Submit to this Journal Review for this Journal Propose a Special Issue

Article Menu

Share Help Cite Discuss in SciProfiles

Open AccessFeature PaperArticle

Peer-Review Record

Asymmetric Bioreduction of Ethyl 4-Chloroacetoacetate into Ethyl 4-Chloro-3-hydroxybutyrate by Recombinant Escherichia coli CgCR in Ethyl Acetate-Betaine:Lactic Acid-Water

Processes 2023, 11(11), 3144; https://doi.org/10.3390/pr11113144

by Linsong Yang¹, Daozhu Xu¹, Luyao Jiang² and Yucai He^1,2,*

Reviewer 1: Anonymous

Reviewer 2:

Tauseef Anwar

Processes 2023, 11(11), 3144; https://doi.org/10.3390/pr11113144

Submission received: 13 October 2023 / Revised: 29 October 2023 / Accepted: 31 October 2023 / Published: 3 November 2023

(This article belongs to the Section Biological Processes and Systems)

Round 1

Reviewer 1 Report

Comments and Suggestions for Authors

The authors report the results of asymmetric reduction of ethyl 4-chloro-3-oxybutyrate (COBE) using E. coli involved carbonyl reductase (CgCR) derived from C Glabrate CGMCC using an interesting solvent system, ethyl acetate: a Des (betaine/lactic acid) and water (50:7:43). Since (R)-CHBE was obtained in very high yield (98.6%) even when 1.0 M substrate was used in the reaction, this reviewer feels that the work may be worth for publication on this journal. However, a heavy revision should be required prior to publication. My concerns are as follows:

(1) The most interesting point of this work is using a deep eutectic solvent (DES) as an additive for the reaction. What is the role of the DES? There are numerous types of DES (betaine/lactic acid). What is the reason why the authors choose this DES?

(2) I strongly recommend that Figure 1 should be revised as like Figure 8. Abbreviation of product (CHBE) and substrate (COBE) should be shown below the corresponding chemical formula. E. coli should be revised as “CgCR (E. coli)”. “Glu” and “Gluconic acid” should be shown below the corresponding chemical formula.

(3) On page 2 line 70, the authors picked up three references for DESs. Why did they select these references? I recommend that first paper for DES (A. P. Abbott, et al. JACS, 2004, 126, 9142) should be cited. If they would like to cite selective references, I recommend to cite reviews for DES that mention about the use of DES as solvents for the bioreactions instead present references. I recommend to cite following reviews: (a) Chem. Reviews 2014, 114, 11060-11082. (b) Appl Microbiol Biotechnol 2016, 100. 6519–6543. (c) J. Agric. Food Chem. 2020, 68, 989−997.

Comments on the Quality of English Language

(1) Quality of the manuscript should be improved. There are numerous mis typos in the reference citation style, i. e., Ref. 17 on line 42, Ref. 71 on line 349, and Ref 69 on line 439. and English of several sentences should be improved, such as a sentence line 36-38, and line 52-53. Furthermore, on line 430, “On the other hand, -----, on the other hand---“. This sentence should be revised.

(2) Line 69. I feel “synthesized” should be revised as “prepared” since the DES was “prepared” by just mixing two compounds.

Author Response

Reviewer 1#: Comments and Suggestions for Authors

Response: Thanks for the good suggestion. In the previous report [44], DES betaine:lactic acid showed biocompatible to biocatalyst. Thus, this betaine:lactic acid was attempted as reaction medium for bioreduction of COBE.

In “Introduction” of the revised manuscript, this information was added as below:

In the previous report [44], DES betaine:lactic acid showed highly biocompatible to biocatalyst. Thus, this betaine:lactic acid might be attempted as reaction medium for bioreduction of COBE. In this study, (R)-CHBE was synthesized from COBE by one newly constructed recombinant E. coli CgCR cells expressing carbonyl reductase (CgCR) and glucose dehydrogenase (GDH). Whole-cell bioreduction factors (e.g., temperature, pH, substrate concentration, co-substrate, metal ions, etc) for assessing the biocatalytic activity were examined in an organic solvent-DES-water system. An efficient whole-cell biotransformation of COBE to (R)-CHBE was successfully established in organic solvent-DES-H₂O.

Reference:

Li Q, Ma CL, He YC. Effective one-pot chemoenzymatic cascade catalysis of biobased feedstock for synthesizing 2,5-diformylfuran in a sustainable reaction system. Bioresource Technology 378 (2023) 128965.

Response: Thanks for the good suggestion. This Fig. 1 was revised as Fig. 8. Abbreviation of product (CHBE) and substrate (COBE) was shown below the corresponding chemical formula. E. coli was revised as “CgCR (E. coli)”. “Glu” and “Gluconic acid” was shown below the corresponding

Figure 1. Glucose/GDH cofactor regeneration system.

