MicroRNA Monitoring in Human Alveolar Macrophages from Patients with Smoking-Related Lung Diseases: A Preliminary Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Bronchoalveolar Lavage
2.3. Clinical Biochemistry Assays and Real Time PCR (RT-PCR)
- hsa-miR-223-5p: CGUGUAUUUGACAAGCUGAGUU; (Assay ID 477984_mir);
- hsa-miR-16-5p: UAGCAGCACGUAAAUAUUGGCG; (Assay ID 477860_mir);
- hsa-miR-20a-5p: UAAAGUGCUUAUAGUGCAGGUAG; (Assay ID 478317_mir);
- hsa-miR-17-5p: CAAAGUGCUUACAGUGCAGGUAG; (Assay ID 478447_mir);
- hsa-miR-34a-5p: UGGCAGUGUCUUAGCUGGUUGU; (Assay ID 478048_mir);
- hsa-miR-106a-5p: AAAAGUGCUUACAGUGCAGGUAG; (Assay ID 478225_mir);
- U6 snRNA: GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT; (AssayID: 001973).
2.4. In Silico Analysis
2.5. Statistical Analysis
3. Results
3.1. miRNA Expression Levels
3.1.1. hsa-miR-223-5p
3.1.2. hsa-miR-16-5p and 20a-5p
3.1.3. hsa-miR-17-5p
3.1.4. hsa-miR-34a-5p
3.1.5. hsa-miR-106a-5p
3.2. In Silico Identification of Target mRNAs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- López-Campos, J.L.; Tan, W.; Soriano, J.B. Global burden of COPD. Respirology 2016, 21, 14–23. [Google Scholar] [CrossRef]
- Safiri, S.; Carson-Chahhoud, K.; Noori, M.; Nejadghaderi, S.A.; Sullman, M.J.M.; Ahmadian Heris, J.; Ansarin, K.; Mansournia, M.A.; Collins, G.S.; Kolahi, A.A.; et al. Burden of chronic obstructive pulmonary disease and its attributable risk factors in 204 countries and territories, 1990–2019: Results from the Global Burden of Disease Study 2019. BMJ 2022, 378, e069679. [Google Scholar] [CrossRef] [PubMed]
- Pauwels, R.A.; Rabe, K.F. Burden and Clinical Features of Chronic Obstructive Pulmonary Disease (COPD). Lancet 2004, 364, 613–620. [Google Scholar] [CrossRef] [PubMed]
- Kotlyarov, S. The Role of Smoking in the Mechanisms of Development of Chronic Obstructive Pulmonary Disease and Atherosclerosis. Int. J. Mol. Sci. 2023, 24, 8725. [Google Scholar] [CrossRef] [PubMed]
- Urbanek, K.; De Angelis, A.; Spaziano, G.; Piegari, E.; Matteis, M.; Cappetta, D.; Esposito, G.; Russo, R.; Tartaglione, G.; De Palma, R.; et al. Intratracheal Administration of Mesenchymal Stem Cells Modulates Tachykinin System, Suppresses Airway Remodeling and Reduces Airway Hyperresponsiveness in an Animal Model. PLoS ONE 2016, 11, e0158746. [Google Scholar] [CrossRef] [PubMed]
- D’Agostino, B.; Advenier, C.; De Palma, R.; Gallelli, L.; Marrocco, G.; Abbate, G.F.; Rossi, F. The Involvement of Sensory Neuropeptides in Airway Hyper-Responsiveness in Rabbits Sensitized and Challenged to Parietaria judaica: Sensory Neuropeptides in Airway Hyper-Responsiveness. Clin. Exp. Allergy 2002, 32, 472–479. [Google Scholar] [CrossRef] [PubMed]
- D’Agostino, B.; Marrocco, G.; De Nardo, M.; Calò, G.; Guerrini, R.; Gallelli, L.; Advenier, C.; Rossi, F. Activation of the Nociceptin/Orphanin FQ Receptor Reduces Bronchoconstriction and Microvascular Leakage in a Rabbit Model of Gastroesophageal Reflux: N/OFQ Effects in the Airways in a GER Animal Model. Br. J. Pharmacol. 2005, 144, 813–820. [Google Scholar] [CrossRef] [PubMed]
- Rouget, C.; Cui, Y.Y.; D’Agostino, B.; Faisy, C.; Naline, E.; Bardou, M.; Advenier, C. Nociceptin Inhibits Airway Microvascular Leakage Induced by HCl Intra-Oesophageal Instillation: Nociceptin and Gastro-Oesophageal Reflux. Br. J. Pharmacol. 2004, 141, 1077–1083. [Google Scholar] [CrossRef] [PubMed]
