Next Article in Journal
Multiapproach Design Methodology of a Downscaled Wet Scrubber to Study the Collection of Submicronic Particles from Waste Incineration Flue Gas
Previous Article in Journal
Permeability Upscaling Conversion Based on Reservoir Classification
Previous Article in Special Issue
Isolation and Characterization of Bacillus Subtilis BSP1 from Soil: Antimicrobial Activity and Optimization of Fermentation Conditions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Processes
Volume 12
Issue 8
10.3390/pr12081654
processes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii

by
Asadullah Khan
1,2,
Zuo Jihong
1,
Haolin Luo
1,
Ali Raza
1,2,
Quaid Hussain
1,2 and
Zhangli Hu
1,3,*
1
Guangdong Technology Research Center for Marine Algal Bioengineering, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518055, China
2
Key Laboratory of Optoelectronic Devices and Systems of Ministry of Education and Guangdong Province, College of Optoelectronic Engineering, Shenzhen University, Shenzhen 518060, China
3
Shenzhen Engineering Laboratory for Marine Algal Biotechnology, Longhua Innovation Institute for Biotechnology, Shenzhen University, Shenzhen 518055, China
*
Author to whom correspondence should be addressed.
Processes 2024, 12(8), 1654; https://doi.org/10.3390/pr12081654
Submission received: 22 June 2024 / Revised: 2 August 2024 / Accepted: 5 August 2024 / Published: 7 August 2024
(This article belongs to the Special Issue Advances in Chemical Characterization, Pharmacological Applications and Synthetic Biology of Natural Products)
Browse Figures
Versions Notes

Abstract

:
Using Chlamydomonas as a model organism, we attempted to eliminate mitochondrial DNA (mtDNA) similar to rho0 or rho− cells (completely or partially mtDNA-eliminated cells) in yeast. We successfully generated partially mtDNA-eliminated cells named as crm- cells, causing the inactivation of mitochondrial activity. We used three different chemicals to eliminate mtDNA including acriflavine (AF), ethidium bromide (EB) and dideoxycytidine (ddC) which prevents replication, inhibits POLG (DNA polymerase gamma) and terminates the mtDNA chain, respectively. The qPCR method was used to detect the mtDNA copy number and the selected rrnL6 gene for the detection of mitochondria, as well as the selected Chlamydomonas CC-124 strain. A reduction in the mitochondrial copy number led to a higher expression of AOX1, UCP1, PGRL1 and ICL1, which indicates the disturbance of the mitochondria–chloroplast ATP and NADPH balance. We selected AOX genes to further study this family and carried out a genome-wide search to identify AOX genes in green algae (C. reinhardtii). Our results revealed that C. reinhardtii contains four AOX genes, i.e., CrAOX1, CrAOX2, CrAOX3 and CrAOX4, which are distributed on Chr 3, Chr7 and Chr9. All CrAOX genes were predicted to localize in mitochondria using bioinformatics tools. Phylogenetic analysis suggests that these CrAOXs are subdivided into four groups and genes existing in the same group could perform identical functions. Collinearity analysis describes the strong evolutionary relationships of AOXs between the unicellular green algae Chlamydomonas reinhardtii and the multicellular green algae Volvox carteri. GO (gene ontology) annotation analysis predicted that CrAOXs played an integral part in carrying out alternate oxidative and respirative activities. Three putative miRNAs, cre-miR1162-3p, cre-miR1171 and cre-miR914, targeting the CrAOX2 gene were identified. Our studies have laid a foundation for the further use of partially mtDNA-eliminated cells and elucidating the functional characteristics of the AOX gene family.