Response: Thanks for the good suggestion. In the revised manuscript, these four references were added in “Introduction”.

Abbott AP, Boothby D, Capper G, Davies DL, Rasheed RK. Deep eutectic solvents formed between choline chloride and carboxylic acids: Versatile alternatives to ionic liquids. J. Am. Chem. Soc. 2004, 126, 29, 9142–9147.

Smith EL, Abbott AP, Ryder K S. Deep eutectic solvents (DESs) and their applications. Chem. Reviews 2014, 114, 11060-11082.

Antonopoulou I, Varriale S, Topakas E, Rova U, Christakopoulos P, Faraco V. Enzymatic synthesis of bioactive compounds with high potential for cosmeceutical application. Appl Microbiol Biotechnol 2016, 100. 6519–6543.

Nian B, Cao C, Liu Y. Synergistic catalytic synthesis of Gemini lipoamino acids based on multiple hydrogen-bonding interactions in natural deep eutectic solvents-enzyme system. J. Agric. Food Chem. 2020, 68, 989−997.

Comments on the Quality of English Language

Response: Thanks for the good suggestion. These parts were revised. In addition, other parts were revised with red color in the revised manuscript.

(2) Line 69. I feel “synthesized” should be revised as “prepared” since the DES was “prepared” by just mixing two compounds.

Response: Thanks for the good suggestion. In this part, “synthesized” was revised as “prepared”.

Author Response File: Author Response.docx

Reviewer 2 Report

Comments and Suggestions for Authors

The article titled "Asymmetric bioreduction of ethyl 4-chloroacetoacetate into ethyl 4-chloro-3-hydroxybutyrate by recombinant Escherichia coli CgCR in ethyl acetate-betaine: lactic acid-water" presents a comprehensive study on the bioreduction of a specific compound. However, there are points of improvement:

The abstract is quite detailed but it might benefit from a slightly more structured presentation. Delineated subheadings, such as 'Objective', 'Methods', 'Results', and 'Conclusion', can enhance reader comprehension. There's an excessive use of detailed molecular weights for the proteins. While this might be important in the methods or results, it’s perhaps too specific for an abstract. Information about the effects of organic solvents and DES on cell permeability is suddenly introduced. It might be useful to either provide a lead-in sentence or clarify its direct relevance to the primary study aim. The introduction jumps between different concepts without smooth transitions. For instance, the discussion on the significance of chiral drugs moves directly to the specific applications of (R)-CHBE. A smoother transition or a bridge sentence might enhance flow. The information that (R)-CHBE is derived from COBE appears multiple times in different formats. It would be more concise to state this information once and then delve deeper into its significance. Ensure that all assertions or claims have proper citations. Some sentences lack them, which could undermine the validity of the statements.

The process for the construction and expression of the reductase seems complex and might benefit from a clearer step-by-step breakdown or even a flowchart representation. The terminology should be consistent throughout. For instance, 'ethyl acetate-betaine: lactic acid-water' in the title and 'organic solvent-DES-water system' in the methodology section likely refer to the same solvent system but are denoted differently. For the evaluation of different parameters like temperature, pH, substrate concentration, etc., the methodology provides the conditions tested but doesn’t detail the actual method of testing or the controls used. This might be elaborated upon. There is the use of various technical terms and abbreviations like DES, HBA, and HBD. The use of 'in this work' or 'in this study' seems repetitive. It might be beneficial to rephrase or combine sentences to reduce redundancy. Expand on the construction process of the recombinant E. coli expressing CgCR and GDH. The methods behind the creation of the recombinant E. coli need to be elaborated upon. The rationale behind choosing specific parameters for optimal conditions (e.g., why 30 ℃, why pH 7.0) should be further elucidated. Figure captions should provide more detail. For instance, Figure 3's description could be more elaborate about what readers should glean from the electrophoresis results.

The mechanism of interaction between CgCR and COBE needs a more in-depth analysis. While molecular docking has been discussed, insights into why specific amino acid residues interact with COBE can offer more depth. When comparing CgCR's performance to other enzymes or systems, it would be beneficial to provide more background on these other systems or methods. For instance, a brief introduction to BsCR and its relevance would be helpful.

The conclusion section might benefit from highlighting the novelty and advantages of the method developed in this study compared to other known methods. Potential applications or implications of this bioreduction in real-world scenarios or industries could be discussed.The significance of parameters like α, β, and π* in the context of the study could be explained more clearly. Referencing numbers (like [66], [67]) should be checked to ensure they correlate to the correct references in the bibliography. Considering the effects of other organic solvents or different types of DES could provide a broader perspective on the method's versatility. Long-term stability and repeatability tests would be beneficial to ensure the method's robustness over time.

The article provides valuable insights into the bioreduction of COBE, but addressing the above points would enhance its clarity, depth, and overall impact.