- Gallelli, L.; D’Agostino, B.; Marrocco, G.; De Rosa, G.; Filippelli, W.; Rossi, F.; Advenier, C. Role of Tachykinins in the Bronchoconstriction Induced by HCl Intraesophageal Instillation in the Rabbit. Life Sci. 2003, 72, 1135–1142. [Google Scholar] [CrossRef] [PubMed]
- Durham, A.L.; Adcock, I.M. The Relationship between COPD and Lung Cancer. Lung Cancer 2015, 90, 121–127. [Google Scholar] [CrossRef]
- Papi, A. COPD Increases the Risk of Squamous Histological Subtype in Smokers Who Develop Non-Small Cell Lung Carcinoma. Thorax 2004, 59, 679–681. [Google Scholar] [CrossRef] [PubMed]
- Young, R.P.; Hopkins, R.J. Link between COPD and Lung Cancer. Respir. Med. 2010, 104, 758–759. [Google Scholar] [CrossRef] [PubMed]
- Schetter, A.J.; Heegaard, N.H.H.; Harris, C.C. Inflammation and Cancer: Interweaving MicroRNA, Free Radical, Cytokine and P53 Pathways. Carcinogenesis 2010, 31, 37–49. [Google Scholar] [CrossRef] [PubMed]
- Caramori, G.; Adcock, I.M.; Casolari, P.; Ito, K.; Jazrawi, E.; Tsaprouni, L.; Villetti, G.; Civelli, M.; Carnini, C.; Chung, K.F.; et al. Unbalanced Oxidant-Induced DNA Damage and Repair in COPD: A Link towards Lung Cancer. Thorax 2011, 66, 521–527. [Google Scholar] [CrossRef] [PubMed]
- Schaible, A.M.; Filosa, R.; Temml, V.; Krauth, V.; Matteis, M.; Peduto, A.; Bruno, F.; Luderer, S.; Roviezzo, F.; Di Mola, A.; et al. Elucidation of the Molecular Mechanism and the Efficacy in Vivo of a Novel 1,4-Benzoquinone That Inhibits 5-Lipoxygenase. Br. J. Pharmacol. 2014, 171, 2399–2412. [Google Scholar] [CrossRef] [PubMed]
- Schaible, A.M.; Filosa, R.; Krauth, V.; Temml, V.; Pace, S.; Garscha, U.; Liening, S.; Weinigel, C.; Rummler, S.; Schieferdecker, S.; et al. The 5-Lipoxygenase Inhibitor RF-22c Potently Suppresses Leukotriene Biosynthesis in Cellulo and Blocks Bronchoconstriction and Inflammation In Vivo. Biochem. Pharmacol. 2016, 112, 60–71. [Google Scholar] [CrossRef] [PubMed]
- Mark, N.M.; Kargl, J.; Busch, S.E.; Yang, G.H.Y.; Metz, H.E.; Zhang, H.; Hubbard, J.J.; Pipavath, S.N.J.; Madtes, D.K.; Houghton, A.M. Chronic Obstructive Pulmonary Disease Alters Immune Cell Composition and Immune Checkpoint Inhibitor Efficacy in Non–Small Cell Lung Cancer. Am. J. Respir. Crit. Care Med. 2018, 197, 325–336. [Google Scholar] [CrossRef] [PubMed]
- Punturieri, A.; Szabo, E.; Croxton, T.L.; Shapiro, S.D.; Dubinett, S.M. Lung Cancer and Chronic Obstructive Pulmonary Disease: Needs and Opportunities for Integrated Research. JNCI J. Natl. Cancer Inst. 2009, 101, 554–559. [Google Scholar] [CrossRef] [PubMed]
- Hodge, S.; Hodge, G.; Ahern, J.; Jersmann, H.; Holmes, M.; Reynolds, P.N. Smoking Alters Alveolar Macrophage Recognition and Phagocytic Ability: Implications in Chronic Obstructive Pulmonary Disease. Am. J. Respir. Cell Mol. Biol. 2007, 37, 748–755. [Google Scholar] [CrossRef] [PubMed]
- de Groot, L.E.S.; van der Veen, T.A.; Martinez, F.O.; Hamann, J.; Lutter, R.; Melgert, B.N. Oxidative Stress and Macrophages: Driving Forces behind Exacerbations of Asthma and Chronic Obstructive Pulmonary Disease? Am. J. Physiol. Lung Cell. Mol. Physiol. 2019, 316, L369–L384. [Google Scholar] [CrossRef] [PubMed]
- Vlahos, R. Role of Alveolar Macrophages in Chronic Obstructive Pulmonary Disease. Front. Immunol. 2014, 5, 110822. [Google Scholar] [CrossRef] [PubMed]
