Luteolin Induces Selective Cell Death of Human Pluripotent Stem Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Reagents
2.2. Cardiomyocyte Differentiation
2.3. Cell Death Analysis
2.4. Fluorescence-Based Competition Assay
2.5. Immunofluorescence and Immunoblotting
2.6. RNA Extraction and Quantitative Real-Time PCR Assay
2.7. Flow-Cytometry
2.8. Measurement of Intracellular Ca2+ Influx
2.9. Statistical Analysis
3. Results
3.1. Stemotoxic Screening of Flavonoids
3.2. Potent Stemotoxic Effects of Luteolin
3.3. Selectivity of Luteolin toward hPSCs
3.4. Normal Functioning of hESC-Derived Cardiomyocytes after Luteolin Treatment
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Data Accessibility
References
- Trounson, A.; DeWitt, N.D. Pluripotent stem cells progressing to the clinic. Nat. Rev. Mol. Cell Biol. 2016, 17, 194–200. [Google Scholar] [CrossRef]
- Schwartz, S.D.; Regillo, C.D.; Lam, B.L.; Eliott, D.; Rosenfeld, P.J.; Gregori, N.Z.; Hubschman, J.P.; Davis, J.L.; Heilwell, G.; Spirn, M.; et al. Human embryonic stem cell-derived retinal pigment epithelium in patients with age-related macular degeneration and Stargardt’s macular dystrophy: follow-up of two open-label phase 1/2 studies. Lancet 2015, 385, 509–516. [Google Scholar] [CrossRef]
- Schweitzer, J.S.; Song, B.; Herrington, T.M.; Park, T.Y.; Lee, N.; Ko, S.; Jeon, J.; Cha, Y.; Kim, K.; Li, Q.; et al. Personalized iPSC-Derived Dopamine Progenitor Cells for Parkinson’s Disease. N. Engl. J. Med. 2020, 382, 1926–1932. [Google Scholar] [CrossRef] [PubMed]
- Goldring, C.E.; Duffy, P.A.; Benvenisty, N.; Andrews, P.W.; Ben-David, U.; Eakins, R.; French, N.; Hanley, N.A.; Kelly, L.; Kitteringham, N.R.; et al. Assessing the safety of stem cell therapeutics. Cell Stem Cell 2011, 8, 618–628. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ben-David, U.; Benvenisty, N. The tumorigenicity of human embryonic and induced pluripotent stem cells. Nat. Rev. Cancer 2011, 11, 268–277. [Google Scholar] [CrossRef] [PubMed]
- Lee, A.S.; Tang, C.; Rao, M.S.; Weissman, I.L.; Wu, J.C. Tumorigenicity as a clinical hurdle for pluripotent stem cell therapies. Nat. Med. 2013, 19, 998–1004. [Google Scholar] [CrossRef] [Green Version]
- Jeong, H.C.; Cho, S.J.; Lee, M.O.; Cha, H.J. Technical approaches to induce selective cell death of pluripotent stem cells. Cell. Mol. Life Sci. 2017. [Google Scholar] [CrossRef]
- Knoepfler, P.S. Deconstructing stem cell tumorigenicity: A roadmap to safe regenerative medicine. Stem Cells 2009, 27, 1050–1056. [Google Scholar] [CrossRef] [Green Version]
- Lee, M.O.; Moon, S.H.; Jeong, H.C.; Yi, J.Y.; Lee, T.H.; Shim, S.H.; Rhee, Y.H.; Lee, S.H.; Oh, S.J.; Lee, M.Y.; et al. Inhibition of pluripotent stem cell-derived teratoma formation by small molecules. Proc. Natl. Acad. Sci. USA 2013, 110, E3281–E3290. [Google Scholar] [CrossRef] [Green Version]
- Cho, S.J.; Kim, S.Y.; Park, S.J.; Song, N.; Kwon, H.Y.; Kang, N.Y.; Moon, S.H.; Chang, Y.T.; Cha, H.J. Photodynamic Approach for Teratoma-Free Pluripotent Stem Cell Therapy Using CDy1 and Visible Light. ACS Cent. Sci. 2016, 2, 604–607. [Google Scholar] [CrossRef]