Comments on the Quality of English Language

Minor editing of English language required

Author Response

Reviewer 2#: The article titled "Asymmetric bioreduction of ethyl 4-chloroacetoacetate into ethyl 4-chloro-3-hydroxybutyrate by recombinant Escherichia coli CgCR in ethyl acetate-betaine: lactic acid-water" presents a comprehensive study on the bioreduction of a specific compound. However, there are points of improvement:

Response: Thanks for the good suggestion. The “Abstract” was revised as below:

“The expressed proteins were determined with molecular weights of 42.8 kDa (CgCR) and 24.9 kDa (GDH), respectively” was deleted from the “Abstract”. The molecular weights for the proteins were provided in “3.1. Construction of recombinant E. coli expressing CgCR and GDH”.

Delineated subheadings, such as 'Objective', 'Methods', 'Results', and 'Conclusion', were used to enhance reader comprehension. The revised “Abstract” was given as below:

“Abstract:

Objective: Optically active (R)-ethyl 4-chloro-3-hydroxybutyrate [(R)-CHBE] is a useful chiral building block applicable to the synthesis of pharmaceuticals. Recently, it is of great interest to synthesize (R)-CHBE via the process of highly stereoselective bioreduction of ethyl 4-chloro-3-oxobutanoate (COBE) under the mild condition. Methods: In this work, a highly efficient bioreduction process for transforming COBE into (R)-CHBE was developed in a biocompatible organic solvent-deep eutectic solvent-water reaction medium. Results: Recombinant Escherichia coli containing carbonyl reductase (CgCR) and glucose dehydrogenase (GDH) was successfully constructed and characterized. In addition, the feasibility for asymmetric bioreduction of COBE into (R)-CHBE was verified in an organic solvent-deep eutectic solvent-water (ethyl acetate-betaine:lactic acid-water) system. At pH 7.0 and 30 ^oC, the kinetic constants Km and kcat of COBE were 20.9 mM and 56.1 s^-1, respectively. A high (R)-CHBE yield (≥ 90%) was achieved by catalyzing COBE (1000 mM) in 12 h with E. coli CgCR cells in the existence of Ni²⁺ (7 mM) and glucose (3.5 mM glucose/mM COBE) in ethyl acetate-betaine:lactic acid-H₂O (50/7/43, v/v/v) system. The effects of organic solvent and DES on whole cell permeability were analyzed. Conclusion: An efficient bioreduction system was constructed for biologically transforming COBE to (R)-CHBE via whole-cell biocatalysis, and the established bioprocess had potential application in future.

The introduction jumps between different concepts without smooth transitions. For instance, the discussion on the significance of chiral drugs moves directly to the specific applications of (R)-CHBE. A smoother transition or a bridge sentence might enhance flow. The information that (R)-CHBE is derived from COBE appears multiple times in different formats. It would be more concise to state this information once and then delve deeper into its significance. Ensure that all assertions or claims have proper citations. Some sentences lack them, which could undermine the validity of the statements.

Response: Thanks for the good suggestion. In this revised manuscript, the “Introduction” was revised.

“1. Introduction

To date, growing global chiral drug market share attracts many researchers to engage in the research and development and application of chiral drugs [1-5]. Chirality is one of the fundamental properties prevalent in nature, and almost all macromolecules such as sugars, nucleic acids, proteins and cellulose involved in life activities in the body are chiral [4-10]. Ethyl 4-chloroacetoacetate (COBE), a chiral drug intermediate of β-carbonyl carboxylic acid esters [11], is generally as a substrate to catalyze the synthesis of chiral CHBE. As a COBE derivative, 4-chloro-3-hydroxybutyrate (CHBE) can be synthesized by asymmetric catalysis of chiral catalysts [12], dehalogenase catalysis, microbial asymmetric resolution and biocatalytic asymmetric reduction [13,14]. Optically active (R)-CHBE is a crucial chiral synthesis agent for manufacturing (R)-4-amino-3-hydroxy-butyric acid, L-carnitine, (R)-4-hydroxy-2-pyrrolidone, negamycin, macrolactin A etc [15,16]. (R)-4-Amino-3-hydroxybutyric acid can be used as an anti-convulsant for the treatment of acute epilepsy caused by ketone body [17]. L-Carnitine synthesized from (R)-CHBE as the initial raw material is able to treat Alzheimer's disease and male infertility [18-20]. Negamycin as an effective candidate for the treatment of nonsense-related diseases [21]. (R)-4-Hydroxy-2-pyrrolidone, which is known as γ-butyllactam, has cytotoxic, antitumor and anti-inflammatory physiological activities [22]. Macrolactin A can prevent HIV replication [23].

