in the Interplay between a Very Low-Calorie Ketogenic Diet and the Infant Gut Microbiota and Its Therapeutic Implications for Reducing Asthma. Int. J. Mol. Sci. 2020, 21, 9580. [Google Scholar] [CrossRef]
  42. Vangay, P.; Johnson, A.J.; Ward, T.L.; Al-Ghalith, G.A.; Shields-Cutler, R.R.; Hillmann, B.M.; Lucas, S.K.; Beura, L.K.; Thompson, E.A.; Till, L.M.; et al. US Immigration Westernizes the Human Gut Microbiome. Cell 2018, 175, 962–972.e10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Valles-Colomer, M.; Falony, G.; Darzi, Y.; Tigchelaar, E.F.; Wang, J.; Tito, R.Y.; Schiweck, C.; Kurilshikov, A.; Joossens, M.; Wijmenga, C.; et al. The neuroactive potential of the human gut microbiota in quality of life and depression. Nat. Microbiol. 2019, 4, 623–632. [Google Scholar] [CrossRef] [PubMed]
  44. Igarashi, K.; Kashiwagi, K. Characteristics of cellular polyamine transport in prokaryotes and eukaryotes. Plant. Physiol. Biochem. 2010, 48, 506–512. [Google Scholar] [CrossRef] [PubMed]
  45. Sakanaka, M.; Sugiyama, Y.; Kitakata, A.; Katayama, T.; Kurihara, S. Carboxyspermidine decarboxylase of the prominent intestinal microbiota species Bacteroides thetaiotaomicron is required for spermidine biosynthesis and contributes to normal growth. Amino Acids 2016, 48, 2443–2451. [Google Scholar] [CrossRef] [PubMed]
  46. Koropatkin, N.M.; Martens, E.C.; Gordon, J.I.; Smith, T.J. Starch catabolism by a prominent human gut symbiont is directed by the recognition of amylose helices. Structure 2008, 16, 1105–1115. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Gotoh, A.; Nara, M.; Sugiyama, Y.; Sakanaka, M.; Yachi, H.; Kitakata, A.; Nakagawa, A.; Minami, H.; Okuda, S.; Katoh, T.; et al. Use of Gifu Anaerobic Medium for culturing 32 dominant species of human gut microbes and its evaluation based on short-chain fatty acids fermentation profiles. Biosci. Biotechnol. Biochem. 2017, 81, 2009–2017. [Google Scholar] [CrossRef] [Green Version]
  48. Baumann, S.; Sander, A.; Gurnon, J.R.; Yanai-Balser, G.M.; Van Etten, J.L.; Piotrowski, M. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway. Virology 2007, 360, 209–217. [Google Scholar] [CrossRef] [Green Version]
  49. Hosoya, R.; Hamana, K. Distribution of two triamines, spermidine and homospermidine, and an aromatic amine, 2-phenylethylamine, within the phylum Bacteroidetes. J. Gen. Appl. Microbiol. 2004, 50, 255–260. [Google Scholar] [CrossRef] [Green Version]
  50. Hamana, K.; Itoh, T.; Benno, Y.; Hayashi, H. Polyamine distribution profiles of new members of the phylum Bacteroidetes. J. Gen. Appl. Microbiol. 2008, 54, 229–236. [Google Scholar] [CrossRef] [Green Version]
  51. Bell, S.C.; Turner, J.M. Bacterial catabolism of threonine. Threonine degradation initiated by l-threonine hydrolyase (deaminating) in a species of Corynebacterium. Biochem. J. 1977, 164, 579–587. [Google Scholar] [CrossRef] [Green Version]
  52. Nakada, Y.; Itoh, Y. Identification of the putrescine biosynthetic genes in Pseudomonas aeruginosa and characterization of agmatine deiminase and N-carbamoylputrescine amidohydrolase of the arginine decarboxylase pathway. Microbiology 2003, 149, 707–714. [Google Scholar] [CrossRef] [PubMed]
  53. Piotrowski, M.; Janowitz, T.; Kneifel, H. Plant C-N hydrolases and the identification of a plant N-carbamoylputrescine amidohydrolase involved in polyamine biosynthesis. J. Biol. Chem. 2003, 278, 1708–1712. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Liao, S.; Poonpairoj, P.; Ko, K.C.; Takatuska, Y.; Yamaguchi, Y.; Abe, N.; Kaneko, J.; Kamio, Y. Occurrence of agmatine pathway for putrescine synthesis in Selenomonas ruminatium. Biosci. Biotechnol. Biochem. 2008, 72, 445–455. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Sekula, B.; Ruszkowski, M.; Malinska, M.; Dauter, Z. Structural Investigations of N-carbamoylputrescine Amidohydrolase from Medicago truncatula: Insights into the Ultimate Step of Putrescine Biosynthesis in Plants. Front. Plant. Sci. 2016, 7, 350. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Sugiyama, Y.; Nara, M.; Sakanaka, M.; Gotoh, A.; Kitakata, A.; Okuda, S.; Kurihara, S. Comprehensive analysis of polyamine transport and biosynthesis in the dominant human gut bacteria: Potential presence of novel polyamine metabolism and transport genes. Int. J. Biochem. Cell. Biol. 2017, 93, 52–61. [Google Scholar] [CrossRef]