- Finicelli, M.; Digilio, F.A.; Galderisi, U.; Peluso, G. The Emerging Role of Macrophages in Chronic Obstructive Pulmonary Disease: The Potential Impact of Oxidative Stress and Extracellular Vesicle on Macrophage Polarization and Function. Antioxidants 2022, 11, 464. [Google Scholar] [CrossRef] [PubMed]
- Polverino, F.; Mirra, D.; Yang, C.X.; Esposito, R.; Spaziano, G.; Rojas-Quintero, J.; Sgambato, M.; Piegari, E.; Cozzolino, A.; Cione, E.; et al. Similar Programmed Death Ligand 1 (PD-L1) Expression Profile in Patients with Mild COPD and Lung Cancer. Sci. Rep. 2022, 12, 22402. [Google Scholar] [CrossRef] [PubMed]
- Franco, R.; Schoneveld, O.; Georgakilas, A.G.; Panayiotidis, M.I. Oxidative Stress, DNA Methylation and Carcinogenesis. Cancer Lett. 2008, 266, 6–11. [Google Scholar] [CrossRef] [PubMed]
- Kabesch, M.; Adcock, I.M. Epigenetics in Asthma and COPD. Biochimie 2012, 94, 2231–2241. [Google Scholar] [CrossRef] [PubMed]
- Molina-Pinelo, S.; Pastor, M.D.; Suarez, R.; Romero-Romero, B.; Gonzalez De la Pena, M.; Salinas, A.; Garcia-Carbonero, R.; De Miguel, M.J.; Rodriguez-Panadero, F.; Carnero, A.; et al. MicroRNA Clusters: Dysregulation in Lung Adenocarcinoma and COPD. Eur. Respir. J. 2014, 43, 1740–1749. [Google Scholar] [CrossRef] [PubMed]
- Mirra, D.; Cione, E.; Spaziano, G.; Esposito, R.; Sorgenti, M.; Granato, E.; Cerqua, I.; Muraca, L.; Iovino, P.; Gallelli, L.; et al. Circulating MicroRNAs Expression Profile in Lung Inflammation: A Preliminary Study. J. Clin. Med. 2022, 11, 5446. [Google Scholar] [CrossRef] [PubMed]
- Lu, L.-F.; Liston, A. MicroRNA in the Immune System, MicroRNA as an Immune System. Immunology 2009, 127, 291–298. [Google Scholar] [CrossRef] [PubMed]
- Iannone, F.; Montesanto, A.; Cione, E.; Crocco, P.; Caroleo, M.C.; Dato, S.; Rose, G.; Passarino, G. Expression Patterns of Muscle-Specific MiR-133b and MiR-206 Correlate with Nutritional Status and Sarcopenia. Nutrients 2020, 12, 297. [Google Scholar] [CrossRef] [PubMed]
- Cannataro, R.; Caroleo, M.C.; Fazio, A.; La Torre, C.; Plastina, P.; Gallelli, L.; Lauria, G.; Cione, E. Ketogenic Diet and MicroRNAs Linked to Antioxidant Biochemical Homeostasis. Antioxidants 2019, 8, 269. [Google Scholar] [CrossRef] [PubMed]
- Leidinger, P.; Keller, A.; Borries, A.; Huwer, H.; Rohling, M.; Huebers, J.; Lenhof, H.P.; Meese, E. Specific peripheral miRNA profiles for distinguishing lung cancer from COPD. Lung Cancer 2011, 74, 41–47. [Google Scholar] [CrossRef] [PubMed]
- Keller, A.; Fehlmann, T.; Ludwig, N.; Kahraman, M.; Laufer, T.; Backes, C.; Vogelmeier, C.; Diener, C.; Biertz, F.; Herr, C.; et al. COSYCONET Study Group. Genome-wide MicroRNA Expression Profiles in COPD: Early Predictors for Cancer Development. Genom. Proteom. Bioinform. 2018, 16, 162–171. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Liao, Y.; Tang, L. MicroRNA-34 Family: A Potential Tumor Suppressor and Therapeutic Candidate in Cancer. J. Exp. Clin. Cancer Res. 2019, 38, 53. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y. MiR-223-5p Suppresses OTX1 to Mediate Malignant Progression of Lung Squamous Cell Carcinoma Cells. Comput. Math. Methods Med. 2021, 2021, 6248793. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Luo, Y.; Lin, M.; Peng, X.; Liu, M.; Wang, Y.; Li, S.; Yang, D.; Yang, Z. Serum Exosomal miR-16-5p Functions as a Tumor Inhibitor and a New Biomarker for PD-L1 Inhibitor-dependent Immunotherapy in Lung Adenocarcinoma by Regulating PD-L1 Expression. Cancer Med. 2022, 11, 2627–2643. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.; Sun, C.; Zhang, L.; Pan, Y. Clinical Significance of MiRNA—106a in Non-Small Cell Lung Cancer Patients Who Received Cisplatin Combined with Gemcitabine Chemotherapy. Cancer Biol. Med. 2018, 15, 157. [Google Scholar] [CrossRef] [PubMed]