- Ben-David, U.; Gan, Q.-F.; Golan-Lev, T.; Arora, P.; Yanuka, O.; Oren Yifat, S.; Leikin-Frenkel, A.; Graf, M.; Garippa, R.; Boehringer, M.; et al. Selective Elimination of Human Pluripotent Stem Cells by an Oleate Synthesis Inhibitor Discovered in a High-Throughput Screen. Cell Stem Cell 2013, 12, 167–179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuo, T.F.; Mao, D.; Hirata, N.; Khambu, B.; Kimura, Y.; Kawase, E.; Shimogawa, H.; Ojika, M.; Nakatsuji, N.; Ueda, K.; et al. Selective elimination of human pluripotent stem cells by a marine natural product derivative. J. Am. Chem. Soc. 2014, 136, 9798–9801. [Google Scholar] [CrossRef] [PubMed]
- Nakahara, T.; Kita, A.; Yamanaka, K.; Mori, M.; Amino, N.; Takeuchi, M.; Tominaga, F.; Hatakeyama, S.; Kinoyama, I.; Matsuhisa, A.; et al. YM155, a novel small-molecule survivin suppressant, induces regression of established human hormone-refractory prostate tumor xenografts. Cancer Res. 2007, 67, 8014–8021. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, K.T.; Jeong, H.C.; Kim, C.Y.; Kim, E.Y.; Heo, S.H.; Cho, S.J.; Hong, K.S.; Cha, H.J. Intact wound repair activity of human mesenchymal stem cells after YM155 mediated selective ablation of undifferentiated human embryonic stem cells. J. Dermatol. Sci. 2017, 86, 123–131. [Google Scholar] [CrossRef] [Green Version]
- Kim, K.T.; Park, J.C.; Jang, H.K.; Lee, H.; Park, S.; Kim, J.; Kwon, O.S.; Go, Y.H.; Jin, Y.; Kim, W.; et al. Safe scarless cassette-free selection of genome-edited human pluripotent stem cells using temporary drug resistance. Biomaterials 2020, 262, 120295. [Google Scholar] [CrossRef]
- Kim, S.Y.; Jeong, H.C.; Hong, S.K.; Lee, M.O.; Cho, S.J.; Cha, H.J. Quercetin induced ROS production triggers mitochondrial cell death of human embryonic stem cells. Oncotarget 2017, 8, 64964–64973. [Google Scholar] [CrossRef] [Green Version]
- Andres, S.; Pevny, S.; Ziegenhagen, R.; Bakhiya, N.; Schafer, B.; Hirsch-Ernst, K.I.; Lampen, A. Safety Aspects of the Use of Quercetin as a Dietary Supplement. Mol. Nutr. Food Res. 2018, 62. [Google Scholar] [CrossRef]
- Heinz, S.A.; Henson, D.A.; Austin, M.D.; Jin, F.; Nieman, D.C. Quercetin supplementation and upper respiratory tract infection: A randomized community clinical trial. Pharm. Res. 2010, 62, 237–242. [Google Scholar] [CrossRef]
- Go, Y.-H.; Lim, C.; Jeong, H.-C.; Kwon, O.-S.; Chung, S.; Lee, H.; Kim, W.; Suh, Y.-G.; Son, W.S.; Lee, M.-O.; et al. Structure-Activity Relationship Analysis of YM155 for Inducing Selective Cell Death of Human Pluripotent Stem Cells. Front. Chem. 2019, 7. [Google Scholar] [CrossRef] [Green Version]
- Go, Y.-H.; Lee, H.-J.; Kong, H.-J.; Jeong, H.-C.; Lee, D.Y.; Hong, S.-K.; Sung, S.H.; Kwon, O.-S.; Cha, H.-J. Screening of cytotoxic or cytostatic flavonoids with quantitative Fluorescent Ubiquitination-based Cell Cycle Indicator-based cell cycle assay. R. Soc. Open Sci. 2018, 5, 181303. [Google Scholar] [CrossRef] [Green Version]