1. Introduction

Chlamydomonas is a unicellular green alga classified under Chlorophyceae and which can be recognized by its single cup-shaped chloroplast and two long cilia. Within Chlamydomonas, four distinct metabolic compartments exist, each enclosed by at least one membrane: chloroplast, cytosol, peroxisome and mitochondria [1]. This metabolic versatility of Chlamydomonas facilitates the examination of the separate roles of photosynthesis and respiration. The 15.8 kb genome of Chlamydomonas mt is characterized by a low gene content, very short intergenic sequences, the absence of introns, and an average GC content of 45% [2]. It has seven genes that either function as components of oxidative phosphorylation complexes or part of the mitochondrial translation machinery.
Many studies in plants and algae use inhibitors to disturb mETC such as rotenone, a Complex I inhibitor; malonate, a Complex II (succinate dehydrogenase) inhibitor; antimycin A (AA) and myxothiazol (MYXO) which inhibit Complex III; the Complex V inhibitor oligomycin (OLIGO); and MFA (monofluoroacetate), a TCA cycle inhibitor that acts on aconitase [3,4]. Changes in the copy numbers of mitochondrial genes were observed during melon leaf development. But less attention is given to studying the effect of the elimination of the mitochondrial genome contrary to human or yeast studies. In humans, altered mtDNA copy number regulation can result in diseases such as infantile neurogenetic disorders [5], liver disease [6], renal cell carcinoma [7], sclerosis [8], biliary atresia [9] and breast cancer [10]. In addition to humans, it is also detected in yeast that a loss of mtDNA copies in yeast leads to an increase in nuclear genomic instability, retarded growth and cell unviability. This in turn leads to a reduction in mitochondrial protein import and a lack of function in non-respiratory mitochondrial processes [4]. Similarly, AF chemicals were previously used to eliminate mtDNA from green algae, but probes were used to detect specific elimination which is a technically unsatisfactory method since the copy number was not observed [11].
Two pathways operate in mitochondria for the transfer of electrons from the ubiquinone pool to oxygen: the alternate oxidase (AOX) pathway and the cytochrome (cyt) pathway, which is comprised of Complex III and cyt c as well as cyt oxidase [12,13]. When AOX is compared to the cyt pathway, the electron flow from the ubiquinone pool is not linked to proton translocation, which lowers the ATP yield associated with electron consumption. AOX is reported to be necessary in order to maintain the energy balance of photosynthesis and prevent ROS damage when it is under drought stress in tobacco [14]. Studies suggest that Arabidopsis mutants lacking AOX exhibit disturbances in photosynthesis, especially in response to changes to higher irradiance [15]. The loss of NADH-oxidizing capacity is considered to be the cause of the increase in AOX quantity observed across all plant species, where it is associated with Complex I of the mitochondrial electron transport chain mutation [16]. Adjustment of the production proportion of ATP to NADPH is important, and this is exploited by the CB cycle for the assimilation of CO2 and photorespiration in chloroplasts. NADPH is balanced by the malate valve, Mehler reaction, PTOX and CET pathways of electron flow in chloroplasts [17], while ATP is adjusted by AOX and UCP in mitochondria which also help to balance ATP and NADPH for the CB cycle in chloroplast [18]. Clearly, these studies have established the significance of AOX in improving photosynthetic efficiency.
In this study, we attempted to eliminate the mitochondrial genome in C. reinhardtii to develop crm0 cells with the aid of chemicals used before in humans and yeast. Acriflavine (AF), ethidium bromide (EB) and ddC, alone and in different combinations, were used to treat C. reinhardtii in light conditions. Variations in strain, chemicals, time and genes to determine copy number were used to optimize the conditions in order to obtain the minimum copy numbers of mt DNA in an effort to create cells without mtDNA. We tried to eliminate mtDNA and optimized the conditions in C. reinhardtii, since this has been established in humans and yeast before but not in plants and algae. We suggest the complete elimination of mtDNA with repetitive weekly treatment of AF until the obtainment of cells without mtDNA, but at this stage we only obtained crm− cells (partially eliminated mtDNA). Additionally, we also carried out a genome-wide analysis of the AOX family gene in C. reinhardtii and identified four AOX genes across Chlamydomonas and revealed their chromosomal locations and gene structures. We analyzed the evolution of the AOX gene family in Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At). In addition, conserved motifs, miRNAs targets, GO annotation and expression studies under AF treatment in C. reinhardtii were conducted.

2. Materials and Methods

2.1. Microalgae Strains and Growth Conditions

The Chlamydomonas untreated strains CC-124 and CC-5325 (CC-124 wild type mt- [137c] and CC-5325 cw15 mt- [Jonikas CMJ030-JR397]) were obtained from our laboratory algae bank. These two strains’ algal cultures were maintained in photobioreactors (PBRs). The normal growth conditions in PBRs were 25 °C, Tris-acetate-phosphate (TAP) medium, constant 100 µmol photons m−2s−1 light (50% red: 50% blue). After a few days, after the cells reached the stationary phase (about 5 × 106 cells/mL), they were diluted to 3 × 105 cells/mL in several flasks filled with new TAP media (300 mL) containing either AF (5, 7 µg/mL), EB (2, 6 µg/mL), a mixture of AF (5 µg/mL) and EB (4 µg/mL) or a mixture of ddC (150, 200) mM and EB (1.5, 2 µg/mL) and incubated autotrophically for up to 9 days, and samples were taken after 5, 7 and 9 days.

2.2. Identification of the AOX Gene Family in C. reinhardtii

C. reinhardtii protein data at the whole-genome level were retrieved from the Phytozome database (http://phytozome.jgi.doe.gov/pz/portal.html, accessed on 15 December 2023). The Arabidopsis genome database from the website (https://www.arabidopsis.org/, accessed on 15 December 2023) provided the protein sequences of the AOX family of Arabidopsis (Arabidopsis thaliana), which were taken as query sequences to be aligned with C. reinhardtii protein files. Next, the Pfam ID of AOX (PF01786) [17,19] was obtained by exploring the Pfam website (http://pfam.janelia.org/; accessed on 15 December 2023). On the Pfam website, the AOX.hmm file was downloaded, including the conserved domain information of the AOX family. Protein sequences of C. reinhardtii, AOX.hmm and the Pfam ID of AOX (PF01786) were used in a simple HMM search of TBtools to extract proteins with an AOX domain, which resulted in 9 proteins detected with an AOX domain. Firstly, the information was screened with the parameter of an e-value ≤ 1 × 10−5, then we manually removed the repetitive sequences. The prediction of the AOX structure domain was performed within the amino acid sequence of the selected candidate AOX protein family member in C. reinhardtii by using the Conserved Domain Database (CDD, http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi; accessed on 15 December 2023) from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/, accessed on 15 December 2023). The candidate genes without the AOX structure domain were removed. As a result, 4 candidate CrAOX genes were identified in C. reinhardtii.
The physicochemical properties of the AOX protein of C. reinhardtii including the molecular weight, protein length, instability index, theoretical pI and hydrophilicity of AOX genes were extracted using the online web tool ExPASY-Prot (https://web.expasy.org/protparam/; accessed on 15 December 2023) [20]. In the protein sequences of the four AOX proteins, the default settings of the online application MEME v5.4.1, (https://meme-suite.org/meme/tools/glam2scan; accessed on 15 December 2023) were to extract conserved regions [21].