- Han, J.; Hu, J.; Sun, F.; Bian, H.; Tang, B.; Fang, X. MicroRNA-20a-5p Suppresses Tumor Angiogenesis of Non-Small Cell Lung Cancer through RRM2-Mediated PI3K/Akt Signaling Pathway. Mol. Cell. Biochem. 2021, 476, 689–698. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Li, Y.; Qi, P.; Ma, Z. Biology of MiR-17-92 Cluster and Its Progress in Lung Cancer. Int. J. Med. Sci. 2018, 15, 1443–1448. [Google Scholar] [CrossRef] [PubMed]
- Sweat, Y.; Ries, R.J.; Sweat, M.; Su, D.; Shao, F.; Eliason, S.; Amendt, B.A. MiR-17 Acts as a Tumor Suppressor by Negatively Regulating the MiR-17-92 Cluster. Mol. Ther. Nucleic Acids 2021, 26, 1148–1158. [Google Scholar] [CrossRef] [PubMed]
- Fathinavid, A.; Ghobadi, M.Z.; Najafi, A.; Masoudi-Nejad, A. Identification of Common MicroRNA between COPD and Non-Small Cell Lung Cancer through Pathway Enrichment Analysis. BMC Genom. Data 2021, 22, 41. [Google Scholar] [CrossRef] [PubMed]
- Sokolowski, J.W., Jr.; Burgher, L.W.; Jones, F.L., Jr.; Patterson, J.R.; Selecky, P.A. Guidelines for fiberoptic bronchoscopy in adults. American Thoracic Society guidelines. Medical Section of the American Lung Association. Am. Rev. Respir. Dis. 1987, 136, 1066. [Google Scholar] [CrossRef] [PubMed]
- de Torres, J.P.; Marín, J.M.; Casanova, C.; Cote, C.; Carrizo, S.; Cordoba-Lanus, E.; Baz-Dávila, R.; Zulueta, J.J.; Aguirre-Jaime, A.; Saetta, M.; et al. Lung Cancer in Patients with Chronic Obstructive Pulmonary Disease: Incidence and Predicting Factors. Am. J. Respir. Crit. Care Med. 2011, 184, 913–919. [Google Scholar] [CrossRef] [PubMed]
- Park, H.Y.; Kang, D.; Shin, S.H.; Yoo, K.-H.; Rhee, C.K.; Suh, G.Y.; Kim, H.; Shim, Y.M.; Guallar, E.; Cho, J.; et al. Chronic Obstructive Pulmonary Disease and Lung Cancer Incidence in Never Smokers: A Cohort Study. Thorax 2020, 75, 506–509. [Google Scholar] [CrossRef] [PubMed]
- Lofdahl, J.M. Bronchoalveolar Lavage in COPD: Fluid Recovery Correlates with the Degree of Emphysema. Eur. Respir. J. 2005, 25, 275–281. [Google Scholar] [CrossRef] [PubMed]
- Pavel, A.B.; Campbell, J.D.; Liu, G.; Elashoff, D.; Dubinett, S.; Smith, K.; Whitney, D.; Lenburg, M.E.; Spira, A. Alterations in Bronchial Airway MiRNA Expression for Lung Cancer Detection. Cancer Prev. Res. 2017, 10, 651–659. [Google Scholar] [CrossRef] [PubMed]
- Dou, L.; Han, K.; Xiao, M.; Lv, F. MiR-223-5p Suppresses Tumor Growth and Metastasis in Non-Small Cell Lung Cancer by Targeting E2F8. Oncol. Res. 2019, 27, 261–268. [Google Scholar] [CrossRef]
- Roffel, M.P.; Bracke, K.R.; Heijink, I.H.; Maes, T. MiR-223: A Key Regulator in the Innate Immune Response in Asthma and COPD. Front. Med. 2020, 7, 196. [Google Scholar] [CrossRef] [PubMed]
- Schembri, F.; Sridhar, S.; Perdomo, C.; Gustafson, A.M.; Zhang, X.; Ergun, A.; Lu, J.; Liu, G.; Zhang, X.; Bowers, J.; et al. MicroRNAs as Modulators of Smoking-Induced Gene Expression Changes in Human Airway Epithelium. Proc. Natl. Acad. Sci. USA 2009, 106, 2319–2324. [Google Scholar] [CrossRef] [PubMed]
- Wei, K.; Pan, C.; Yao, G.; Liu, B.; Ma, T.; Xia, Y.; Jiang, W.; Chen, L.; Chen, Y. MiR-106b-5p Promotes Proliferation and Inhibits Apoptosis by Regulating BTG3 in Non-Small Cell Lung Cancer. Cell. Physiol. Biochem. 2017, 44, 1545–1558. [Google Scholar] [CrossRef] [PubMed]
