Population Composition, Physiology and Ecology of Filamentous Bacteria in Activated Sludge

Abstract

Filamentous bacteria are one of the main components of activated sludge microorganisms, which not only support flocculent bacteria in forming sludge flocs but also easily lead to sludge bulking. This article summarizes the high-throughput sequencing technology and database construction that integrates the FISH probe and 16s rRNA gene of filamentous bacteria. The detection frequency and abundance were statistically analyzed to determine the core filamentous bacteria. The filamentous bacteria searchable in the NCBI database belong to six phyla and 42 genera, with a total of 94 species. The core filamentous bacteria in the expanded activated sludge include Microthrix parvicella (M. parvicella), type 0092, Mycobacterium fortuitum, etc. The physiological ecology of the core filamentous bacteria is discussed in detail, aiming to establish targeted sludge expansion control strategies, reduce the incidence and harm of sludge expansion, and propose that future research needs to promote further development in the field of environmental microbiology.

1. Introduction

In 1914, the British Arden and Lockett [1] first introduced the concept of activated sludge and developed a process thereof. This method is suitable for various wastewater quality levels, has flexible and diverse operation modes, has high pollutant removal efficiency, has low operation cost, and has strong controllability. It is the most widely used biological wastewater treatment technology at present. Similar to soil and sediment, activated sludge is a highly complex system composed of bacteria, archaea, eukaryotes (protozoa and fungi) and viruses, with bacteria dominating and existing in the form of bacterial micelles [2,3]. From a morphological perspective, fungal flocs comprise flocculent and filamentous bacteria. For activated sludge systems, filamentous bacteria play a crucial role. They not only contribute to wastewater purification through biochemical processes, thanks to their larger specific surface area and greater capacity to absorb low-concentration pollutants than flocculent bacteria, but also serve as a supporting skeleton. In this physical role, filamentous bacteria and flocculent bacteria act as “bone and meat”, with the latter attaching to the “skeleton” with extracellular polymers such as pectin and polysaccharides [4,5,6].

According to the process flow of the activated sludge method, the concentrated sludge in the secondary sedimentation tank is returned to the biochemical tank through the external circulation system, and its concentration determines the amount of sludge in the biochemical tank. However, filamentous bacteria grow and reproduce excessively, and the mycelium extends beyond the surface of the sludge. In that case, it will cause loose flocs and the deterioration of sedimentation performance, resulting in filamentous sludge bulking [7,8,9,10], and the concentration of returned sludge decreases, ultimately affecting the effectiveness of sewage treatment. There are many species and a large number of filamentous bacteria which have low requirements for environmental conditions and strong adaptability. Due to their high frequency and harm to sludge bulking, they are one of the common operational difficulties in sewage treatment plants [11,12,13,14,15,16,17,18,19,20,21,22,23]. Eikelboom took the lead in carrying out pioneering and groundbreaking research on filamentous bulking and foam bacteria classification in 1975 [24]. So far, research has preliminarily shown the species of filamentous bacteria, the process and mechanism of sludge bulking, influencing factors and control strategies [25,26,27,28,29,30,31,32,33,34]. Although a certain research foundation has been accumulated, the incidence of sludge bulking remains high and recurrent. Therefore, conducting a comprehensive review of filamentous bacteria in all existing sewage treatment plants is necessary.

This review integrates the existing literature on filamentous bacteria identification methods, population composition and physiological ecology. It comprehensively summarizes recent filamentous bacteria identification methods, including a detailed summary of FISH probes, high-throughput sequencing of 16s rRNA genes and database construction. For the first time, it comprehensively analyzes the detection frequency and abundance of filamentous bacteria in sewage treatment plants in different countries, regions and cities around the world and determines core filamentous bacteria based on this. It also analyzes and summarizes physiological ecology, providing references for developing effective sludge-swelling control strategies and filling the knowledge gap related to filamentous bacteria in the field of environmental microbiology.