2.3. Chromosomal Distribution, AOX Gene Structure and Subcellular Localization

The genomic positions as well as protein sequences of all the AOX genes of C. reinhardtii were retrieved by exploring an online database, namely Phytozome (http://phytozome.jgi.doe.gov/pz/portal.html accessed on 15 December 2023). We judged the location of AOX genes throughout the chromosomes by using an online tool named as MapGene2 Chromosome (http://mg2c.iask.in/mg2c_v2.1/index.html; accessed on 15 December 2023) and discovered how the AOX genes were positioned on the chromosomes of C. reinhardtii.
The AOX gene structure diagram was built by using an online web tool named GSDS 2.0 software (http://gsds.cbi.pku.edu.cn; accessed on 15 December 2023), followed by quantitative analysis of introns and exons.
We utilized CELLO v2.5 (http://cello.life.nctu.edu.tw/; accessed on 15 December 2023) for prediction of the subcellular localization of the CrAOX family of genes.

2.4. Phylogenetic and Collinearity Analysis

The protein sequences of AOX genes from Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At) were used to carry out phylogenetic analysis, and the evolutionary relation of the C. reinhardtii AOX gene family to other species was displayed. ClustalW 2.0 software was used to conduct multiple alignments of AOX protein sequences and the phylogenetic tree was built with MEGA 7.0 software [22] using the neighbor-joining (NJ) method with 1000 bootstrap repetitions. The online website iTOL tool (https://itol.embl.de/login.cgi, accessed on 15 December 2023) [23] was used to perceive the phylogenetic tree and further divide it into different groups.
Comparative collinearity analysis to find the evolutionary relationships and conservation among Chlamydomonas reinhardtii, Coccomyxa subellipsoidea, Volvox carteri, Physcomitrella patens and Arabidopsis thaliana AOX proteins was conducted by using an online tool named the synteny viewer circoletto tool (https://tools.bat.infspire.org/circoletto/; accessed on 15 December 2023) using its default parameters [24].

2.5. Visualization of CrmiRNAs’ Predicted Cleavage Sites and GO Enrichment Analysis

CrmiRNAs targeting CrAOXs were identified using the online website tool psRNATarget (https://www.zhaolab.org/psRNATarget/; accessed on 15 December 2023) [25]. Gene structures were designed using an offline tool named TBtools where yellow triangles depict the CrmiRNA probable targeted sites in the exons of CrAOX genes. An online tool named ShinyGO 0.80 (http://bioinformatics.sdstate.edu/go/; accessed on 15 December 2023) [26] was used to carry out GO enrichment analysis of the CrAOX genes and visually draw the chart to make it clear.

2.6. Extraction and Purification of RNA and RNA Reverse Transcription

RNA was extracted using a TIANAMP Genomic RNA Extraction Kit (Tiangen Biotech, Beijing, China), according to the manufacturer’s instructions. The concentration and quality of DNA and RNA were detected by a NanoDrop2000 Ultra Microscope Photometer (Thermo, Waltham, MA, USA). Total RNA was used as a template to synthesize cDNA by the Quantscript RT Kit (TIANGEN), and synthesized cDNA was stored at −20 °C for subsequent experiments.

2.7. Real-Time Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)

cDNA obtained in the last step was used in real-time PCR analyses using the Advanced Universal SYBR Green Supermix (Bio-Rad Laboratories Inc., Hercules, CA, USA) following the manufacturer’s instructions in order to determine the mRNA levels. The PCR primer sets used including the housekeeping gene tubulin are shown in Table 1 and were designed from the published database, BLAST. Comparative gene expression analysis using qRT-PCR was performed according to previously described methods.

2.8. Analysis of Mitochondrial DNA (mtDNA) Copy Number

Genomic DNA extraction was performed by using a Genomic DNA Kit (Transgen, Beijing, China, EE101). Sample quality was assessed through a device named the NanoDrop2000 Ultra Microscope Photometer to set a unified concentration of 50 ng/μL, in order to perform qPCR. The detailed method for the analysis of the mtDNA copy number has been described previously [27]. Briefly, we calculated the number of copies of mtDNA using the following formula: ΔCt = Ct (nDNA gene) − Ct (mtDNA gene). Finally, we obtained the number of copies of mtDNA = 2 × 2ΔCt. Here, we use the rrnL6, nad5 and cox1 genes from mitochondria and CLPD24 for cell nuclear DNA, as these genes correspond to stable fractions of algae that are less prone to deletion, to evaluate the relative copy number of mtDNA and nDNA.

2.9. Statistical Analysis

Statistical analysis was performed by conducting t-tests (* p < 0.05, ** p < 0.01). Results are reported as the mean values ± SD.

3. Results

3.1. Screening of Inhibiting Dyes and Time Duration to Eliminate mtDNA

In order to achieve cells without mt DNA, we depleted mtDNA by using chemicals, including the treatment of cells with ethidium bromide (EB), dideoxydidehydrocytidine(ddC) and acraflavine (AF). These chemicals have different mechanisms of action such as intercalation and preventing replication, the inhibition of POLG and terminating the mtDNA chain [11]. We used a qPCR method to detect the mtDNA copy number to check the effect of these chemicals on the mitochondrial genome [27]. Our results showed that each chemical showed a significant reduction in mtDNA copy number but we choose 7-AF for further experiments since it had less effect on nuclear chloroplast mutation (Figure 1A). In addition to this, we also checked the most effective time of AF on mtDNA and found that after 7 days the effect of AF started to reduce and the mtDNA copy number slightly increased 9 days after treatment (Figure 1B). Thus, we recommended 7 days treatment with 7-AF to obtain the minimum copies.