- Sharma, A.; Kumar, M.; Ahmad, T.; Mabalirajan, U.; Aich, J.; Agrawal, A.; Ghosh, B. Antagonism of Mmu-Mir-106a Attenuates Asthma Features in Allergic Murine Model. J. Appl. Physiol. 2012, 113, 459–464. [Google Scholar] [CrossRef] [PubMed]
- Jiang, X.; Wang, J.; Deng, X.; Xiong, F.; Ge, J.; Xiang, B.; Wu, X.; Ma, J.; Zhou, M.; Li, X.; et al. Role of the Tumor Microenvironment in PD-L1/PD-1-Mediated Tumor Immune Escape. Mol. Cancer 2019, 18, 10. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Jia, A.; Ma, L.; Wang, Y.; Qiu, L.; Xiao, B. MicroRNA-16 Inhibits the Proliferation and Metastasis of Human Lung Cancer Cells by Modulating the Expression of YAP. J. Buon. 2020, 25, 862–868. [Google Scholar] [PubMed]
- Zhang, K.; Yang, L.; Wang, J.; Sun, T.; Guo, Y.; Nelson, R.; Tong, T.R.; Pangeni, R.; Salgia, R.; Raz, D.J. Ubiquitin-Specific Protease 22 Is Critical to in Vivo Angiogenesis, Growth and Metastasis of Non-Small Cell Lung Cancer. Cell Commun. Signal. 2019, 17, 167. [Google Scholar] [CrossRef] [PubMed]
- Wang, N.; Zhan, T.; Ke, T.; Huang, X.; Ke, D.; Wang, Q.; Li, H. Increased Expression of RRM2 by Human Papillomavirus E7 Oncoprotein Promotes Angiogenesis in Cervical Cancer. Br. J. Cancer 2014, 110, 1034–1044. [Google Scholar] [CrossRef] [PubMed]
- Mirra, D.; Esposito, R.; Spaziano, G.; La Torre, C.; Vocca, C.; Tallarico, M.; Cione, E.; Gallelli, L.; D’Agostino, B. Lung MicroRNAs Expression in Lung Cancer and COPD: A Preliminary Study. Biomedicines 2023, 11, 736. [Google Scholar] [CrossRef] [PubMed]
- Danov, O.; Wolff, M.; Bartel, S.; Böhlen, S.; Obernolte, H.; Wronski, S.; Jonigk, D.; Hammer, B.; Kovacevic, D.; Reuter, S.; et al. Cigarette Smoke Affects Dendritic Cell Populations, Epithelial Barrier Function, and the Immune Response to Viral Infection With H1N1. Front. Med. 2020, 7, 571003. [Google Scholar] [CrossRef] [PubMed]
- Barclay, A.N.; Brown, M.H. The SIRP Family of Receptors and Immune Regulation. Nat. Rev. Immunol. 2006, 6, 457–464. [Google Scholar] [CrossRef] [PubMed]
- Zhu, D.; Pan, C.; Li, L.; Bian, Z.; Lv, Z.; Shi, L.; Zhang, J.; Li, D.; Gu, H.; Zhang, C.-Y.; et al. MicroRNA-17/20a/106a Modulate Macrophage Inflammatory Responses through Targeting Signal-Regulatory Protein α. J. Allergy Clin. Immunol. 2013, 132, 426–436.e8. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Yu, M.; Yao, X. MicroRNA-17 and the Prognosis of Human Carcinomas: A Systematic Review and Meta-Analysis. BMJ Open 2018, 8, e018070. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.-H.; Goswami, S.; Grudo, A.; Song, L.; Bandi, V.; Goodnight-White, S.; Green, L.; Hacken-Bitar, J.; Huh, J.; Bakaeen, F.; et al. Antielastin Autoimmunity in Tobacco Smoking–Induced Emphysema. Nat. Med. 2007, 13, 567–569. [Google Scholar] [CrossRef] [PubMed]
- Polverino, F.; Laucho-Contreras, M.; Rojas Quintero, J.; Divo, M.; Pinto-Plata, V.; Sholl, L.; de-Torres, J.P.; Celli, B.R.; Owen, C.A. Increased Expression of A Proliferation-Inducing Ligand (APRIL) in Lung Leukocytes and Alveolar Epithelial Cells in COPD Patients with Non Small Cell Lung Cancer: A Possible Link between COPD and Lung Cancer? Multidiscip. Respir. Med. 2016, 11, 17. [Google Scholar] [CrossRef] [PubMed]
- Qiu, C.; Chen, G.; Cui, Q. Towards the Understanding of MicroRNA and Environmental Factor Interactions and Their Relationships to Human Diseases. Sci. Rep. 2012, 2, 318. [Google Scholar] [CrossRef] [PubMed]