2. Detection and Identification of Filamentous Bacteria

In the early stages of research, filamentous bacteria were identified and classified through morphology and chemical staining, and physiological ecology was studied using bacterial pure-culture techniques. However, these methods had their limitations. For instance, in 2000, Eikelboom et al. established a manual for identifying filamentous bacteria, which required extensive experience and had low sensitivity. Detecting filamentous bacteria inside flocs was particularly challenging, leading to unreliable identification results. The use of pure cultivation of filamentous bacteria also had its drawbacks, as the data obtained from the study were not easily generalizable to large-scale environments. It could not accurately depict the actual population biodiversity, and individual conclusions obtained may be contrary to in situ monitoring. Moreover, with the help of the filamentous bacteria identification manual, the number of identifiable filamentous bacteria is limited, and there are relatively few types of filamentous bacteria that can be isolated and cultured. In summary, traditional methods have severe shortcomings in revealing the accurate level of filamentous bacterial biodiversity. Since the beginning of this century, molecular biology methods that do not rely on pure cultivation have been introduced into the study of activated sludge microorganisms; notably, FISH technology with rRNA-directed oligonucleotides and high-throughput sequencing technology have revealed many previously unclassified taxa, improving the reliability of primary data and, more importantly, significantly enhancing the ability to distinguish bacteria and archaea. The species and quantities of filamentous bacteria detected have also increased, overcoming these challenges and providing more accurate results [35,36,37,38,39,40]. FISH and high-throughput sequencing technology can simultaneously detect multiple filamentous bacteria and determine their relative abundance. Based on this analysis, they can analyze the population structure and succession rules of filamentous bacteria in the sample and confirm the dominant filamentous bacteria. Combined with physiological ecology, the factors causing sludge swelling can be identified, providing a basis for targeted measures to be formulated.

2.1. Fluorescence In Situ Hybridization (FISH) Technology

Fluorescence in situ hybridization (FISH) technology is intuitive, highly specific and sensitive. It does not require extraction and amplification of microbial Deoxyribo Nucleic Acid (DNA), which can avoid systematic errors and has unique advantages in identifying microorganisms [41,42]. The Probe Base provides detailed information on most filamentous bacterial probes, and for filamentous bacteria with known phylogenetics, targeted probes are selected based on evaluation results. Figure 1 summarizes the important known filamentous bacteria and their targeted probes for phylogenetics in the literature (indicated by the text on the horizontal line) [28,43,44,45,46]. Most filamentous bacteria can be directly identified, such as M. parvicella (MPAMIX probe); however, some filamentous bacteria need to be identified using a classification method. For example, when identifying filamentous bacteria of type 0092 in the species Chlorothallus, the universal probe CFXMIX needs to be used first, followed by the species-specific probes CLX197 or CLX221. Due to the lack of rRNA sequence data required for targeted probe design, FISH currently cannot recognize all filamentous bacteria, such as type 0803. Each probe is used to capture digital images under a microscope, which are then analyzed using ImageJ software to determine the biological volume of bacteria based on the pixel area of specific probe-positive cells [47]. The EUBmix probe measures the abundance of whole bacteria, while the abundance of filamentous bacteria is expressed as the percentage of specific probe-positive cell pixel area to the total bacterial-positive cell pixel area. During the measurement process, several images are extracted, and the average value is calculated to improve the accuracy of the results and avoid randomness.

2.2. High-Throughput Sequencing (HTS) and Filamentous Bacteria Database

HTS technology has been used to analyze detailed information on microbial community structures such as seawater, soil, human hand surfaces, remote human intestines and activated sludge. The unprecedented sequencing depth has shown overwhelming advantages in analyzing complex bacterial communities [48,49,50,51,52,53,54]. Especially with a detection limit of about 0.01%, the benefit of analyzing sub-dominant groups with abundance ranging from 0.01% to 1% is significant. When identifying filamentous bacteria, the 16S ribosomal RNA (16S rRNA) gene was amplified using universal primers for archaea or bacterial primers, and the amplified product was sequenced on the Illumina Miseq platform. The commonly used primers and amplification conditions are shown in

Table 1. Primer sequences and amplification conditions are commonly used in high-throughput sequencing.