Commercially, the synthesis of (R)-CHBE from COBE is conducted by chemical catalysts containing rare metals, reducing metal catalysts with ammonia, or flammable and explosive chemocatalysts (such as sodium borohydride) [24-26]. These methods require expensive rare metals as chemocatalysts and the harsh reaction conditions, and the optical purity of the products is not high [27,28]. Distinct from chemical reduction, biocatalytic reduction has mild conditions, good selectivity and high conversion. Using carbonyl reductase to catalyze the asymmetric biological reduction of COBE to produce (R)-CHBE is a promising synthesis pathway [29]. The key to the biological reduction process is the participation of carbonyl reductase and NAD(P)H [30,31]. Presently, coupling of reductases with dehydrogenases for regeneration of coenzyme can been applied to enhance the bioreduction [32]. Glucose dehydrogenase (GDH) enable biologically transform glucose to gluconic acid, promoting the biotransformation of NAD(P)⁺ to NAD(P)H (Figure 1).

Figure 1. Glucose/GDH cofactor regeneration system.

It is known that the substrate COBE is hydrophobic compound that are insoluble [33]. In the whole cell catalysis bioprocess, high titer of the hydrophobic substrate may inhibit the biocatalytic efficiency in the whole-cell reaction [34-36]. The supplementary of hydrophobic organic solvents to the bioreaction system can enhance the efficiency of the bioreaction [37-40]. Deep eutectic solvents (DESs), which can be prepared by blending a hydrogen-bond-acceptor (e.g., choline chloride) and a hydrogen-bond-donor (e.g., amines, carboxylic acids, and polyols) [41-43], are recognized as green solvents. They have been extensively utilized as a chemical or biochemical reaction medium for enhancing the catalytic efficiency [44-47]. Some DESs have applied to be used as tool for biocatalysis, either as solvents or as separative agents to overcome challenging workup procedures [48-50]. Many organic solvents and DESs have been applied for enhancing the availability of insoluble substrates, alleviate the inhibition of substrate, and promoting the efficiency of catalysis [51]. The use of additives (organic solvents and DESs) might be applied to increase the permeability of cell membranes for facilitating the efficiency of substance exchange during biocatalytic reactions [52].

Due to coenzyme dependence of keto reductase in the bioreduction of COBE, it is generally necessary to supplement NAD(P) into the bioreaction system [52-54]. In order to reduce the performance cost, co-substrate such as glucose will be supplemented to the COBE-reducing system to yield (R)-CHBE using tandem dehydrogenase and another coenzymes [55-57]. Compared the purified enzymes, whole-cell bioreduction is gained much attention, which avoids the complicated step for enzyme purification and facilitates the product recovery [58-60]. In an ideal bioreduction system, carbonyl reductase coupled with dehydrogenase for cofactor regeneration in a same kind of bacteria cells is a good strategy for biological reduction This strategy can be applied to biologically transform COBE into (R)-CHBE with high activity and substrate-tolerance of reductase biocatalyst, which has the potential to replace traditional chemical reduction processes [61-64].

The process for the construction and expression of the reductase seems complex and might benefit from a clearer step-by-step breakdown or even a flowchart representation.

Response: Thanks for the good suggestion. In this revised manuscript, the process for the construction and expression of the reductase was provided in a new scheme (Figure 2, as below):

Figure 2. Construction process of recombinant E. coli CgCR.

The terminology should be consistent throughout. For instance, 'ethyl acetate-betaine: lactic acid-water' in the title and 'organic solvent-DES-water system' in the methodology section likely refer to the same solvent system but are denoted differently.

Response: Thanks for the good suggestion. In this revised manuscript, 'organic solvent-DES-water system' in the methodology section involved different solvents [ethyl acetate (EA), isopropyl alcohol (IPA), butyl acetate (BA), and methyl isobutylketone (MIBK)].

'ethyl acetate-betaine: lactic acid-water' in the title and 'organic solvent-DES-water system' in the methodology section were not same solvent system.

To evaluate the influence of organic solvent on the biocatalytic efficiency, different solvents [ethyl acetate (EA), isopropyl alcohol (IPA), butyl acetate (BA), and methyl isobutylketone (MIBK)] (50%, v/v) were separately added to bioreaction system.

For the evaluation of different parameters like temperature, pH, substrate concentration, etc., the methodology provides the conditions tested but doesn’t detail the actual method of testing or the controls used.

Response: Thanks for the good suggestion. In this revised manuscript, the related information was provided as follows:

“2.4. Bioreduction of COBE with CgCR cell in water system

In this work, several bioreaction factors were assessed in the biotransformation of COBE into CHBE. To test the effect of reaction temperature on the bioreduction, bioconversions were performed at various temperature (15–55 °C) in the aqueous system containing glucose (1 mM glucose/mM COBE), COBE (100 mM), and CgCR cells (OD₆₀₀=100). To examine the effect of medium pH on the bioreduction, bioconversions were performed at 30 ^oC in the bioreaction system (citrate buffer solution, pH 4–5; phosphate buffer solution, pH 6–8) containing glucose (1 mM glucose/mM COBE), COBE (100 mM), and CgCR cells (OD₆₀₀=100). To assess the influence of metal ion additives on the biocatalytic efficiency, Fe³⁺, Fe²⁺, Ni²⁺, Gr³⁺, Zn²⁺, Mg²⁺, Ca²⁺, Mn²⁺, Li²⁺, Sn⁴⁺, Al³⁺, and Sr³⁺ (1 mM) was individually supplemented to the aqueous system with glucose (1 mM glucose/mM COBE), COBE (100 mM), and CgCR cells (OD₆₀₀=100) at 30 ℃ and pH 7.0. To evaluate the influence of different Ni²⁺ concentration on the biocatalytic efficiency, Ni²⁺ (0~10 mM) was added to the aqueous system (pH 7.0) containing glucose (1 mM glucose/mM COBE), COBE (100 mM) and CgCR cells (OD₆₀₀=100) at 30 ℃ and pH 7.0. To test the effect of glucose ratio on the biocatalytic efficiency, different concentration of glucose (glucose:COBE=0.5:1, 1:1, 1.5:1, 2:1, 2.5:1, 3:1, 3.5:1, 4:1, or 5:1, mol/mol) was individually added to the aqueous system with CgCR wet cells (OD₆₀₀=100) at 30 ℃ and pH 7.0. To investigate the influence of substrate concentration on the biocatalytic efficiency under the above optimized system, different concentration of substrate (100-1000 mM) was individually supplemented to 10 mL system with CgCR cells (OD₆₀₀=100), glucose (3.5 mM glucose/mM COBE), and Ni²⁺ (7 mM) at 30 ℃ and pH 7.0. Samples were withdrawn periodically for the assay.”

This might be elaborated upon. There is the use of various technical terms and abbreviations like DES, HBA, and HBD. The use of 'in this work' or 'in this study' seems repetitive. It might be beneficial to rephrase or combine sentences to reduce redundancy.

Response: Thanks for the good suggestion. In this revised manuscript, most HBA, and HBD were deleted from the text body. Most DES were delted from the text body. The use of 'in this work' or 'in this study' was united.

Expand on the construction process of the recombinant E. coli expressing CgCR and GDH. The methods behind the creation of the recombinant E. coli need to be elaborated upon.

Response: Thanks for the good suggestion. In this revised manuscript, the details were was given as below:

“2.3. Construction and expression of reductase

The genes of reductase (CgCR) from C. glabrata CGMCC 2.234 and glucose dehydrogenase (GDH) from B. megaterium (BmGDH) (GenBank: SUV21072.1) were co-expressed in one E. coli cell (Figure 2). pRSF-F (AGCCAGATCCGAATTCGAGC) and pRSF-R (GTGGTGATGATGGATGGCTGC) were applied to linearize pRSFDuet-1 backbone. Primers CgCR-R (ATTCGGATCCTGGCTTTACACAAATGGCTTAAATGGCCCCC) and CgCR-F (CACCATCATCACCACATGGCTGCTCTACATAAGAACACTTCTACTTTG) were applied to amplify CgCR. Primers GDH-R (GATATATCTCCTTAGGTACCTTACACAAATGGCTTAAATG) and GDH-F (CACCATCATCACCACATGGCTGCTCTACATAAGAACACTTC) were applied to amplify GDH. The purified CgCR, GDH and linearized pRSFDuet-1 fragments were linked by T5 exonuclease by transforming E. coli DH 5α chemically competent cells. The pRSFDuet-CgCR-GDH was verified by DNA sequencing, and it was transferred into competent E. coli BL21 (DE3) through the electroporation to give recombinant strain E. coli CgCR. The plasmid with correct gene sequencing expression was introduced into the BL21 clone strain for expression. Under the action of IPTG inducer, it promotes the expression of target genes. The nucleic acid and SDS-PAGE electrophoresis were used to test the expression results.

Figure 2. Construction process of recombinant E. coli CgCR.

Recombinant E. coli CgCR was inoculated, cultivated and harvested as previously reported [53]. Activity of reductase in E. coli CgCR was measured spectrophotometrically under pH 7.0 and 30 °C by detecting the alteration of NADPH absorbance (340 nm) in a total volume of 1 mL containing 0.2 mM NADPH, different concentration of COBE, 0.85 mL buffer (100 mM KPB) and 100 μL crude enzyme. One unit (U) of enzyme activity of CgCR was defined as the enzyme amount (mg protein) that can oxidize 1 μmol of NADPH per minute under the specified conditions.”

The rationale behind choosing specific parameters for optimal conditions (e.g., why 30 ℃, why pH 7.0) should be further elucidated. Figure captions should provide more detail. For instance, Figure 3's description could be more elaborate about what readers should glean from the electrophoresis results.