- Lee, T.H.; Song, S.H.; Kim, K.L.; Yi, J.Y.; Shin, G.H.; Kim, J.Y.; Kim, J.; Han, Y.M.; Lee, S.H.; Lee, S.H.; et al. Functional recapitulation of smooth muscle cells via induced pluripotent stem cells from human aortic smooth muscle cells. Circ. Res. 2010, 106, 120–128. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.Y.; Park, J.H.; Jeong, S.; Kim, B.Y.; Kang, Y.K.; Xu, Y.; Chung, S.K. K120R mutation inactivates p53 by creating an aberrant splice site leading to nonsense-mediated mRNA decay. Oncogene 2019, 38, 1597–1610. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.M.; Hong, K.S.; Song, W.K.; Bae, D.; Hwang, I.K.; Kim, J.S.; Chung, H.M. Perivascular Progenitor Cells Derived From Human Embryonic Stem Cells Exhibit Functional Characteristics of Pericytes and Improve the Retinal Vasculature in a Rodent Model of Diabetic Retinopathy. Stem Cells Transl. Med. 2016, 5, 1268–1276. [Google Scholar] [CrossRef]
- Park, S.J.; Kim, R.Y.; Park, B.W.; Lee, S.; Choi, S.W.; Park, J.H.; Choi, J.J.; Kim, S.W.; Jang, J.; Cho, D.W.; et al. Dual stem cell therapy synergistically improves cardiac function and vascular regeneration following myocardial infarction. Nat. Commun. 2019, 10, 3123. [Google Scholar] [CrossRef] [Green Version]
- Cho, S.J.; Kim, K.T.; Jeong, H.C.; Park, J.C.; Kwon, O.S.; Song, Y.H.; Shin, J.G.; Kang, S.; Kim, W.; Shin, H.D.; et al. Selective Elimination of Culture-Adapted Human Embryonic Stem Cells with BH3 Mimetics. Stem Cell Rep. 2018. [Google Scholar] [CrossRef] [Green Version]
- Kwon, O.S.; Lee, H.; Kong, H.J.; Kwon, E.J.; Park, J.E.; Lee, W.; Kang, S.; Kim, M.; Kim, W.; Cha, H.J. Connectivity map-based drug repositioning of bortezomib to reverse the metastatic effect of GALNT14 in lung cancer. Oncogene 2020. [Google Scholar] [CrossRef] [PubMed]
- Cha, Y.; Han, M.J.; Cha, H.J.; Zoldan, J.; Burkart, A.; Jung, J.H.; Jang, Y.; Kim, C.H.; Jeong, H.C.; Kim, B.G.; et al. Metabolic control of primed human pluripotent stem cell fate and function by the miR-200c-SIRT2 axis. Nat. Cell Biol. 2017, 19, 445–456. [Google Scholar] [CrossRef] [Green Version]
- Fernandez, C.; Nieto, O.; Fontenla, J.A.; Rivas, E.; de Ceballos, M.L.; Fernandez-Mayoralas, A. Synthesis of glycosyl derivatives as dopamine prodrugs: Interaction with glucose carrier GLUT-1. Org. Biomol. Chem. 2003, 1, 767–771. [Google Scholar] [CrossRef] [PubMed]
- Gynther, M.; Ropponen, J.; Laine, K.; Leppanen, J.; Haapakoski, P.; Peura, L.; Jarvinen, T.; Rautio, J. Glucose promoiety enables glucose transporter mediated brain uptake of ketoprofen and indomethacin prodrugs in rats. J. Med. Chem. 2009, 52, 3348–3353. [Google Scholar] [CrossRef]
- Patra, M.; Johnstone, T.C.; Suntharalingam, K.; Lippard, S.J. A Potent Glucose-Platinum Conjugate Exploits Glucose Transporters and Preferentially Accumulates in Cancer Cells. Angew. Chem. Int. Ed. Engl. 2016, 55, 2550–2554. [Google Scholar] [CrossRef] [Green Version]
- Calvaresi, E.C.; Hergenrother, P.J. Glucose conjugation for the specific targeting and treatment of cancer. Chem. Sci. 2013, 4, 2319–2333. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sequiera, G.L.; Mehta, A.; Shim, W. A Simple Protocol for the Generation of Cardiomyocytes from Human Pluripotent Stem Cells. Methods Mol. Biol. 2016, 1307, 379–383. [Google Scholar] [CrossRef] [PubMed]
- Moon, S.H.; Kang, S.W.; Park, S.J.; Bae, D.; Kim, S.J.; Lee, H.A.; Kim, K.S.; Hong, K.S.; Kim, J.S.; Do, J.T.; et al. The use of aggregates of purified cardiomyocytes derived from human ESCs for functional engraftment after myocardial infarction. Biomaterials 2013, 34, 4013–4026. [Google Scholar] [CrossRef]
- Dubois, N.C.; Craft, A.M.; Sharma, P.; Elliott, D.A.; Stanley, E.G.; Elefanty, A.G.; Gramolini, A.; Keller, G. SIRPA is a specific cell-surface marker for isolating cardiomyocytes derived from human pluripotent stem cells. Nat. Biotechnol. 2011, 29, 1011–1018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uosaki, H.; Fukushima, H.; Takeuchi, A.; Matsuoka, S.; Nakatsuji, N.; Yamanaka, S.; Yamashita, J.K. Efficient and scalable purification of cardiomyocytes from human embryonic and induced pluripotent stem cells by VCAM1 surface expression. PLoS ONE 2011, 6, e23657. [Google Scholar] [CrossRef] [PubMed]
- Tohyama, S.; Hattori, F.; Sano, M.; Hishiki, T.; Nagahata, Y.; Matsuura, T.; Hashimoto, H.; Suzuki, T.; Yamashita, H.; Satoh, Y.; et al. Distinct metabolic flow enables large-scale purification of mouse and human pluripotent stem cell-derived cardiomyocytes. Cell Stem Cell 2013, 12, 127–137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Viatchenko-Karpinski, S.; Fleischmann, B.K.; Liu, Q.; Sauer, H.; Gryshchenko, O.; Ji, G.J.; Hescheler, J. Intracellular Ca2+ oscillations drive spontaneous contractions in cardiomyocytes during early development. Proc. Natl. Acad. Sci. USA 1999, 96, 8259–8264. [Google Scholar] [CrossRef] [Green Version]
- Sirenko, O.; Grimm, F.A.; Ryan, K.R.; Iwata, Y.; Chiu, W.A.; Parham, F.; Wignall, J.A.; Anson, B.; Cromwell, E.F.; Behl, M.; et al. In vitro cardiotoxicity assessment of environmental chemicals using an organotypic human induced pluripotent stem cell-derived model. Toxicol. Appl. Pharm. 2017, 322, 60–74. [Google Scholar] [CrossRef] [Green Version]
- Sirenko, O.; Cromwell, E.F.; Crittenden, C.; Wignall, J.A.; Wright, F.A.; Rusyn, I. Assessment of beating parameters in human induced pluripotent stem cells enables quantitative in vitro screening for cardiotoxicity. Toxicol. Appl. Pharm. 2013, 273, 500–507. [Google Scholar] [CrossRef] [Green Version]
- Kang, S.J.; Park, Y.I.; Hwang, S.R.; Yi, H.; Tham, N.; Ku, H.O.; Song, J.Y.; Kang, H.G. Hepatic population derived from human pluripotent stem cells is effectively increased by selective removal of undifferentiated stem cells using YM155. Stem Cell Res. Ther. 2017, 8, 78. [Google Scholar] [CrossRef] [Green Version]
- Bedel, A.; Beliveau, F.; Lamrissi-Garcia, I.; Rousseau, B.; Moranvillier, I.; Rucheton, B.; Guyonnet-Duperat, V.; Cardinaud, B.; de Verneuil, H.; Moreau-Gaudry, F.; et al. Preventing Pluripotent Cell Teratoma in Regenerative Medicine Applied to Hematology Disorders. Stem Cells Transl. Med. 2017, 6, 382–393. [Google Scholar] [CrossRef] [PubMed]
- Ross, J.A.; Kasum, C.M. Dietary flavonoids: Bioavailability, metabolic effects, and safety. Annu. Rev. Nutr. 2002, 22, 19–34. [Google Scholar] [CrossRef]
- Cyranoski, D. ‘Reprogrammed’ stem cells approved to mend human hearts for the first time. Nature 2018, 557, 619–620. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mallapaty, S. Revealed: Two men in China were first to receive pioneering stem-cell treatment for heart disease. Nature 2020, 581, 249–250. [Google Scholar] [CrossRef] [PubMed]
- Elliott, D.A.; Braam, S.R.; Koutsis, K.; Ng, E.S.; Jenny, R.; Lagerqvist, E.L.; Biben, C.; Hatzistavrou, T.; Hirst, C.E.; Yu, Q.C.; et al. NKX2-5(eGFP/w) hESCs for isolation of human cardiac progenitors and cardiomyocytes. Nat. Methods 2011, 8, 1037–1040. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Shang, P.; Li, D. Luteolin: A Flavonoid that Has Multiple Cardio-Protective Effects and Its Molecular Mechanisms. Front. Pharm. 2017, 8, 692. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, W.; Xu, T.; Wu, P.; Pan, D.; Chen, J.; Chen, J.; Zhang, B.; Zhu, H.; Li, D. Luteolin improves cardiac dysfunction in heart failure rats by regulating sarcoplasmic reticulum Ca(2+)-ATPase 2a. Sci. Rep. 2017, 7, 41017. [Google Scholar] [CrossRef] [Green Version]
- Rodriguez, J.; Yanez, J.; Vicente, V.; Alcaraz, M.; Benavente-Garcia, O.; Castillo, J.; Lorente, J.; Lozano, J.A. Effects of several flavonoids on the growth of B16F10 and SK-MEL-1 melanoma cell lines: Relationship between structure and activity. Melanoma Res. 2002, 12, 99–107. [Google Scholar] [CrossRef]
Gene | Forward Sequence (5′ to 3′) | Reverse Sequence (5′ to 3′) |
---|---|---|
POU5F1 | GTGGAGGAAGCTGACAACAA | ATTCTCCAGGTTGCCTCTCA |
SOX2 | TTCACATGTCCCAGCACTACCAGA | TCACATGTGTGAGAGGGGCAGTGTGC |
NANOG | AAATTGGTGATGAAGATGTATTCG | GCAAAACAGAGCCAAAAACG |
TNNT2 | ATGAGCGGGAGAAGGAGCGGCAGAAC | TCAATGGCCAGCACCTTCCTCCTCTC |
MYH7 | CACCAACAACCCCTACGATT | ACTCATTGCCCACTTTCACC |
NKX2-5 | GTTCCAGAACCGGCGCTACAAGTG | GCTTGCCATCGCGCACCAGCACTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Go, Y.-H.; Kim, J.; Jeong, H.-C.; Kim, S.-M.; Kim, Y.-J.; Park, S.-J.; Moon, S.-H.; Cha, H.-J. Luteolin Induces Selective Cell Death of Human Pluripotent Stem Cells. Biomedicines 2020, 8, 453. https://doi.org/10.3390/biomedicines8110453
Go Y-H, Kim J, Jeong H-C, Kim S-M, Kim Y-J, Park S-J, Moon S-H, Cha H-J. Luteolin Induces Selective Cell Death of Human Pluripotent Stem Cells. Biomedicines. 2020; 8(11):453. https://doi.org/10.3390/biomedicines8110453
Chicago/Turabian StyleGo, Young-Hyun, Jumee Kim, Ho-Chang Jeong, Seong-Min Kim, Yun-Jeong Kim, Soon-Jung Park, Sung-Hwan Moon, and Hyuk-Jin Cha. 2020. "Luteolin Induces Selective Cell Death of Human Pluripotent Stem Cells" Biomedicines 8, no. 11: 453. https://doi.org/10.3390/biomedicines8110453