3.2. Selection of Gene and Strain to Minimize the mtDNA Contents

We used three different genes, nad5, cox1 and rrnL6, to check whether there is any impact of mitochondrial genes on the copy number as observed before in the expression level of the four mitochondrial genes which were notably different in melon [28], but we could not find a significant difference among the mt genes and the selected rrnL6 gene since it shows the least copy number (Figure 2A). It is reported that CC-5325 is often reported as cell-wall deficient and appears to have a reduced thickness [29]. We tried to determine whether AF causes the removal of mtDNA in CC-124 cells to a different extent than in CC-5325 cells, but we could not find significant difference among them in the mtDNA copy number. However, we selected CC-124 since it showed a slightly lower mtDNA copy number as compared to CC-5325 (Figure 2B).

3.3. Effect of mtDNA Elimination on Genes Reported for mETC Inhibition

Mitochondria play important role in cell viability and are capable of informing the cellular nucleus about their functional condition via retrograde signaling, thereby disturbing gene expression. We checked the expression of previously reported genes which are described to be disrupted with the inhibition of mETC or cETC. Our results showed that mitochondria-localized nuclear genes such as AMC1 and MOC1 were significantly downregulated while AOX1, UCP1 and ICL1 were significantly upregulated. We also observed that the chloroplast-localized nuclear gene PGRL1 was highly upregulated and PTOX1 was significantly downregulated (Figure 3). This showed that AF affected mitochondria- as well as chloroplast-localized genes similar to AA [30]. Since AOX is highly upregulated in AF-treated cells, we decided to explore the AOX gene family and further check the mtDNA elimination effect on the AOX gene family.

3.4. Identification and Characterization of CrAOX Genes

In order to perform the identification of the AOX family members of C. reinhardtii, AOX protein sequences of A. thaliana was used for analyzing the genome database of C. reinhardtii. In total, seven CrAOX candidate genes were discovered, while four of these genes consisting of expected AOX conserved domains were ultimately kept. The C. reinhardtii genome consist of four AOX genes in total, which are quite similar to the AOXs previously reported in plant species like Moso bamboo (Phyllostachys edulis), wheat (Triticum aestivum) and tea plant (Camellia sinensis).
The four CrAOXs genes exhibited somewhat similar biochemical properties (Table 2). The sequences of these proteins varied from 289 to 337aa, and the molecular weights (MW) varied from 37.4 to 53.8 kDa. The protein CrAOX2 depicted the highest isoelectric point (pI) value of 9.30, while CrAOX3 indicated the lowest pI value of 5.76, an instability index of 42.59 to 51.17 and a hydrophilicity range of −0.352 to 0.027.

3.5. Sequence Feature, Gene Structure Analysis and Chromosomal Location of CrAOX Genes

The gene expansion of the C. reinhardtii family was studied in order to examine the patterns of exons and introns of the CrAOX genes (Figure 4B). To further understand the structural features of CrAOX genes, the structures of exon–intron sequences and conserved motifs (Figure 4C) were observed. The number of CrAOX introns and exons ranged from 7 to 12 and 8 to 13, respectively (Figure 4B). The CrAOX gene family has a wide range of gene architectures, with most CrAOX3 genes consisting of 12 introns; however, CrAOX1 gene family members, like CrAOX1, contain 7 introns. The highest number of introns and exons observed in CrAOX3 was 12 and 13, respectively. These results suggested that evolutionary relationships of gene structures that are highly similar which are shared by a group of CrAOX individuals. Thus, varied organization of exon–intron sequences could be part of the evolutionary divergence among the different members of the same gene family. The chromosomal positions of the AOX genes in C. reinhardtii were identified using the MapChart web service to map the genomic chromosomal position of these genes to the appropriate chromosomes. The four AOX genes, including CrAOX1, CrAOX2, CrAOX3 and CrAOX4, were found on chromosome 9 (Chr9), chromosome 3 (Chr3), chromosome 3 (Chr3) and chromosome 7 (Chr7) (Figure 4C), respectively.

3.6. Phylogenetics and Collinearity Analysis

To explore the evolutionary relationship among the orthologous AOX family members, a phylogenetic tree was constructed that consisted of genes from Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At). Based on the results, the 25 AOX genes were collected into four different color groups (Figure 5A). The four CrAOX genes were dispersed in all four groups. The two major red and gray color groups consisted of the higher number of AOX genes (eight), followed by the blue group which contributed five AOX genes, whereas the purple group contained four AOX genes. All the groups shared at least one CrAOX gene, which is an indication of the diversity and coevolution of CrAOX genes among different species after the partition of each lineage.
Collinearity analysis of AOX proteins was also carried out among Chlamydomonas reinhardtii (Cr), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At) species to identify significant micro synteny blocks between the species (Figure 5B). More than 60% identity was observed between CrAOX1 (VcAOX2), CrAOX2 (VcAOX2), CrAOX3 (VcAOX1) and CrAOX4 (VcAOX3). More than 40% identity was found between CrAOX1 (AtAOX2, AtAOX4, CsAOX2, MpAOX3, MpAOX3, VcAOX2, PpAOX2) and CrAOX2 (AtAOX2, AtAOX4, AtAOX6, PpAOX2, CsAOX2, VcAOX2, MpAOX3), followed by CrAOX3 (AtAOX1, PpAOX3, MpAOX3, PpAOX1, PpAOX4, MpAOX1, CsAOX1, VcAOX1, VcAOX3) and CrAOX4 (AtAOX1, CsAOX1, MpAOX1, VcAOX1, PpAOX1, PpAOX4). The findings indicated that the AOX genes participated in several orthologous gene matches, suggesting that these genes experienced divergence and duplication from a shared ancestor during the evolutionary period.