Response: Thanks for the good suggestion. In this revised manuscript, these information and discussion were given as below:

“It is known that bioreduction temperature and medium pH have crucial role in the biotransformation [38,39,67]. The influences of bioreduction temperature and medium pH on the COBE-reducing activity were investigated, and the results were displayed in Figure S1a & b (in Support Information). It was observed that temperature influenced the catalytic activity apparently. When temperature was increased from 15 ℃ to 30 ℃, the COBE-reducing activities increased. At 30 ℃, the highest yield of CHBE by CgCR reductase was obtained at 84.7% in 1.5 h. After temperature exceeded 30 ℃, the activities began to decrease, possibly due to the thermal deactivation of reductase in CgCR cells during the bioreduction reaction. Accordingly, the suitable temperature for promoting COBE-reducing activity was chosen at 30 ℃. Under low or high temperature conditions, the activities were decreased, so the reaction temperature should be strictly controlled during the bioreaction process. Figure 6b showed that medium pH had little influence on the bioreaction, but it generally presented a trend of rising and then falling, reaching the highest value at pH 7.0. High pH or low pH might affect the dissociation state of substrate and enzymes, which would influence the binding of substrates to enzyme active centers. Clearly, recombinant E. coli CgCR had good pH tolerance, and the residual reductase activity reached 83.9% even at pH 4.0, indicating that CgCR reductase could adapt to both weak acid environment. Compared to the conventional chemical reduction], bioreduction is considered as a sustainable route for producing CHBE under the eco-friendly performance condition [13].”

More information was provided in the Figure 3's description:

Figure 3. Analysis of the CgCR gene fragment by electrophoresis (Lane 1: marker, Lane 2: CgCR gene) (a); analysis of the CgCR-GDH gene fragment by electrophoresis (Lane 1: marker, Lane2: CgCR-GDH gene) (b); SDS−PAGE analysis of recombinant protein of CgCR and GDH in recombinant E. coli CgCR cells expressing carbonyl reductase (CgCR) and glucose dehydrogenase (GDH) [Lane 1: marker, Lane 2: CgCR (43.9 kDa) and GDH (36.0 kDa) in E. coli CgCR] (c).

Other Captions were revised as below:

Figure S1. Effect of different temperatures (15~55 ℃) on the catalytic reactions [100 mM COBE, pH 7.0] (a); Effect of different pH (4~8) on the catalytic reactions n [100 mM COBE, 30 ^oC ] b); Effect of different metal ions on the catalytic reactions (c); Effect of co-substrate glucose loading on the catalytic reactions [100 mM COBE, 30 ^oC and pH 7.0] (d).

Figure S2. Effects of different metal ions on the catalytic reactions [100 mM COBE, 30 ^oC and pH 7.0] (a); Effects of different Ni²⁺ concentration on the catalytic reactions [100 mM COBE, 30 ^oC and pH 7.0] (b).

Figure S3. Effect of COBE concentration on the biocatalytic reaction [30 ^oC and pH 7.0].

Figure S4. Effect of DES (betaine:lactic acid) loading on the biocatalytic reactions [100 mM COBE, 30 ^oC and pH 7.0].

Table S1. Effects of different additives on total cell membrane permeability of CgCR.

Response: Thanks for the good suggestion. In this revised manuscript, these information and discussion were given as below:

Figure 4. The binding of COBE with CgCR (a); Making apparent interactions with the functionally important residues of CgCR (b); The 2D plot of CgCR binding-pocket residues and their interaction (c).

Molecular docking (MD) can describe the interaction between molecules in depth, and can explain the mechanism of interaction visually, and has become an important research method to explain the biological mechanism [27]. CgCR was one kind of reductase with Prelog preference in the asymmetric reduction of prochiral ketone COBE. Reductase CgCR with ligand COBE Molecular docking was conducted via AutoDock and PyMOL. The interaction between CgCR and COBE was illustrated in Figure 4a & 4b. There was a binding energy of -12.74 kcal/mol between CgCR and COBE, and it interacted with two amino acid residues Tyr127 and Ala11 at the same time. The low energy facilitated the bioreduction of COBE. As presented in Figure 4b & 4c, the binding site of CgCR from C. glabrata (CGMCC 2.234) with COBE includes the amino acids THR-25, TYR-63, LYS-88, TYR-206, VAL-255, ASN-157 and TRP-297, which form an active pocket. Hydrophobic interaction between the small molecule and VAL-255 was observed, as well as hydrogen bond interactions with THR-25, TYR-63, ASN-157 and TRP-297. In addition, the substrate molecules also have electrostatic interaction with LYS-88 and TYR-206. These interactions play a crucial role in the stable association between COBE and CgCR.

When comparing CgCR's performance to other enzymes or systems, it would be beneficial to provide more background on these other systems or methods. For instance, a brief introduction to BsCR and its relevance would be helpful.

Response: Thanks for the good suggestion. In this revised manuscript, more background on these other systems or methods were provided. They were marked with red color. A brief introduction about CgCR and GDH was given.