No.	Type	Primer Name and Sequence (5′-3′)	Amplification Conditions	Reference
1	Bacteria	27F (5′-AGAGTTTGATCCTGGCTCAG-3′) 534R (5′-ATTACCGCGGCTGCTGG-3′)	95 °C 2 min; (95 °C 20 s, 56 °C 30 s, 72 °C 60 s) × 30; 72 °C 5 min	[55]
2	Bacteria	563f (AYTGGGYDTAAAGNG) r1 (TACCRGGGTHTCTAATCC) r2 (CAGAGTATCTAATTC) r3 (CTACDSRGGTMTC TAATC) r4 (TACNVGGGTATCTAATC)	98 °C 2 min; (98 °C 15 s, 56 °C 20 s, 68 °C 30 s) × 28; 68 °C 10 min	[56]
3	Bacteria	338f (ACTCCTACGGGAGGCAGCA) 806r (GGACTACHVGGGTWTCTAAT)	95 °C 3 min; (95 °C 30 s, 55 °C 30 s, 72 °C 45 s) × 27; 72 °C 10 min	[57]
4	Bacteria	968F (AACGCGAAGAACCTTAC) 1401r (CGGTGTGTACAAGACCC)	95 °C 5 min; (95 °C 30 s, 63 °C 45 s, 72 °C 1 min) × 35; 72 °C 5 min	[58]
5	Universal primers	341f (CCTACGGGNGGCWGCAGG) 785r (GACTACHVGGGTATCOTTCC)	95 °C 5 min; (95 °C 40 s, 55 °C 120 s, 72 °C 60 s) × 25; 72 °C 7 min	[40]
6	Universal primers	341f (CCTACGGGNGGCWGCAGG) 534R (ATTACCGCGGCTGCTGG)	94 °C 5 min; (94 °C 30 s, 55 °C 30 s, 72 °C 30 s) × 30; 72 °C 10 min	[59]
7	Universal primers	27f (AGA GTT TGA TCC TGG CTC AG) 1492r (TACGGYTACCTTGTTACGACTT)	95 °C 10 min; (95 °C 60 s, 55 °C 60 s, 72 °C 90 s) × 35; 72 °C 10 min	[60]
8	Actinomycetes	243f (GGATGAGCCCGCGGCCTA) 513r (CGGCCGCGGCTGCTGGCACGTA)	95 °C 5 min; (95 °C 30 s, 63 °C 45 s, 72 °C 1 min) × 35; 72 °C 5 min	[61]

.

Based on the amplification of the 16S rRNA gene and high-throughput sequencing results, a summary of 94 important filamentous bacteria belonging to 42 genera and six phyla that are widely present in sewage treatment plants and can be retrieved from the NCBI database [43,44,45] has been presented. Figure 1 shows the systematic development of important filamentous bacteria and the retrieval sequence of representative bacterial species. The filamentous bacteria and their related sequences are shown in Figure 1. When retrieving annotations, the e-value is set to 1 × 10⁻⁶⁰, and the minimum similarity between the reference and query sequences is about 87%. For each annotated sequence, only list the closest reference sequence and filter the results: (1) remove results with similarity less than 95% (if identified by FISH probe, set to 90%); (2) delete pyrotags with more than two bases uncovered (i.e., 200 bp pyrotags with query coverage less than 99%) [62,63]. The abundance calculation formula is as follows (Formula (1)):

$$\mathrm{Filamentous} \mathrm{bacteria} \mathrm{abundance}={\displaystyle \frac{N}{N_T}}\times 100\%$$

(1)

Note the following:

• N—the number of annotated filamentous bacterial sequences under different truncation values (100%, 99%, 97%, etc.);
• N_T—total number of sample sequences.

In addition, to annotate and identify filamentous bacteria in activated sludge, Feng Guo et al. summarized literature reports and selected filamentous bacteria reference sequences from the NCBI database to establish a 16S rRNA gene database containing 22 strains of expansive bacteria and 5 strains of foaming bacteria [62]. In 2020, Bing Bing Li et al. updated it [63], an update which is currently widely used.

3. Total Abundance and Population Structure of Filamentous Bacteria in Activated Sludge

3.1. Filamentous Bacteria in Typical Activated Sludge

Filamentous bacteria are natural members of the activated sludge microbial community, and their total abundance value is closely related to sludge settling performance, making them the leading indicator of the filamentous bacterial community. According to research results for synchronous nitrogen and phosphorus removal wastewater treatment plants, the total abundance range of filamentous bacteria in activated sludge with average settling performance (sludge volume index (SVI) value is less than 120 mL/g) is 1–9%, and the spatial and geographical distribution pattern is not apparent, with little correlation with latitude location, human social activities, etc. [11,43,50,51,56,62,63].