3.7. Gene Ontology (GO) Annotation Analysis and miRNAs Analysis

To further discover the role of CrAOXs, GO enrichment analysis (http://bioinformatics.sdstate.edu/go/, accessed on 15 December 2023) was performed on the online tool ShinyGO 0.80 to find the major GO categories, such as the biological process, cellular component, and molecular function, of CrAOXs. GO enrichment analysis predicted that CrAOX proteins are mainly involved in alternative respiration, alternative oxidase activity and oxidoreductase activity (Figure 6C). To better recognize the regulatory mechanism of miRNAs contributing to the regulation of CrAOX genes, three putative miRNAs pointing to the CrAOX2 gene were discovered. The results showed that cre-miR1162-3p, cre-miR1171 and cre-miR914 targeted only one gene, CrAOX2 (Figure 6A).

3.8. CrAOX Genes Expression Patterns under AF Treatment

The mitochondrial DNA copy number of CrAOX genes in C. reinhardtii after 7 days AF treatment and after 45 days without AF treatment were analyzed using qRT-PCR (Figure 7A). The transcript levels of CrAOX genes in C. reinhardtii after 7 days of AF treatment and after 45 days without AF treatment were analyzed using qRT-PCR. As shown in Figure 7B, CrAOX1 showed a higher gene expression while CrAOX2, CrAOX3 and CrAOX4 had a lower transcript level after 7 days of AF treatment. Once the treatment was removed after 7 days, expression was analyzed after 45 days and it was found that the expressions of all CrAOX genes were downregulated. These results indicate that the CrAOX genes adjusted their expression in order to control the ATP yield according to chloroplast requirements.

4. Discussion

Intercalating dyes such as AF, EB and ddC have been known to eliminate mtDNA in mammals and yeast to generate rho− and rho0 cells [4,31,32]. Mitochondria to nucleus communication has been studied extensively in yeast and mammalian cells by eliminating mtDNA. Inhibitors like rotenone, antimycin A, myxothiazol and oligomycin have been commonly used in plants to inhibit different complexes of the electron transport chain [33,34]. The plasticity of metabolic connections and signaling among mitochondria, chloroplasts and the nucleus have been studied in plants by inhibiting mtETC or cETC [3,30]. When it comes to Chlamydomonas reinhardtii, AF and EB have been used for the targeted removal of mitochondrial DNA in C. reinhardtii and studies have described the capability of these chemicals to insert minor colony mutations [11,32]. We used AF, EB and ddC to eliminate mtDNA copy numbers and found that all these chemicals significantly eliminate mtDNA but AF showed a higher reduction in copy number and we selected it for further screening. Worthy of introduction is the loss of mtDNA in wild-type CC-125 and CC-124 cells which were compared by using ethidium bromide and it was observed that CC-124 took more generations for the removal of mtDNA as detected thorough probes [11]. Contrary to this, our results showed that two frequently used Chlamydomonas strains, CC-5325 and CC-124, do not have significance differences since both are mt− cells but CC-124 shows a lower copy number of mtDNA after 7 days.
To report the relationship of mitochondria and chloroplasts, we compared the nuclear gene expression of potential MRR targets due to a reduction in mtDNA copy numbers. AOX was reported to be necessary in order to sustain the balance of photosynthetic energy and to prevent ROS damage. Adjustment of the production of ATP ratio to NADPH is important, as it is utilized for photorespiration and CO2 absorption by the CB cycle. ATP is adjusted by AOX and UCP in mitochondria which also helps to balance ATP and NADPH for the CB cycle. Our results showed a higher expression of AOX1 and UCP1 with a reduction in mtDNA copy number. NADPH is balanced by the malate valve, Mehler reaction, PTOX, CET and pathways of electron flow. The PGR5/PGRL1-dependent pathway is observed as the primary CET route. Plastid terminal oxidase (PTOX) is photoprotective, which associates PQ oxidation with the reduction of oxygen to water. Our results showed a higher expression of PGRL1, while there was a lower expression of PTOX1. Changes in the expressions of AOX1, UCP1, PGRL1 and PTOX1 predict that treatment with AF has disturbed the energy metabolism balance of chloroplast–mitochondrion interactions, which is why these genes have adjusted their expression to maintain the balance.
A genome-wide search was performed to discover a short gene family known as AOX, and four putative AOX genes in the green algae Chlamydomonas reinhardtii were found. By observing the results of the reported research, it was discovered that some of the plant species hold a small number of four to five AOX genes and there was no significant change observed among C. reinhardtii and the remaining reported species in plants, leading to the conclusion of the existence of small AOX gene families [35,36,37]. Our research results align with previous inquiries in this regard.
The genomic AOX sequence are mostly composed of four exons and three introns, with the splice site locations being very well preserved [38]. CrAOX genes recognized from C. reinhardtii consist of the distinctive gene structure of 12 exons and 11 introns (Figure 4B). Unlike AOXs in higher plants like Moso bamboo (Phyllostachys edulis), wheat (Triticum aestivum) and tea plant (Camellia sinensis) which has five exons and four introns [35,36,37], the chromosomal portion analysis exposed that four CrAOXs are dispersed on 3 chromosomes out of total 17 chromosomes in C. reinhardtii and chromosome 3 has the highest number of two CrAOXs. All of these four CrAOXs showed mitochondrial subcellular localization as found previously using a GFP-targeting assay; CsAOX proteins were localized in mitochondria [35]. These results show that irrespective of their position in the genome, CrAOXs have an independent subcellular localization. Our results indicate that AOXs are distributed unevenly, which could be a consequence of functional evolution.
The phylogenetic tree was built among Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At) proteins and divided into four groups as mentioned in [39] (Figure 1A). The work of [40] suggested that genes existing in the same group could exhibit the same functions. Furthermore, collinearity analysis describes the evolutionary relationships of AOXs among the unicellular green algae Chlamydomonas reinhardtii and the multicellular green algae Volvox carteri, the model liverwort Marchantia polymorpha, the model moss Physcomitrella patens and the model plant Arabidopsis thaliana. It presents a high level of resemblance between Chlamydomonas reinhardtii and Volvox carteri relative to Marchantia polymorpha, Physcomitrella patens and Arabidopsis thaliana since both are green algae. These results are aligned with previous research reported by [41], in which they also predicted a great number of orthologous genes between cotton G. raimondi and G. arboretum since they are closely related species as compared to Arabidopsis.
In our study, three putative miRNAs pointing to the CrAOX2 gene were found. cre-miR914 is reported as a possible target of RPL18 in Chlamydomonas and performs a vital part in heat shock adaptation [42]. The Chlamydomonas endogenous miRNA precursor cre-miR1162 was reported as a backbone to proficiently introduce miRNAs, resulting in a highly reduced accumulation of MAA7 and RBCS1/2 and the expected mutant phenotypes [19]. This miRNA technology could be an efficient tool to study reverse genetics in Chlamydomonas and could be utilized to explore the AOX gene family.
The GO annotation analysis for CrAOXs was full of GO terms relevant to alternative respiration, alternative oxidase activity and oxidoreductase activity (Figure 6B). Similar to these findings, the upregulation of AOX was reported to compensate for reduced ubiquinol oxidation capacity-induced inhibition of the AOX pathway by elevating the growth of Nicotiana tabacum throughout extended water deficiency [14]. As well, increased cellular respiration rates accompanied by higher AOX pathway-guided metabolic variation are noticed in the leaves of salinity-tolerant Medicago truncatula [12]. These results showed that the CrAOXs perform a vital part in carrying out alternate oxidative and respirative activities.