“The genes of reductase (CgCR) from C. glabrata CGMCC 2.234 and glucose dehydrogenase (GDH) from B. megaterium (BmGDH) (GenBank: SUV21072.1) were co-expressed in one E. coli cell (Figure 2)”

“CgCR was one kind of reductase with Prelog preference in the asymmetric reduction of prochiral ketone COBE. ”

Response: Thanks for the good suggestion. In this revised manuscript, these information and discussion were given as below:

“4. Conclusions

Optically active (R)-CHBE is a key intermediate for the production of (R)-4-amino-3-hydroxy-butyric acid, L-carnitine, (R)-4-hydroxy-2-pyrrolidone, negamycin, macrolactin A. To date, there is of great interest to synthesize (R)-CHBE from COBE through the bioreduction approach. CgCR was coexpressed with GDH to provide cofactor regeneration systems, and recombinant E. coli CgCR harboring NADPH-dependent reductase was created to efficiently transform high loading of COBE into (R)-CHBE. At pH 7.0, 30 ℃, Ni²⁺ (7 mM) and glucose (3.5 mM glucose/mM COBE) was added into this bioreaction system containing COBE (1000 mM), and the (R)-CHBE yield could achieve by about 90% within 12 h. The constructed EA-betaine:lactic acid-water (50:7:43 v/v/v) system could be used as optimal bioreaction medium in the presence of metal ion Ni²⁺ (7 mM) and glucose (3.5 mM glucose/mM COBE). The combination of betaine:lactic acid plus EA as bioreaction medium could significantly improve the whole-cell permeability, which facilitated the bioreduction of COBE and enhanced the (R)-CHBE yield. Compared to other bioreduction approaches, this established bioreduction process could be used to synthesize (R)-CHBE in a high yield from 1000 mM COBE. This developed process showed high potential application in future.”

The significance of parameters like α, β, and π* in the context of the study could be explained more clearly.

Response: Thanks for the good suggestion. In this revised manuscript, these information and discussion were given as below:

“Furthermore, 50 vol% of ethyl acetate, 7 vol% of betaine:lactic acid and 43 vol% of water were mixed to construct the optimal bioreduction system, and the yield of (R)-CHBE was increased apparently compared to the single water system. This was probably related to the K-T parameters of the solution, which was used for estimating the chemical properties of reaction solutions. The corresponding parameters α, β, and π* were behalf of the hydrogen-bonding acidity, basicity, and dipolarity/polarizability of the catalytic reaction solvent [27], respectively. A solution with a high α value might easily disrupt H-bonds to release H⁺, while betaine:lactic acid with a high β value might have high H-bond accepting ability. α and β of betaine:lactic acid were 0.37 and 0.39, respectively, and the π* value was 1.53. α, β and π* of EA+H₂O were 0.39, 2.53, 0.038, respectively. While α, β and π* of EA+betaine:lactic acid+H₂O were 0.56, 1.77, 0.27, respectively. Combined with the K-T parameters of betaine:lactic acid, the reason for the increase in (R)-CHBE yield might be the increase in π*. High π* value of reaction system facilitated the COBE dissolution, which was more suitable for CgCR cells to participate in bioreduction.”

Referencing numbers (like [66], [67]) should be checked to ensure they correlate to the correct references in the bibliography.

Response: Thanks for the good suggestion. In this revised manuscript, these referencing numbers (like [66], [67]) were checked to ensure they correlate to the correct references in the bibliography.

Considering the effects of other organic solvents or different types of DES could provide a broader perspective on the method's versatility. Long-term stability and repeatability tests would be beneficial to ensure the method's robustness over time.

Response: Thanks for the good suggestion. Before “4 Conclusion”, these discussions “Considering the effects of other organic solvents or different types of DES might provide a broader perspective on the method's versatility. Long-term stability and repeatability tests would be beneficial to ensure the method's robustness over time. ” were added as below:

“The approach of coupling reductase with dehydrogenase for the coenzyme regeneration is an efficient way to improve the bioreduction efficiency [75,76]. Asymmetric biosynthesis of (R)-CHBE from COBE was conducted through the bioreduction with CgCR cells containing CgCR and GDH in the presence of glucose (Figure 8). CgCR and GDH were used to build a double-enzymatic system for the regeneration of NADPH. Then carbonyl reductase efficiently and asymmetrically synthesizes (R)-CHBE from COBE, while glucose dehydrogenase utilizes glucose to regenerate NADP⁺ produced during COBE reduction into DANPH. Accordingly, an efficient bioreduction of COBE into (R)-CHBE with CgCR cell in EA-betaine:lactic acid-water system. The selected EA was easy to volatilize and separate for subsequent development and utilization. Betaine:lactic acid was prone to prepare as green solvent. This developed strategy using EA and betaine:lactic acid as the cosolvent could enhance the catalytic efficiency. Considering the effects of other organic solvents or different types of DES might provide a broader perspective on the method's versatility. Long-term stability and repeatability tests would be beneficial to ensure the method's robustness over time. In the future, it would be of great interest to develop a cost-effective catalysis process to enhance (R)-CHBE productivities with robust reductase biocatalysts in benign bioreaction medium.