In the activated sludge system, filamentous mycelium act as a “skeleton”. Other functional microorganisms, such as common heterotrophic bacteria, phosphorus-accumulating bacteria, ammonia-oxidizing bacteria, nitrite-oxidizing bacteria, denitrifying bacteria, etc., attach to them, forming bacterial micelle together with extracellular polymers, and finally become activated sludge floc. The sludge structure with normal sedimentation performance is shown in Figure 2. More than 50 species of filamentous bacteria have been detected in most normal or bulked activated sludge. Still, there are significant differences in their species and abundance among different sewage treatment plants. The detection frequency of Mycobacterium fortuitum in the phylum Actinobacteria is 100%, and the detection frequencies and abundances of M. parvicella, Nostocoida limicola II, and Gordonia are also high. Gordonia is a typical foaming bacterium with higher detection rates and abundance in foam than activated sludge. The detection frequency of thick-walled bacteria Nostocoida limicola I and Bacteroidetes type 1863 is also relatively high. According to the HTS measurement results, the abundance of Chloroflexi is low in the typical structure of activated sludge, but it is widely present. However, FISH detection results indicate that Chloroflexi is a filamentous species with high frequency and abundance [50,51,62,63].

3.2. Filamentous Bacteria in Expanded Sludge

In the same sewage treatment plant, the composition of the filamentous bacteria community in bulked sludge is the same as that in non-bulked sludge. Still, the abundance of individual filamentous bacteria varies significantly, often leading to sludge bulking. Figure 3 shows the growth of dominant filamentous bacteria in the decline stage of sludge settling performance when the operating environment, especially the sewage water temperature, of the same sewage treatment system changes [64].

In Denmark, the distribution range of SVI detected in the sewage treatment plant was 62–192 mL/g, with an average of 107 mL/g. Among them, 25% of the systems have SVI values greater than 120 mL/g; FISH technology testing found that the most abundant bacterial genus in activated sludge was the Actinobacteria M. parvicella, with a detection rate of 100% in all sludge samples and an average abundance of 6% (expressed as a percentage of EUBmix), far exceeding that of normal activated sludge. Secondly, Tetrasperera and Gordonia, both belonging to the phylum Actinobacteria, had a high detection frequency and abundance, making them the dominant filamentous bacteria in the expanded sludge of most wastewater treatment plants. In addition to Actinomycetes, the detection frequency of Chloroflexi bacteria was also relatively high [44]. FISH technology was used to identify filamentous bacteria in the bulking sludge of Polish sewage plants (The range of SVI values for all tested sludge samples was 66–389 mL/g.) It was found that the dominant species was Chloroflexi bacteria, with an average abundance of 14% (expressed as a percentage of EUBmix), among which 0803 and 1851 had the highest abundance. The most abundant genus of bacteria is M. parvicella, which accounts for 1.8–15% of the total abundance [65]. Similar results were obtained in the study by Beer and Kong et al., with 1 to 25 per cent and 8 to 30 per cent of the wastewater plants surveyed, respectively [66,67]. The urban sewage treatment plants operating under long mud age and low load conditions in South Africa have M. parvicella, type 0092, type 0675, type 0041, and type 1851 as dominant bacterial genera. The dominant filamentous bacteria in sewage treatment plants operating at low dissolved oxygen levels in the United States were type 1701, type 021N, type 1863, and planktonic bacteria. When operating at low organic loads, they are type 0041, type 0092, and M. parvicella. The main types of filamentous bacteria that cause sludge bulking in Europe are M. parvicella and type 021N bacteria, followed by type 1701 bacteria, type 0803 bacteria, Streptococcus, Sphaerotilus (Sphaerotilus) and Candidatus ‘Nostocoida limicola’ (Tetrasperera jenkinsii and Tetrasperera velonensis) [68]. The high-throughput sequencing results of the nutrient removal system activated sludge by Kang Hong et al. showed that Saprospira and M. parvicella were the dominant bacterial genera during the sludge bulking stage, with relative abundances of 13.58% and 12.55%, respectively, followed by Flavobacterium and Tetrasphaera, for which the relative abundances were 1.19% and 1.51% [69], respectively. The sequencing results of Gao Chundi et al. also found that the relative abundance of M. parvicella increased from 2% to 8% before and after sludge expansion, making it the bacterial genus with the highest growth [10]. The remaining filamentous bacteria were only detected in a small percentage of sludge samples. Still, they remained sporadically distributed with relatively low abundance and had no significant impact on the structure and properties of flocs [10,51,70,71,72,73,74].