  57. Nakada, Y.; Jiang, Y.; Nishijyo, T.; Itoh, Y.; Lu, C.D. Molecular characterization and regulation of the aguBA operon, responsible for agmatine utilization in Pseudomonas aeruginosa PAO1. J. Bacteriol. 2001, 183, 6517–6524. [Google Scholar] [CrossRef] [Green Version]
  58. Haas, D.; Matsumoto, H.; Moretti, P.; Stalon, V.; Mercenier, A. Arginine degradation in Pseudomonas aeruginosa mutants blocked in two arginine catabolic pathways. Mol. Gen. Genet. 1984, 193, 437–444. [Google Scholar] [CrossRef]
  59. Chou, H.T.; Kwon, D.H.; Hegazy, M.; Lu, C.D. Transcriptome analysis of agmatine and putrescine catabolism in Pseudomonas aeruginosa PAO1. J. Bacteriol. 2008, 190, 1966–1975. [Google Scholar] [CrossRef] [Green Version]
Biomedicines 11 01123 g001 550
Figure 1. Polyamine biosynthetic pathway in B. thetaiotaomicron. The pathway is shown with the corresponding enzymes, which were predicted by BLASTP analyses in our previous study [45]. NCPAH, the enzyme analyzed in this study, is indicated by red characters, while the enzyme analyzed in our previous study is shown by blue characters. The other predicted enzymes are shown by orange characters. The abbreviations are as follows. SpeA: arginine decarboxylase; AIH: agmatine deiminase/iminohydrolase; NCPAH: N-carbamoylputrescine amidohydrolase; CASDH, carboxyspermidine dehydrogenase; CASDC: carboxyspermidine decarboxylase; PotABCD: ATP-binding cassette transporter for spermidine.
Figure 1. Polyamine biosynthetic pathway in B. thetaiotaomicron. The pathway is shown with the corresponding enzymes, which were predicted by BLASTP analyses in our previous study [45]. NCPAH, the enzyme analyzed in this study, is indicated by red characters, while the enzyme analyzed in our previous study is shown by blue characters. The other predicted enzymes are shown by orange characters. The abbreviations are as follows. SpeA: arginine decarboxylase; AIH: agmatine deiminase/iminohydrolase; NCPAH: N-carbamoylputrescine amidohydrolase; CASDH, carboxyspermidine dehydrogenase; CASDC: carboxyspermidine decarboxylase; PotABCD: ATP-binding cassette transporter for spermidine.
Biomedicines 11 01123 g001
Biomedicines 11 01123 g002 550
Figure 2. Disruption of ncpah affects growth and polyamine profiles in B. thetaiotaomicron. (A) Growth curve of parental strain (MS39), ncpah deletion strain (MS123), and ncpah-complemented strain (MS140) in polyamine-free minimal medium. (B) Intracellular spermidine concentrations at different cultivation times are shown. (C,D) The peak area of unknown amine compounds 1 and 2 present in the cells at different cultivation times are shown. The abundance of the unknown amine compounds was represented as peak areas due to lack of the appropriate standards. Circle: parental strain (MS39); triangle: Δncpah strain (MS123); square: ncpah-complemented strain (MS140). Data are mean ± standard deviation of biological triplicates.
Figure 2. Disruption of ncpah affects growth and polyamine profiles in B. thetaiotaomicron. (A) Growth curve of parental strain (MS39), ncpah deletion strain (MS123), and ncpah-complemented strain (MS140) in polyamine-free minimal medium. (B) Intracellular spermidine concentrations at different cultivation times are shown. (C,D) The peak area of unknown amine compounds 1 and 2 present in the cells at different cultivation times are shown. The abundance of the unknown amine compounds was represented as peak areas due to lack of the appropriate standards. Circle: parental strain (MS39); triangle: Δncpah strain (MS123); square: ncpah-complemented strain (MS140). Data are mean ± standard deviation of biological triplicates.
Biomedicines 11 01123 g002
Biomedicines 11 01123 g003 550
Figure 3. Characterization of recombinant NCPAH. (A) The effect of reaction temperature on activity was analyzed using the indophenol blue method. The reaction rate at 50 °C was set as 100% and the NCPAH activity at other temperatures was expressed as relative values. (B) The effect of pH on activity was analyzed using HPLC. The reaction rate at pH 7.0 was set as 100% and the NCPAH activity at other pH values was expressed as relative values. (C) Substrate–saturation curve of recombinant NCPAH with N-carbamoylputrescine as a substrate. The kinetic analysis was performed by varying the concentrations of N-carbamoylputrescine in NCPAH reactions using the indophenol blue method. (D) The effect of polyamines and their derivatives on activity was analyzed using HPLC. Arg: arginine; Agm: agmatine; Put: putrescine; Spd: spermidine.