5. Conclusions

This is the first study to develop partially mtDNA-eliminated cells in Chlamydomonas using three different chemicals. In addition to the development of crm− cells, a comprehensive analysis of the gene structure, evolutionary relationships, conserved motifs, miR156–CrAOX connections and expression of the Chlamydomonas AOX gene family was performed. In this research, a total of four CrAOX genes were retrieved from the genomic analysis of Chlamydomonas. These 4 CrAOX genes, together with those of 25 genes from Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At), were aligned into four sub-groups, implying that on the basis of their motifs and structural identities, individuals of the same group could perform identical biological functions. Collinearity analysis describes the strong evolutionary relationships of AOXs between the unicellular green algae Chlamydomonas reinhardtii and the multicellular green algae Volvox carteri. In addition, the CrAOX2 gene had a targeted relationship with three miRNAs. GO annotation analysis for CrAOXs indicated that the CrAOXs played an integral part in carrying out alternative respiration, alternative oxidase activity and oxidoreductase activity. Our data as a whole explore the information of the biological functions and genetic evolutionary links of CrAOXs. The discovery of this study have finally established the foundation to explore the functional characteristics of the AOX gene family. Our study also offers a background for the further use of partially mtDNA-removed cells to study different pathways of mitochondria and chloroplasts’ dependence on ATP and NADPH adjustment.