In addition, FISH testing showed that the structure of the filamentous bacteria community of bulked sludge in sewage plants in European countries was similar, which may be due to their geographical proximity. However, the HTS measurement results showed that the community structure of filamentous bacteria in expanded sludge did not have obvious spatial geographic patterns [75,76].

4. Physiological and Ecological Analysis of Core Filamentous Bacteria

Filamentous bacteria are one of the main microbial communities in sewage treatment plants, with a high detection frequency and dominant abundance. The filamentous bacteria that have a structural effect on activated sludge are defined as core filamentous bacteria, regardless of whether the sludge expands or not. Relatively few filamentous bacteria make up the vast majority of the core filamentous bacteria in all systems: M. parvicella, type 0092, type 0041/0675, Candidatus ‘Nostocoida limicola’ (Tetrasperera jenkinsii and Tetrasperera veronensis), type 0803, type 1851, Gordonia spp., Mycobactrium fortuitoum and others. The physiological and ecological characteristics of core filamentous bacteria are shown in

Table 2. Physiological and ecological analysis of core filamentous bacteria.

Filamentous Bacteria	Use of Acceptors	Storage Compounds	Carbon Source	Optimal Growth Temperature	Grows Rate	Characteristic
M. parvicella	O2, NO3−, NO2−, anaerobic	PHA	Acetate, glucose and long-chain fatty acids	12–15 °C	0.3~0.5 d−1	Bulking
Candidatus ‘Nostocoida limicola’	O2, NO3−, NO2−	PHA, Poly P	Hydrophilic and hydrophobic substrates, including LCFA	15−37 °C	Not reported	Bulking and foaming
Gordonia	O2, NO3−, NO2−	PHA, Poly P	Phthalates, hydrocarbons	20−37 °C	Not reported	Foaming
Mycobactrium fortuitoum	O2, NO3−, NO2−, anaerobic	PHA	Organic matter	15−37 °C	grows slowly	“Skeleton”
Chloroflexi	O2	PHA	Proteins, polysaccharides and dead cell debris	15−37 °C	Not reported	Bulking
type 0041/0675	O2, NO3−, NO2−	PHA	Acetate, glucose	15−37 °C	Not reported	Bulking

.

M. parvicella is a common key bacterium that causes sludge bulking in activated sludge systems, mainly distributed in soil, water environments, etc. In situ observation, laboratory validation and genomic identification results indicate carbon sources such as acetate, glucose and long-chain fatty acids (LCFAs) can maintain their growth and preferentially absorb LCFAs, the main carbon and energy sources [77]. The nitrogen source of M. parvicella is ammonia, and high concentrations of free ammonia can also promote growth [78]. Microradiometric autoradiography (MAR) analysis showed that M. parvicella could maintain activity within an extensive range of oxygen partial pressures. It grows well under aerobic and microaerophilic conditions but at a slower rate of 0.3–0.5 d⁻¹. The absolute abundance of genes is negatively correlated with sludge load and positively correlated with sludge age [79,80]. Under anaerobic conditions, there is no growth, but it can absorb carbon sources [81]. Under low dissolved oxygen (DO) conditions, the microaerophilic properties and high specific surface area of M. parvicella make it easier to absorb limited oxygen and more competitive. The surface of M. parvicella a is hydrophobic, and the optimal growth temperature is 12−15 °C [82,83]. It is easy for it float on the surface of the biochemical pool in the form of foam. In winter, the solubility of LCFAs and other oil substances also decreases, and they also gather on the water surface, and the two are in full contact. Therefore, when the sewage treatment plant operates under low temperature, low DO and low load conditions, it is most suitable for the growth and reproduction of M. parvicella.

Candidatus “Nostocoida. limicola” (Tetrasperera jenkinsii and Tetrasperera. voronensis), a member of the Actinobacteria species, has been proven to belong to the Tetrasperera (T bacteria) genus in the Intrasporangiaceae, widely distributed in soil and water environments. The probability of existing in activated sludge is high, leading to swelling and foaming problems. This bacterium has a wide range of substrate assimilation characteristics and can utilize hydrophilic and hydrophobic substrates, including LCFA. However, it is currently unclear whether LCFA is used for growth, transformation and storage. It can also survive under anaerobic conditions using oxygen or nitrate nitrogen as electron acceptors. Nostocoida limicola II Tetrasphaera can store PHAs, and there is evidence to suggest that this bacterium has a considerable ability to store polyphosphate, belonging to polyphosphate-accumulating bacteria. However, the mechanism of synthesizing storage substances is still unclear [84,85,86].