- Xie, M.; Park, D.; Sica, G.L.; Deng, X. Bcl2-Induced DNA Replication Stress Promotes Lung Carcinogenesis in Response to Space Radiation. Carcinogenesis 2020, 41, 1565–1575. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Wei, X. Unraveling the Potential of Senescence-Related Genes in Guiding Clinical Therapy of Lung Adenocarcinoma Patients. Funct. Integr. Genom. 2023, 23, 188. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Wan, S.; Li, J.; Xu, Y.; Lou, X.; Sun, M.; Wang, S. Expression and Prognostic Value of E2F3 Transcription Factor in Non-small Cell Lung Cancer. Oncol. Lett. 2021, 21, 411. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; He, J.; Xia, J.; Chen, Z.; Chen, X. Delayed Apoptosis by Neutrophils from COPD Patients Is Associated with Altered Bak, Bcl-Xl, and Mcl-1 MRNA Expression. Diagn. Pathol. 2012, 7, 65. [Google Scholar] [CrossRef] [PubMed]
- Chanvorachote, P.; Sriratanasak, N.; Nonpanya, N. C-Myc Contributes to Malignancy of Lung Cancer: A Potential Anticancer Drug Target. Anticancer Res. 2020, 40, 609–618. [Google Scholar] [CrossRef]
- Zhang, J.; Pan, L.; Zhang, Q.; Zhao, Y.; Wang, W.; Lin, N.; Zhang, S.; Wu, Q. MFN2 Deficiency Affects Calcium Homeostasis in Lung Adenocarcinoma Cells via Downregulation of UCP4. FEBS Open Bio. 2023, 13, 1107–1124. [Google Scholar] [CrossRef] [PubMed]
- Luo, Z.; Ye, X.; Shou, F.; Cheng, Y.; Li, F.; Wang, G. RNF115-Mediated Ubiquitination of P53 Regulates Lung Adenocarcinoma Proliferation. Biochem. Biophys. Res. Commun. 2020, 530, 425–431. [Google Scholar] [CrossRef] [PubMed]
- Gao, C.; Xiao, F.; Zhang, L.; Sun, Y.; Wang, L.; Liu, X.; Sun, H.; Xie, Z.; Liang, Y.; Xu, Q.; et al. SENP1 Inhibition Suppresses the Growth of Lung Cancer Cells through Activation of A20-Mediated Ferroptosis. Ann. Transl. Med. 2022, 10, 224. [Google Scholar] [CrossRef] [PubMed]
- Tu, Y.; Yao, S.; Chen, Q.; Li, W.; Song, Y.; Zhang, P. 5-Hydroxytryptamine Activates a 5-HT/c-Myc/SLC6A4 Signaling Loop in Non–Small Cell Lung Cancer. Biochim. Biophys. Acta (BBA) Gen. Subj. 2022, 1866, 130093. [Google Scholar] [CrossRef] [PubMed]
- Xue, Y.; Jiang, K.; Ou, L.; Shen, M.; Yang, Y.; Lu, J.; Xu, W. Targeting Sphingosine Kinase 1/2 by a Novel Dual Inhibitor SKI-349 Suppresses Non-Small Cell Lung Cancer Cell Growth. Cell Death Dis. 2022, 13, 602. [Google Scholar] [CrossRef]
- Zhang, W.; Sun, Y.; Bai, L.; Zhi, L.; Yang, Y.; Zhao, Q.; Chen, C.; Qi, Y.; Gao, W.; He, W.; et al. RBMS1 Regulates Lung Cancer Ferroptosis through Translational Control of SLC7A11. J. Clin. Investig. 2021, 131, e152067. [Google Scholar] [CrossRef] [PubMed]
- Hassanein, M.; Hoeksema, M.D.; Shiota, M.; Qian, J.; Harris, B.K.; Chen, H.; Clark, J.E.; Alborn, W.E.; Eisenberg, R.; Massion, P.P. SLC1A5 Mediates Glutamine Transport Required for Lung Cancer Cell Growth and Survival. Clin. Cancer Res. 2013, 19, 560–570. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhao, S.; Chen, X.; Feng, G.; Chen, Z.; Fan, S. MiR-145 Modulates the Radiosensitivity of Non-Small Cell Lung Cancer Cells by Suppression of TMOD3. Carcinogenesis 2022, 43, 288–296. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Li, S.; Zhao, S.; Fa, X. Upregulated miR-17 Regulates Hypoxia-Mediated Human Pulmonary Artery Smooth Muscle Cell Proliferation and Apoptosis by Targeting Mitofusin 2. Med. Sci. Monit. 2016, 22, 3301–3308. [Google Scholar] [CrossRef] [PubMed]
- Christoffersen, N.R.; Shalgi, R.; Frankel, L.B.; Leucci, E.; Lees, M.; Klausen, M.; Pilpel, Y.; Nielsen, F.C.; Oren, M.; Lund, A.H. p53-independent upregulation of miR-34a during oncogene-induced senescence represses MYC. Cell Death Differ. 2010, 17, 236–245. [Google Scholar] [CrossRef] [PubMed]
Healthy Never-Smokers | Healthy Smokers | COPD | NSCLC | p-Value | |
---|---|---|---|---|---|
Total Participants (N) | 9 | 11 | 11 | 12 | |
Age (SD) | 70.5 (15.2) | 52.5 (8.3) | 63.5 (6) | 75 (16.9) | NS |
Gender (M/F) | 5/4 | 6/5 | 5/6 | 6/6 | NS |
Smoking history (pack/years) | NA | 35 | 28.3 | 31 | <0.001 |
Smoking habit (current/former smoker) | NA | 8/3 | 11/0 | 6/6 | 0.0133 |
FEV1 (% predicted) | 96% (3.2) | 91% (12) | 66% (14) | 88% (11) | 0.0438 |
FEV/FVC | 76.1 (2.5) | 75 (1.4) | 59 (1.7) | 74 (3) | <0.0001 |
Comorbidities | |||||
Hypertension (%) | 5 (55.5%) | 5 (45.4%) | 3 (27.2%) | 5 (41.6%) | 0.0152 |
Other cardiovascular diseases (%) | 2 (22.2%) | 0 | 3 (27.2%) | 1 (12.5%) | NS |
Diabetes mellitus (%) | 1 (16.7%) | 0 | 0 | 1 (0.8%) | NS |
Medications | |||||
Inhaled corticosteroids (N, %) | 0 | 0 | 0 | 0 | NS |
LABA/SABA/LAMA (N, %) | 0 | 0 | 11 (100%) | 3 (25%) | <0.0001 |
Number of Target Genes | ||
---|---|---|
miRNA | miR Target Link 2.0 | DIANA Tools |
hsa-miR-223-5p | 551 | 10 |
hsa-miR-16-5p | 2279 | 455 |
hsa-miR-20a-5p | 1659 | 611 |
hsa-miR-17-5p | 1817 | 136 |
hsa-miR-34a-5p | 968 | 324 |
hsa-miR-106a-5p | 1166 | 435 |
Biochemical Pathways | miRNA | Validated Target Genes |
---|---|---|
DNA replication—apoptosis | hsa-miR-16-5p hsa-miR-17-5p hsa-miR-20a-5p hsa-miR-34a-5p | BCL2 |
DNA damage telomere stress—senescence pathways | hsa-miR-16-5p hsa-miR-17-5p hsa-miR-20a-5p hsa-miR-34a-5p | CYCS |
Uncontrolled tumor growth and invasion | hsa-miR-16-5p hsa-miR-17-5p hsa-miR-20a-5p hsa-miR-34a-5p | E2F3 |
Apoptosis—Bcl2 pathway—drug resistance | hsa-miR-16-5p hsa-miR-17-5p hsa-miR-20a-5p hsa-miR-34a-5p | MCL1 |
Promotion of tumor growth—drug resistance—poor survival | hsa-miR-16-5p hsa-miR-17-5p hsa-miR-34a-5p hsa-miR-106a-5p | MFN2 |
Cancer cell growth and survival—drug resistance—poor survival | hsa-miR-16-5p hsa-miR-17-5p hsa-miR-20a-5p hsa-miR-34a-5p | MYC |
p53 pathway—proliferation and energy metabolism | hsa-miR-20a-5p hsa-miR-16-5p hsa-miR-106a-5p hsa-miR-223-5p | RNF115 |
Cell cycle deregulation and cell proliferation—drug resistance | hsa-miR-20a-5p hsa-miR-16-5p hsa-miR-34a-5p hsa-miR-223-5p | SENP1 |
Cellular transformation and growth | hsa-miR-16-5p hsa-miR-20a-5p hsa-miR-16-5p hsa-miR-34a-5p hsa-miR-106a-5p | SLC1A5 |
C-MYC pathway—poor survival | hsa-miR-16-5p hsa-miR-20a-5p hsa-miR-16-5p hsa-miR-106a-5p | SLC6A4 |
Ferroptosis—tumor progression | hsa-miR-20a-5p hsa-miR-16-5p hsa-miR-106a-5p hsa-miR-223-5p | SLC7A11 |
Cancer progression—EGFR/PI3K/AKT or MAPK/ERK signaling pathways | hsa-miR-20a-5p hsa-miR-16-5p hsa-miR-34a-5p hsa-miR-106a-5p | TMOD3 |
Abbreviation | Gene Name | Methods | Tissues | References (PMID) |
---|---|---|---|---|
BCL2 | BCL2 Apoptosis Regulator | Luciferase reporter assay, qRT-PCR, Western blot, reporter assay, proteomics analysis, immunohistochemistry, microarray, sequencing, HITS-CLIP, immunoblot, immunoprecipitation | Cervix cells, gastric cells, bone cells, marrow cells, spleen, liver, kidney, lymph node, tracheal/bronchial epithelial cells, breast cells, ovary cells, embryonic kidney cells, gastric cancer cells, B cells, mesothelial cell, glioma cells | 17877811 18449891 18362358 17351108 17707831 20643754 20876285 19269153 16166262 19903841 20371350 23907579 22473208 24148817 25435430 26397135 26722459 |