The article provides valuable insights into the bioreduction of COBE, but addressing the above points would enhance its clarity, depth, and overall impact.

Response: Thanks for the good suggestion. In this revised manuscript, the article provided valuable insights into the bioreduction of COBE, but addressing the above points enhanced its clarity, depth, and overall impact. The revised parts were marked with red color.

Author Response File: Author Response.docx

Round 2

Reviewer 1 Report

Comments and Suggestions for Authors

Quality of the revised manuscript has been improved. However, this reviewer feels that the authors provide only a partial answer against query (1) rose by the referee. While the referee asked the reason why the authors choose betaine:lactic acid as an additive. According to the text, the authors also investigated additive effect of ChCl:Gly on page 10. I strongly recommend that Figure S4 should be moved to main text as “Figure 7”, and Figure 7 should be moved to SI. By this modification, more detailed results of additive effect of DES, including that of ChCl:Gly should be added in the new Figure 7. I also recommend that Figure 8 should be revised common figure stye, though this figure is very impressive figure as a graphic abstract.

Comments on the Quality of English Language

This reviewer feels that all readers can follow the story easily.

Author Response

Reviewer 1#

Comments and Suggestions for Authors

Response: Thanks for the good suggestion.

The most interesting point of this work is using a deep eutectic solvent (DES) as an additive for the reaction. This description about DES role and the reason of DES in bioreaction was provided in “Introduction” of the revised manuscript. It was given as folows: “Organic solvent and DES can enhance the biocatalytic efficicency [28,37,49]. In the previous report [44], DES betaine:lactic acid (1:2, mol/mol) showed highly biocompatible to biocatalyst. Thus, combination of organic solvent and betaine:lactic acid might be attempted as reaction medium for bioreduction of COBE. The constructed reaction system might facilitate the dissolution of COBE, which would be suitable for biocatalysts to participate in the bioreduction of COBE。。。”.

In our work, only DES betaine:lactic acid was used. DES ChCl:Gly was from the cited reference, and it was just used to be introduced. This sentence “Gonzalo used the bifunctional biocatalyst PDHH-MFMO in the existence of polyol-ChCl in a biphasic system of 5 vol% or 10 vol% with high COBE concentration (0.10 M or 0.20 M) with 10 vol% of ChCl:Gly having a positive influence on the oxidation with a conversion of 73% [74]. As the content of betaine:lactic acid in water was increased to 80%, ChCl:Gly (molar ratio 1:2) could enhance the stereoselectivity for carbonyl reductase in the biotransformation of COBE, yielding 95% e.e. of (R)-CHBE” was deleted from the text body. Thus, ChCl:Gly was not added in Figure 7.

In this revised manuscript, Figure S4 was moved to main text as “Figure 7”, and Figure 7 should be moved to SI. The updated Figures were given as below:

Figure 7. Effect of DES (betaine:lactic acid) loading on the biocatalytic reactions [100 mM COBE, 30 ^oC and pH 7.0].

Figure S4. Influence of different crushing time on the cell catalytic reaction [100 mM COBE, 30 ^oC and pH 7.0]

Figure 8 looks like a graphic abstract, and it can be deleted from the text body. In this revised manuscript, Figure 8 was deleted.

Comments on the Quality of English Language

This reviewer feels that all readers can follow the story easily.

Response: Thanks for the good suggestion. In the revised manuscript, the English was further improved. The revised parts were marked with red color in the revised mansucript.

Author Response File: Author Response.docx

Reviewer 2 Report

Comments and Suggestions for Authors

Accept after minor revision (corrections to minor methodological errors and text editing)

Comments on the Quality of English Language

Minor editing of English language required

Author Response

Reviewer 2#

Comments and Suggestions for Authors

Accept after minor revision (corrections to minor methodological errors and text editing)

Response: Thanks for the good suggestion. In the revised manuscript, the minor methodological errors and text editing were further improved. The revised parts were marked with red color in the revised mansucript.

Comments on the Quality of English Language

Minor editing of English language required

Response: Thanks for the good suggestion. In the revised manuscript, the English was further improved. The revised parts were marked with red color in the revised mansucript.

Author Response File: Author Response.docx

Article Menu

Asymmetric Bioreduction of Ethyl 4-Chloroacetoacetate into Ethyl 4-Chloro-3-hydroxybutyrate by Recombinant Escherichia coli CgCR in Ethyl Acetate-Betaine:Lactic Acid-Water

Further Information

Guidelines

MDPI Initiatives

Follow MDPI