The genera Gordonia and Mycobacteria are commonly present in the species Actinobacteria. Gordonia abundance varies significantly over time and has strong specificity. It is a rare actinomycete with aerobic demand, and 41 effective species have been isolated from habitats such as soil, animal feces, wastewater, compost and human infection sites. This mycobacterium is a common foaming bacterium which can produce glycolipids, glycosylated peptide lipids, and polysaccharide surfactants. Gordonia can biodesulfurize and biodegrade compounds such as phthalates, hydrocarbons, rubber, nitriles, etc., playing an essential role in environmental remediation [87,88]. The detection frequency of Mycobacterium isolated from soil, sewage and normal human oral and sputum in activated sludge is 100%. Still, regardless of swelling, the abundance of Mycobacterium in activated sludge from the same sewage treatment plant does not change much [50,51,63]. This bacterium is a non-sporous, non-motile, branched and acid-resistant Gram-positive bacterium. Its cell size is (0.2–0.8) μm × (1–10) μm; it is aerobic and grows slowly. According to the research results, it can be confirmed that the genus Mycobacterium is the “skeleton” of activated sludge, playing a structural role and rarely causing sludge swelling.

The phylum Chloroflexi often dominates alongside the phylum Actinobacteria because these two bacteria utilize different substrates; the former absorbs lipids, while the latter utilizes proteins, polysaccharides and dead cell debris, with no competition for energy sources, and occupies different ecological niches [65]. The influence of Chloroflexi on the floc structure of sludge is species-dependent, with some bacteria serving as “skeletons” and other microorganisms adhering to them, forming strong and dense flocs that hide inside the flocs and do not cause expansion. However, other forms are located at the edge of the sludge flocs and protrude into the sewage, which has a negative impact on the settling performance of the sludge. The surface of Chloroflexi is more hydrophilic than many other filamentous bacteria in activated sludge and can accept oxygen or nitrogen with nitrate as an electron acceptor. Degradation of glucose and mixed amino acids can also be observed under strict anaerobic conditions [89]. The common group of Chloroflexi bacteria, 0803 type, mainly exists within flocs. Still, sometimes clusters may also appear, resulting in open floc structures and deteriorating sedimentation performance, especially in winter, which is one of the main reasons for the decline in sludge sedimentation performance [90]. Types 0092 and 1851 are common in nutrient removal systems [44,89]. The abundance of Chloroflexi (including both populations defined by specific probes and unidentified species) is highest in summer and autumn, exhibiting a pattern opposite to that of M. parvicella.

The 0041/0675 population of Proteobacteria is also one of the core filamentous bacteria with a high detection frequency. Under aerobic conditions, it can absorb various monosaccharides and leucine, with some populations consuming galactose and a few assimilating glycine. Under anaerobic conditions with nitrate as the electron acceptor, glucose and galactose absorption levels are comparable to aerobic conditions, and glucose can also be utilized under strict anaerobic conditions. However, it is currently uncertain whether this strain is a fermenting organism. In addition, the abundance of these two filamentous bacteria varies seasonally, with the highest levels in summer and autumn [91,92].

5. Conclusions

Researchers have extensively researched the identification, population structure and physiological ecology of filamentous bacteria in activated sludge. However, there is still a lack of essential information for a comprehensive understanding of the activated sludge ecosystem and filamentous bacterial functions. Firstly, in terms of identifying filamentous bacteria, high-throughput sequencing primers and depth, filamentous bacteria databases, etc., need to be continuously improved, supplemented and updated to identify more filamentous bacteria. FISH probes also need to be continuously designed and combined with in situ detection techniques such as microradiography. Secondly, more comprehensive and systematic experiments should be conducted. If possible, reliable quantitative analyses of core filamentous bacteria should be undertaken to determine ecological factors that control individual population density and clarify the reasons for the excessive growth of filamentous bacteria. Finally, deep sequencing and analysis of 16S rRNA gene sequences attempt to address the distribution patterns and potential sources of filamentous bacterial community diversity, the driving factors behind filamentous bacterial community composition and whether there exists a latitudinal diversity gradient in filamentous bacteria. Understanding the global diversity and biogeographical mechanisms of activated sludge bacterial communities within the framework of theoretical ecology is of great significance for microbial ecology and wastewater treatment processes.