Figure 3. Characterization of recombinant NCPAH. (A) The effect of reaction temperature on activity was analyzed using the indophenol blue method. The reaction rate at 50 °C was set as 100% and the NCPAH activity at other temperatures was expressed as relative values. (B) The effect of pH on activity was analyzed using HPLC. The reaction rate at pH 7.0 was set as 100% and the NCPAH activity at other pH values was expressed as relative values. (C) Substrate–saturation curve of recombinant NCPAH with N-carbamoylputrescine as a substrate. The kinetic analysis was performed by varying the concentrations of N-carbamoylputrescine in NCPAH reactions using the indophenol blue method. (D) The effect of polyamines and their derivatives on activity was analyzed using HPLC. Arg: arginine; Agm: agmatine; Put: putrescine; Spd: spermidine.
Biomedicines 11 01123 g003
Table
Table 1. Bacterial strains and plasmids used in this study.
Table 1. Bacterial strains and plasmids used in this study.
StrainDescriptionReference or Source
Escherichia coli
BL21 (DE3)Host for protein expression Novagen
S17-1 λpirDonor host in bacterial conjugation (for RP4 oriT/oriR6K derivative plasmids)National BioResource Project (NIG, Japan)
MS108pMSK5/ S17-1 λpirThis study
MS110pMSK6/ S17-1 λpirThis study
MS821pMSK106/BL21(DE3)This study
Bacteroides thetaiotaomicron
JCM5827TSame strain as ATCC 29148TJapan Collection of Microorganisms
MS39ATCC 29148T except Δtdk, GmR[46]
MS123MS39 except Δncpah, GmRThis study
MS140MS123 except att1::ncpah+, GmR, EmRThis study
Plasmid
pET23bPlasmid for protein expression, ColE1 replicon, ApRNovagen
pExchange-tdkPlasmid for gene disruption, RP4 oriT/oriR6K, tdk+, ApR, EmR[46]
pMSK5Plasmid for ncpah disruption, derivative of pExchange-tdk This study
pMSK6Plasmid for ncpah complementation, derivative of pNBU2-bla-ermGb This study
pMSK106C-terminal His6-tagged NCPAH expression plasmid, derivative of pET23bThis study
pNBU2-bla-ermGbPlasmid for gene complementation, RP4 oriT/oriR6K, ApR, EmR[46]
Table
Table 2. Primers used in this study.
Table 2. Primers used in this study.
PrimerNucleotide Sequence (5′-3′)
Pr-MS46TAACATTCGAGTCGAggtgtgatttattgaatacgcctg
Pr-MS47AAATAATTATTCATCcgagcagaatcacaattaatcac
Pr-MS48gatgaataattatttaatatgctactgaaatg
Pr-MS49TATCGATACCGTCGAttcacattcaacggctgg
Pr-MS50ATCTGTTTTTAAAGAatgaaaaagataaaagtaggattaatc
Pr-MS51ACCGCGGTGGCGGCCgtttatttacggagctgccaac
Pr-MS52TGATATCGAATTCCTtgatctggaagaagcaatg
Pr-MS53tctttaaaaacagatttggagtg
Pr-MS435AAGGAGATATACATAtgaaaaagataaaagtagga
Pr-MS436GGTGGTGGTGCTCGAgatccaaaaaacgtttggtg
Uppercase letters indicate the sequence for In-Fusion cloning.
Table
Table 3. Summary of biochemical functions of NCPAH from B. thetaiotaomicron and other bacteria.
Table 3. Summary of biochemical functions of NCPAH from B. thetaiotaomicron and other bacteria.
SpeciesOptimal Temperature
(°C)		Optimal pHKm
(mM)		kcat
(s−1)		kcat/Km
(mM−1 s−1)		References
Bacteroides thetaiotaomicron507.00.730.761.0This study
Pseudomonas aeruginosa408.00.503.36.6[52]
Selenomonas ruminatium457.00.220.180.81[54]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shimokawa, H.; Sakanaka, M.; Fujisawa, Y.; Ohta, H.; Sugiyama, Y.; Kurihara, S. N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota. Biomedicines 2023, 11, 1123. https://doi.org/10.3390/biomedicines11041123

AMA Style

Shimokawa H, Sakanaka M, Fujisawa Y, Ohta H, Sugiyama Y, Kurihara S. N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota. Biomedicines. 2023; 11(4):1123. https://doi.org/10.3390/biomedicines11041123

Chicago/Turabian Style

Shimokawa, Hiromi, Mikiyasu Sakanaka, Yuki Fujisawa, Hirokazu Ohta, Yuta Sugiyama, and Shin Kurihara. 2023. "N-Carbamoylputrescine Amidohydrolase of Bacteroides thetaiotaomicron, a Dominant Species of the Human Gut Microbiota" Biomedicines 11, no. 4: 1123. https://doi.org/10.3390/biomedicines11041123

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop