Exacerbation of Hepatic Damage in Endothelial Aquaporin 1 Transgenic Mice after Experimental Heatstroke
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Collection of Capillary-Rich Fraction (CF) in the Brain and mRNA Isolation
2.3. PCR
2.4. Multiple Staining for AQP1 Localization
2.5. Heatstroke Model
2.6. Serum Biochemical Parameters
2.7. Immunohistochemistry and Cell Counts
2.8. Statistical Analysis
3. Results
3.1. Evaluation of Tie2-Cre/LNL-AQP1 dTG Mice
3.2. Changes in AT, RH, and WBGT during Heat Exposure
3.3. Serum Biochemical Parameters after 1 Day of Heat Exposure
3.4. Expression of Hepatic AQP1 on Vessels
3.5. Increase in Inflammation in the Liver of Tie2-Cre/LNL-AQP1 dTG Mice
3.6. Increase in Oxidative Stress in Tie2-Cre/LNL-AQP1 dTG mice
3.7. Increase in Iba1-Positive Cells on Vessels in the Liver of Tie2-Cre/LNL-AQP1 dTG Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Epstein, Y.; Yanovich, R. Heatstroke. N. Engl. J. Med. 2019, 380, 2449–2459. [Google Scholar] [CrossRef] [PubMed]
- Sharma, H.S.; Westman, J.; Nyberg, F. Pathophysiology of brain edema and cell changes following hyperthermic brain injury. Prog. Brain Res. 1998, 115, 351–412. [Google Scholar] [CrossRef] [PubMed]
- Robine, J.M.; Cheung, S.L.; Le Roy, S.; Van Oyen, H.; Griffiths, C.; Michel, J.P.; Herrmann, F.R. Death toll exceeded 70,000 in Europe during the summer of 2003. C. R. Biol. 2008, 331, 171–178. [Google Scholar] [CrossRef] [PubMed]
- Sherwood, S.C.; Huber, M. An adaptability limit to climate change due to heat stress. Proc. Natl. Acad. Sci. USA 2010, 107, 9552–9555. [Google Scholar] [CrossRef]
- Meehl, G.A.; Tebaldi, C. More intense, more frequent, and longer lasting heat waves in the 21st century. Science 2004, 305, 994–997. [Google Scholar] [CrossRef]
- Day, R.E.; Kitchen, P.; Owen, D.S.; Bland, C.; Marshall, L.; Conner, A.C.; Bill, R.M.; Conner, M.T. Human aquaporins: Regulators of transcellular water flow. Biochim. Biophys. Acta 2014, 1840, 1492–1506. [Google Scholar] [CrossRef]
- Agre, P.; Saboori, A.M.; Asimos, A.; Smith, B.L. Purification and partial characterization of the Mr 30,000 integral membrane protein associated with the erythrocyte Rh(D) antigen. J. Biol. Chem. 1987, 262, 17497–17503. [Google Scholar] [CrossRef]
- Agre, P.; King, L.S.; Yasui, M.; Guggino, W.B.; Ottersen, O.P.; Fujiyoshi, Y.; Engel, A.; Nielsen, S. Aquaporin water channels—From atomic structure to clinical medicine. J. Physiol. 2002, 542, 3–16. [Google Scholar] [CrossRef] [PubMed]
- Papadopoulos, M.C.; Verkman, A.S. Aquaporin water channels in the nervous system. Nat. Rev. Neurosci. 2013, 14, 265–277. [Google Scholar] [CrossRef]
- Oshio, K.; Watanabe, H.; Song, Y.; Verkman, A.S.; Manley, G.T. Reduced cerebrospinal fluid production and intracranial pressure in mice lacking choroid plexus water channel Aquaporin-1. FASEB J. 2005, 19, 76–78. [Google Scholar] [CrossRef]
- Ishibashi, K.; Sasaki, S.; Fushimi, K.; Uchida, S.; Kuwahara, M.; Saito, H.; Furukawa, T.; Nakajima, K.; Yamaguchi, Y.; Gojobori, T. Molecular cloning and expression of a member of the aquaporin family with permeability to glycerol and urea in addition to water expressed at the basolateral membrane of kidney collecting duct cells. Proc. Natl. Acad. Sci. USA 1994, 91, 6269–6273. [Google Scholar] [CrossRef]
- Wang, Y.H.; Liu, T.T.; Kung, W.M.; Chen, C.C.; Wen, Y.T.; Lin, I.C.; Huang, C.C.; Wei, L. Expression of aquaporins in intestine after heat stroke. Int. J. Clin. Exp. Pathol. 2015, 8, 8742–8753. [Google Scholar] [PubMed]
- Jimi, T.; Wakayama, Y.; Inoue, M.; Kojima, H.; Oniki, H.; Matsuzaki, Y.; Shibuya, S.; Hara, H.; Takahashi, J. Aquaporin 1: Examination of its expression and localization in normal human skeletal muscle tissue. Cells Tissues Organs 2006, 184, 181–187. [Google Scholar] [CrossRef] [PubMed]
- Sato, H.; Kato, R.; Isogai, Y.; Saka, G.; Ohtsuki, M.; Taketomi, Y.; Yamamoto, K.; Tsutsumi, K.; Yamada, J.; Masuda, S.; et al. Analyses of group III secreted phospholipase A2 transgenic mice reveal potential participation of this enzyme in plasma lipoprotein modification, macrophage foam cell formation, and atherosclerosis. J. Biol. Chem. 2008, 283, 33483–33497. [Google Scholar] [CrossRef]
- Kanegae, Y.; Takamori, K.; Sato, Y.; Lee, G.; Nakai, M.; Saito, I. Efficient gene activation system on mammalian cell chromosomes using recombinant adenovirus producing Cre recombinase. Gene 1996, 181, 207–212. [Google Scholar] [CrossRef] [PubMed]
- Sakai, K.; Miyazaki, J. A transgenic mouse line that retains Cre recombinase activity in mature oocytes irrespective of the cre transgene transmission. Biochem. Biophys. Res. Commun. 1997, 237, 318–324. [Google Scholar] [CrossRef]
- Kisanuki, Y.Y.; Hammer, R.E.; Miyazaki, J.; Williams, S.C.; Richardson, J.A.; Yanagisawa, M. Tie2-Cre transgenic mice: A new model for endothelial cell-lineage analysis in vivo. Dev. Biol. 2001, 230, 230–242. [Google Scholar] [CrossRef]
- Dolman, D.; Drndarski, S.; Abbott, N.J.; Rattray, M. Induction of aquaporin 1 but not aquaporin 4 messenger RNA in rat primary brain microvessel endothelial cells in culture. J. Neurochem. 2005, 93, 825–833. [Google Scholar] [CrossRef] [PubMed]
- Pan, W.; Banks, W.A.; Kastin, A.J. Permeability of the blood-brain and blood-spinal cord barriers to interferons. J. Neuroimmunol. 1997, 76, 105–111. [Google Scholar] [CrossRef]
- Pan, W.; Ding, Y.; Yu, Y.; Ohtaki, H.; Nakamachi, T.; Kastin, A.J. Stroke upregulates TNFalpha transport across the blood-brain barrier. Exp. Neurol. 2006, 198, 222–233. [Google Scholar] [CrossRef]
- Yagura, K.; Ohtaki, H.; Tsumuraya, T.; Sato, A.; Miyamoto, K.; Kawada, N.; Suzuki, K.; Nakamura, M.; Kanzaki, K.; Dohi, K.; et al. The enhancement of CCL2 and CCL5 by human bone marrow-derived mesenchymal stem/stromal cells might contribute to inflammatory suppression and axonal extension after spinal cord injury. PLoS ONE 2020, 15, e0230080. [Google Scholar] [CrossRef] [PubMed]
- Schnell, S.A.; Staines, W.A.; Wessendorf, M.W. Reduction of lipofuscin-like autofluorescence in fluorescently labeled tissue. J. Histochem. Cytochem. 1999, 47, 719–730. [Google Scholar] [CrossRef] [PubMed]
- Miyamoto, K.; Ohtaki, H.; Dohi, K.; Tsumuraya, T.; Song, D.; Kiriyama, K.; Satoh, K.; Shimizu, A.; Aruga, T.; Shioda, S. Therapeutic time window for edaravone treatment of traumatic brain injury in mice. BioMed Res. Int. 2013, 2013, 379206. [Google Scholar] [CrossRef] [PubMed]
- Yaglou, C.P.; Minard, D. Control of heat casualties at military training centers. AMA Arch. Ind. Health 1957, 16, 302–316. [Google Scholar]
- Ramanathan, N.L.; Belding, H.S. Physiologic evaluation of the WBGT index for occupational heat stress. Am. Ind. Hyg. Assoc. J. 1973, 34, 375–383. [Google Scholar] [CrossRef]
- Suzuki, K.; Yamaga, H.; Ohtaki, H.; Hirako, S.; Miyamoto, K.; Nakamura, M.; Yanagisawa, K.; Shimada, T.; Hosono, T.; Hashimoto, H.; et al. Effect of PACAP on Heat Exposure. Int. J. Mol. Sci. 2024, 24, 3992. [Google Scholar] [CrossRef]
- Miyamoto, K.; Nakamura, M.; Ohtaki, H.; Suzuki, K.; Yamaga, H.; Yanagisawa, K.; Maeda, A.; Yagi, M.; Hayashi, M.; Honda, K.; et al. Heatstroke-induced late-onset neurological deficits in mice caused by white matter demyelination, Purkinje cell degeneration, and synaptic impairment in the cerebellum. Sci. Rep. 2022, 12, 10598. [Google Scholar] [CrossRef]
- Miyamoto, K.; Suzuki, K.; Ohtaki, H.; Nakamura, M.; Yamaga, H.; Yagi, M.; Honda, K.; Hayashi, M.; Dohi, K. A novel mouse model of heatstroke accounting for ambient temperature and relative humidity. J. Intensive Care 2021, 9, 35. [Google Scholar] [CrossRef]
- Preston, G.M.; Agre, P. Isolation of the cDNA for erythrocyte integral membrane protein of 28 kilodaltons: Member of an ancient channel family. Proc. Natl. Acad. Sci. USA 1991, 88, 11110–11114. [Google Scholar] [CrossRef]
- Venneri, M.A.; De Palma, M.; Ponzoni, M.; Pucci, F.; Scielzo, C.; Zonari, E.; Mazzieri, R.; Doglioni, C.; Naldini, L. Identification of proangiogenic TIE2-expressing monocytes (TEMs) in human peripheral blood and cancer. Blood 2007, 109, 5276–5285. [Google Scholar] [CrossRef]
- Nowak, G.; Karrar, A.; Holmén, C.; Nava, S.; Uzunel, M.; Hultenby, K.; Sumitran-Holgersson, S. Expression of vascular endothelial growth factor receptor-2 or Tie-2 on peripheral blood cells defines functionally competent cell populations capable of reendothelialization. Circulation 2004, 110, 3699–3707. [Google Scholar] [CrossRef] [PubMed]
- Obata, F.; Narita, K. Hypercholesterolemia negatively influences morphology and molecular markers of epithelial cells within the choroid plexus in rabbits. Fluids Barriers CNS 2020, 17, 13. [Google Scholar] [CrossRef] [PubMed]
- Satoh, J.; Tabunoki, H.; Yamamura, T.; Arima, K.; Konno, H. Human astrocytes express aquaporin-1 and aquaporin-4 in vitro and in vivo. Neuropathology 2007, 27, 245–256. [Google Scholar] [CrossRef] [PubMed]
- Wegner, A.; Doberentz, E.; Madea, B. Death in the sauna-vitality markers for heat exposure. Int. J. Leg. Med. 2021, 135, 903–908. [Google Scholar] [CrossRef]
- Du, Y.; Xu, J.T.; Jin, H.N.; Zhao, R.; Zhao, D.; Du, S.H.; Xue, Y.; Xie, X.L.; Wang, Q. Increased cerebral expressions of MMPs, CLDN5, OCLN, ZO1 and AQPs are associated with brain edema following fatal heat stroke. Sci. Rep. 2017, 7, 1691. [Google Scholar] [CrossRef]
- Huebert, R.C.; Vasdev, M.M.; Shergill, U.; Das, A.; Huang, B.Q.; Charlton, M.R.; LaRusso, N.F.; Shah, V.H. Aquaporin-1 facilitates angiogenic invasion in the pathological neovasculature that accompanies cirrhosis. Hepatology 2010, 52, 238–248. [Google Scholar] [CrossRef]
- Huebert, R.C.; Jagavelu, K.; Hendrickson, H.I.; Vasdev, M.M.; Arab, J.P.; Splinter, P.L.; Trussoni, C.E.; Larusso, N.F.; Shah, V.H. Aquaporin-1 promotes angiogenesis, fibrosis, and portal hypertension through mechanisms dependent on osmotically sensitive microRNAs. Am. J. Pathol. 2011, 179, 1851–1860. [Google Scholar] [CrossRef]
- Yokomori, H.; Oda, M.; Yoshimura, K.; Watanabe, S.; Hibi, T. Aberrant expressions of aquaporin-1 in association with capillarized sinusoidal endothelial cells in cirrhotic rat liver. Med. Mol. Morphol. 2010, 43, 6–12. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Ning, J.L.; Gu, J.T.; Cui, J.; Yang, Y.; Wang, Z.; Zeng, J.; Yi, B.; Lu, K.Z. Caspase-3 inhibition prevents the development of hepatopulmonary syndrome in common bile duct ligation rats by alleviating pulmonary injury. Liver Int. 2015, 35, 1373–1382. [Google Scholar] [CrossRef]
- Tambe, M.A.; Ng, B.G.; Freeze, H.H. N-Glycanase 1 transcriptionally regulates aquaporins independent of its enzymatic activity. Cell Rep. 2019, 29, 4620–4631.e4. [Google Scholar] [CrossRef]
- Marrone, J.; Lehmann, G.L.; Soria, L.R.; Pellegrino, J.M.; Molinas, S.; Marinelli, R.A. Adenoviral transfer of human aquaporin-1 gene to rat liver improves bile flow in estrogen-induced cholestasis. Gene Ther. 2014, 21, 1058–1064. [Google Scholar] [CrossRef] [PubMed]
- Marrone, J.; Soria, L.R.; Danielli, M.; Lehmann, G.L.; Larocca, M.C.; Marinelli, R.A. Hepatic gene transfer of human aquaporin-1 improves bile salt secretory failure in rats with estrogen-induced cholestasis. Hepatology 2016, 64, 535–548. [Google Scholar] [CrossRef] [PubMed]
- Marrone, J.; Danielli, M.; Gaspari, C.I.; Marinelli, R.A. Adenovirus-mediated human aquaporin-1 expression in hepatocytes improves lipopolysaccharide-induced cholestasis. IUBMB Life 2017, 69, 978–984. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.; Zhang, B.; Chen, Q.; Zhang, J.; Lei, B.; Li, B.; Wei, Y.; Zhai, R.; Liang, Z.; He, S.; et al. The mechanism underlying alpinetin-mediated alleviation of pancreatitis-associated lung injury through upregulating aquaporin-1. Drug Des. Dev. Ther. 2016, 10, 841–850. [Google Scholar] [CrossRef]
- Fontijn, R.D.; Volger, O.L.; van der Pouw-Kraan, T.C.; Doddaballapur, A.; Leyen, T.; Baggen, J.M.; Boon, R.A.; Horrevoets, A.J.G. Expression of nitric oxide-transporting Aquaporin-1 is controlled by KLF2 and marks non-activated endothelium in vivo. PLoS ONE 2015, 10, e0145777. [Google Scholar] [CrossRef]
- Talbot, N.C.; Garrett, W.M.; Caperna, T.J. Analysis of the expression of aquaporin-1 and aquaporin-9 in pig liver tissue: Comparison with rat liver tissue. Cells Tissues Organs 2003, 174, 117–128. [Google Scholar] [CrossRef]
- Yokomori, H.; Oda, M.; Yoshimura, K.; Kaneko, F.; Hibi, T. Aquaporin-1 associated with hepatic arterial capillary proliferation on hepatic sinusoid in human cirrhotic liver. Liver Int. 2011, 31, 1554–1564. [Google Scholar] [CrossRef]
- Iguchi, H.; Oda, M.; Yamazaki, H.; Yoshimura, K.; Ando, W.; Yokomori, H. Aquaporin-1 is associated with arterial capillary proliferation and hepatic sinusoidal transformation contributing to portal hypertension in primary biliary cirrhosis. Med. Mol. Morphol. 2014, 47, 90–99. [Google Scholar] [CrossRef]
- Marinelli, R.A.; Gradilone, S.A.; Carreras, F.I.; Calamita, G.; Lehmann, G.L. Liver aquaporins: Significance in canalicular and ductal bile formation. Ann. Hepatol. 2004, 3, 130–136. [Google Scholar] [CrossRef]
- Jiang, Y. The expression of MRTF-A and AQP1 play important roles in the pathological vascular remodeling. Asian Pac. J. Cancer Prev. 2015, 16, 1375–1383. [Google Scholar] [CrossRef]
- Elliott, L.; Ashley-Koch, A.E.; De Castro, L.; Jonassaint, J.; Price, J.; Ataga, K.I.; Levesque, M.C.; Brice Weinberg, J.; Eckman, J.R.; Orringer, E.P.; et al. Genetic polymorphisms associated with priapism in sickle cell disease. Br. J. Haematol. 2007, 137, 262–267. [Google Scholar] [CrossRef] [PubMed]
Gene Symbol | Amplicon Size | Fwd | Rev | Ref Seq Numbers |
---|---|---|---|---|
Aqp1 | 124 | AGGCTTCAATTACCCACTGGA | GTGAGCACCGCTGATGTGA | NM_007472 |
Pecam | 136 | TGGTTGTCATTGGAGTGGTC | TTCTCGCTGTTGGAGTTCAG | NM_008816 |
Pecam | 812 | GGTGACCTCCAATGACCCAG | GCCTTCCGTTCTTAGGGTCG | NM_008816 |
Vwf | 125 | CTTCTGTACGCCTCAGCTATG | GCCGTTGTAATTCCCACACAAG | NM_011708.4 |
Eno2 | 302 | TGAGAATAAATCCTTGGAGCTGGT | GGTCATCGCCCACTATCTGG | NM_001302642 |
Gfap | 419 | CTAACGACTATCGCCGCCAA | CTGGTGAGCCTGTATTGGGAC | NM_001131020 |
Mbp | 262 | CAGAGTCCGACGAGCTTCAG | CAGCTTCTCTACGGCTCGG | NM_001025245 |
Aif1 | 144 | ATCAACAAGCAATTCCTCGATGA | CAGCATTCGCTTCAAGGACATA | NM_019467 |
Rps18 | 166 | AGTTCCAGCACATTTTGCGAG | TCATCCTCCGTGAGTTCTCCA | NM_011296 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yanagisawa, K.; Miyamoto, K.; Wakayama, Y.; Arata, S.; Suzuki, K.; Nakamura, M.; Yamaga, H.; Miyazaki, T.; Honda, K.; Dohi, K.; et al. Exacerbation of Hepatic Damage in Endothelial Aquaporin 1 Transgenic Mice after Experimental Heatstroke. Biomedicines 2024, 12, 2057. https://doi.org/10.3390/biomedicines12092057
Yanagisawa K, Miyamoto K, Wakayama Y, Arata S, Suzuki K, Nakamura M, Yamaga H, Miyazaki T, Honda K, Dohi K, et al. Exacerbation of Hepatic Damage in Endothelial Aquaporin 1 Transgenic Mice after Experimental Heatstroke. Biomedicines. 2024; 12(9):2057. https://doi.org/10.3390/biomedicines12092057
Chicago/Turabian StyleYanagisawa, Kaoru, Kazuyuki Miyamoto, Yoshihiro Wakayama, Satoru Arata, Keisuke Suzuki, Motoyasu Nakamura, Hiroki Yamaga, Takuro Miyazaki, Kazuho Honda, Kenji Dohi, and et al. 2024. "Exacerbation of Hepatic Damage in Endothelial Aquaporin 1 Transgenic Mice after Experimental Heatstroke" Biomedicines 12, no. 9: 2057. https://doi.org/10.3390/biomedicines12092057