Author Contributions

Z.H. and A.K. conceptualized the initial study; A.K. was involved in the experimental layout; Z.J. and H.L. performed the laboratory experiments; A.K. helped with bioinformatics analyses; A.K. drafted the initial article; Z.H., A.R. and Q.H. revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32273118), the Chinese National Key R&D Project for Synthetic Biology (2018YFA0902500), the Guangdong Key R&D Project (2022B1111070005), the Shenzhen Special Fund for Sustainable Development (KCXFZ20211020164013021), the Development and Reform Commission of Shenzhen Municipality (XMHT20220104019) and the Shenzhen University 2035 Program for Excellent Research (2022B010) to Zhangli Hu.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ott, M.; Amunts, A.; Brown, A. Organization and Regulation of Mitochondrial Protein Synthesis. Annu. Rev. Biochem. 2016, 85, 77–101. [Google Scholar] [CrossRef]
  2. Hiramatsu, T.; Nakamura, S.; Misumi, O.; Kuroiwa, T.; Nakamura, S. Morphological changes in mitochondrial and chloroplast nucleoids and mitochondria during the Chlamydomonas reinhardtii (Chlorophyceae) cell cycle. J. Phycol. 2006, 42, 1048–1058. [Google Scholar] [CrossRef]
  3. Alber, N.A.; Vanlerberghe, G.C. Signaling interactions between mitochondria and chloroplasts in Nicotiana tabacum leaf. Physiol. Plant. 2019, 167, 188–204. [Google Scholar] [CrossRef] [PubMed]
  4. Singh, K.; Rasmussen, A.; Chatterjee, A.; Rasmussen, L. Mitochondria-mediated nuclear mutator phenotype in Saccharomyces cerevisiae. Biochim. Biophys. Acta-Bioenerg. 2004, 1657, 21–22. [Google Scholar]
  5. Macmillan, C.J.; Shoubridge, E.A. Mitochondrial DNA depletion: Prevalence in a pediatric population referred for neurologic evaluation. Pediatr. Neurol. 1996, 14, 203–210. [Google Scholar] [CrossRef]
  6. Morten, K.J.; Ashley, N.; Wijburg, F.; Hadzic, N.; Parr, J.; Jayawant, S.; Adams, S.; Bindoff, L.; Bakker, H.D.; Mieli-Vergani, G. Liver mtDNA content increases during development: A comparison of methods and the importance of age-and tissue-specific controls for the diagnosis of mtDNA depletion. Mitochondrion 2007, 7, 386–395. [Google Scholar] [CrossRef]
  7. Xing, J.; Chen, M.; Wood, C.G.; Lin, J.; Spitz, M.R.; Ma, J.; Amos, C.I.; Shields, P.G.; Benowitz, N.L.; Gu, J. Mitochondrial DNA content: Its genetic heritability and association with renal cell carcinoma. J. Natl. Cancer Inst. 2008, 100, 1104–1112. [Google Scholar] [CrossRef] [PubMed]
  8. Blokhin, A.; Vyshkina, T.; Komoly, S.; Kalman, B. Variations in mitochondrial DNA copy numbers in MS brains. J. Mol. Neurosci. 2008, 35, 283–287. [Google Scholar] [CrossRef] [PubMed]
  9. Tiao, M.-M.; Lin, T.-K.; Kuo, F.-Y.; Huang, C.-C.; Du, Y.-Y.; Chen, C.-L.; Chuang, J.-H. Early stage of biliary atresia is associated with significant changes in 8-hydroxydeoxyguanosine and mitochondrial copy number. J. Pediatr. Gastroenterol. Nutr. 2007, 45, 329–334. [Google Scholar] [CrossRef] [PubMed]
  10. Yu, M.; Zhou, Y.; Shi, Y.; Ning, L.; Yang, Y.; Wei, X.; Zhang, N.; Hao, X.; Niu, R. Reduced mitochondrial DNA copy number is correlated with tumor progression and prognosis in Chinese breast cancer patients. IUBMB Life 2007, 59, 450–457. [Google Scholar] [CrossRef]
  11. Gillham, N.W.; Boynton, J.E.; Harris, E.H. Specific elimination of mitochondrial-DNA from chlamydomonas by intercalating dyes. Curr. Genet. 1987, 12, 41–47. [Google Scholar] [CrossRef] [PubMed]
  12. Del-Saz, N.F.; Ribas-Carbo, M.; McDonald, A.E.; Lambers, H.; Fernie, A.R.; Florez-Sarasa, I. An In Vivo Perspective of the Role(s) of the Alternative Oxidase Pathway. Trends Plant Sci. 2018, 23, 206–219. [Google Scholar] [CrossRef] [PubMed]
  13. Millar, A.H.; Whelan, J.; Soole, K.L.; Day, D.A. Organization and Regulation of Mitochondrial Respiration in Plants. Annu. Rev. Plant Biol. 2011, 62, 79–104. [Google Scholar] [CrossRef] [PubMed]
  14. Dahal, K.; Vanlerberghe, G.C. Alternative oxidase respiration maintains both mitochondrial and chloroplast function during drought. New Phytol. 2017, 213, 560–571. [Google Scholar] [CrossRef] [PubMed]
  15. Florez-Sarasa, I.; Flexas, J.; Rasmusson, A.G.; Umbach, A.L.; Siedow, J.N.; Ribas-Carbo, M. In vivo cytochrome and alternative pathway respiration in leaves of Arabidopsis thaliana plants with altered alternative oxidase under different light conditions. Plant Cell Environ. 2011, 34, 1373–1383. [Google Scholar] [CrossRef] [PubMed]
  16. Fromm, S.; Senkler, J.; Eubel, H.; Peterhänsel, C.; Braun, H.P. Life without complex I: Proteome analyses of an Arabidopsis mutant lacking the mitochondrial NADH dehydrogenase complex. J. Exp. Bot. 2016, 67, 3079–3093. [Google Scholar] [CrossRef] [PubMed]
  17. Kramer, D.M.; Evans, J.R. The Importance of Energy Balance in Improving Photosynthetic Productivity. Plant Physiol. 2011, 155, 70–78. [Google Scholar] [CrossRef] [PubMed]