CYCS | Cytochrome C, Somatic | Proteomics, PAR-CLIP, PCR array | Breast cells, brain and liver | 18668040 23446348 28097098 |
E2F3 | E2F Transcription Factor 3 | CLASH. HITS-CLIP, luciferase reporter assay, Western blot | Human embryonic kidney cells, B cells, stem cells | 23622248 22473208 17252019 |
MCL1 | MCL1 Apoptosis Regulator, BCL2 Family Member | HITS-CLIP, microarray, immunohistochemistry, luciferase reporter assay, qRT-PCR, Western blot, PCR array | Human embryonic kidney cells, leukemic cells, liver | 22473208 18362358 23594563 28097098 |
MFN2 | Mitofusin 2 | Proteomics, luciferase reporter assay, Western blot, CLASH | Breast cells, lungs, human embryonic kidney cells | 18668040 27640178 23622248 |
MYC | MYC Proto-Oncogene, BHLH Transcription Factor | TRAP, Western blot, CLASH, Luciferase reporter assay, Western blot, reporter assay; Western blot, qRT-PCR, microarray; sequencing. | Bone cells, mouse embryonic fibroblasts, breast cells, kidney cells, cervical cells, human fibroblasts, oral epithelium, stem cells, lymphoblastoid cells, bladder cells | 24510096 18695042 23622248 19696787 21294122 21297663 22159222 20371350 25572695 |
RNF115 | Ring Finger Protein 115 | HITS-CLIP | Kidney cells, cervical cells, neuroblastoma cells, mouse embryonic fibroblasts, glial cells | 23313552 23824327 |
SENP1 | SUMO Specific Peptidase 1 | HITS-CLIP, MIRT025428, PAR-CLIP | Human embryonic kidney cells | 22473208 20371350 21572407 |
SLC1A5 | Solute Carrier Family 12 Member 6 | HITS-CLIP | Neuronal mouse cells, mouse primary embryonic fibroblasts | 23313552 |
SLC6A4 | Solute Carrier Family 6 Member 4 | qRT-PCR, Western blot, HITS-CLIP | Lungs, brain | 22940131 23313552 23313552 |
SLC7A11 | Solute Carrier Family 7 Member 11 | PAR-CLIP HITS-CLIP | Cervix cells, mouse neural progenitor cells, human retinal epithelial cells, primary mouse embryo fibroblasts, human embryonic stem cells, kidney cells | 23313552 22012620 20371350 21572407 |
TMOD3 | Tropomodulin 3 | HITS-CLIP Proteomics | Cervical cells, colorectal cells | 23313552 21566225 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mirra, D.; Esposito, R.; Spaziano, G.; Sportiello, L.; Panico, F.; Squillante, A.; Falciani, M.; Cerqua, I.; Gallelli, L.; Cione, E.; et al. MicroRNA Monitoring in Human Alveolar Macrophages from Patients with Smoking-Related Lung Diseases: A Preliminary Study. Biomedicines 2024, 12, 1050. https://doi.org/10.3390/biomedicines12051050
Mirra D, Esposito R, Spaziano G, Sportiello L, Panico F, Squillante A, Falciani M, Cerqua I, Gallelli L, Cione E, et al. MicroRNA Monitoring in Human Alveolar Macrophages from Patients with Smoking-Related Lung Diseases: A Preliminary Study. Biomedicines. 2024; 12(5):1050. https://doi.org/10.3390/biomedicines12051050
Chicago/Turabian StyleMirra, Davida, Renata Esposito, Giuseppe Spaziano, Liberata Sportiello, Francesca Panico, Antonio Squillante, Maddalena Falciani, Ida Cerqua, Luca Gallelli, Erika Cione, and et al. 2024. "MicroRNA Monitoring in Human Alveolar Macrophages from Patients with Smoking-Related Lung Diseases: A Preliminary Study" Biomedicines 12, no. 5: 1050. https://doi.org/10.3390/biomedicines12051050