  18. Laitz, A.V.N.; Acencio, M.L.; Budzinski, I.G.F.; Labate, M.T.V.; Lemke, N.; Ribolla, P.E.M.; Maia, I.G. Transcriptome Response Signatures Associated with the Overexpression of a Mitochondrial Uncoupling Protein (AtUCP1) in Tobacco. PLoS ONE 2015, 10, e0130744. [Google Scholar] [CrossRef] [PubMed]
  19. Zhao, T.; Wang, W.; Bai, X.; Qi, Y. Gene silencing by artificial microRNAs in Chlamydomonas. Plant J. 2009, 58, 157–164. [Google Scholar] [CrossRef]
  20. Si, X.; Lyu, S.; Hussain, Q.; Ye, H.; Huang, C.; Li, Y.; Huang, J.; Chen, J.; Wang, K. Analysis of Delta (9) fatty acid desaturase gene family and their role in oleic acid accumulation in Carya cathayensis kernel. Front. Plant Sci. 2023, 14, 1193063. [Google Scholar] [CrossRef]
  21. Bailey, T.L.; Williams, N.; Misleh, C.; Li, W.W. MEME: Discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 2006, 34, W369–W373. [Google Scholar] [CrossRef]
  22. Kumar, S.; Nei, M.; Dudley, J.; Tamura, K. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 2008, 9, 299–306. [Google Scholar] [CrossRef]
  23. Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL): An online tool for phylogenetic tree display and annotation. Bioinformatics 2007, 23, 127–128. [Google Scholar] [CrossRef]
  24. Darzentas, N. Circoletto: Visualizing sequence similarity with Circos. Bioinformatics 2010, 26, 2620–2621. [Google Scholar] [CrossRef]
  25. Dai, X.; Zhuang, Z.; Zhao, P.X. psRNATarget: A plant small RNA target analysis server (2017 release). Nucleic Acids Res. 2018, 46, W49–W54. [Google Scholar] [CrossRef] [PubMed]
  26. Ge, S.X.; Jung, D.; Yao, R. ShinyGO: A graphical gene-set enrichment tool for animals and plants. Bioinformatics 2020, 36, 2628–2629. [Google Scholar] [CrossRef] [PubMed]
  27. Quiros, P.M.; Goyal, A.; Jha, P.; Auwerx, J. Analysis of mtDNA/nDNA Ratio in Mice. Curr. Protoc. Mouse Biol. 2017, 7, 47–54. [Google Scholar] [CrossRef] [PubMed]
  28. Shen, J.; Zhang, Y.; Havey, M.J.; Shou, W. Copy numbers of mitochondrial genes change during melon leaf development and are lower than the numbers of mitochondria. Hortic. Res. 2019, 6, 95. [Google Scholar] [CrossRef]
  29. Zhang, N.; Pazouki, L.; Nguyen, H.; Jacobshagen, S.; Bigge, B.M.; Xia, M.; Mattoon, E.M.; Klebanovych, A.; Sorkin, M.; Nusinow, D.A.; et al. Comparative Phenotyping of Two Commonly Used Chlamydomonas reinhardtii Background Strains: CC-1690 (21gr) and CC-5325 (The CLiP Mutant Library Background). Plants 2022, 11, 585. [Google Scholar] [CrossRef]
  30. Alber, N.A.; Vanlerberghe, G.C. The flexibility of metabolic interactions between chloroplasts and mitochondria in Nicotiana tabacum leaf. Plant J. 2021, 106, 1625–1646. [Google Scholar] [CrossRef]
  31. Khozhukhar, N.; Spadafora, D.; Rodriguez, Y.; Alexeyev, M. Elimination of Mitochondrial DNA from Mammalian Cells. Curr. Protoc. Cell Biol. 2018, 78, 20.11.1–20.11.14. [Google Scholar] [CrossRef] [PubMed]
  32. Matagne, R.F.; Michelwolwertz, M.R.; Munaut, C.; Duyckaerts, C.; Sluse, F. Induction and characterization of mitochondrial-dna mutants in Chlamydomonas reinhardtii. J. Cell Biol. 1989, 108, 1221–1226. [Google Scholar] [CrossRef] [PubMed]
  33. Umbach, A.L.; Zarkovic, J.; Yu, J.; Ruckle, M.E.; McIntosh, L.; Hock, J.J.; Bingham, S.; White, S.J.; George, R.M.; Subbaiah, C.C.; et al. Comparison of Intact Arabidopsis thaliana Leaf Transcript Profiles during Treatment with Inhibitors of Mitochondrial Electron Transport and TCA Cycle. PLoS ONE 2012, 7, e044339. [Google Scholar] [CrossRef]
  34. Mazorra Morales, L.M.; Cosme Silva, G.M.; Santana, D.B.; Pireda, S.F.; Dorighetto Cogo, A.J.; Heringer, A.S.; de Oliveira, T.d.R.; Reis, R.S.; dos Santos Prado, L.A.; de Oliveira, A.V.; et al. Mitochondrial dysfunction associated with ascorbate synthesis in plants. Plant Physiol. Biochem. 2022, 185, 55–68. [Google Scholar] [CrossRef] [PubMed]
  35. Ding, C.-Q.; Ng, S.; Wang, L.; Wang, Y.-C.; Li, N.-N.; Hao, X.-Y.; Zeng, J.-M.; Wang, X.-C.; Yang, Y.-J. Genome-wide identification and characterization of Alternative oxidase genes and their response under abiotic stresses in Camellia sinensis (L.) O. Kuntze. Planta 2018, 248, 1231–1247. [Google Scholar] [CrossRef] [PubMed]
  36. Wang, X.; Geng, X.; Bi, X.; Li, R.; Chen, Y.; Lu, C. Genome-wide identification of AOX family genes in Moso bamboo and functional analysis of PeAOX1b_2 in drought and salinity stress tolerance. Plant Cell Rep. 2022, 41, 2321–2339. [Google Scholar] [CrossRef] [PubMed]
  37. Brew-Appiah, R.A.T.; York, Z.B.; Krishnan, V.; Roalson, E.H.; Sanguinet, K.A. Genome-wide identification and analysis of the ALTERNATIVE OXIDASE gene family in diploid and hexaploid wheat. PLoS ONE 2018, 13, e0201439. [Google Scholar] [CrossRef]
  38. Polidoros, A.N.; Mylona, P.V.; Arnholdt-Schmitt, B. Aox gene structure, transcript variation and expression in plants. Physiol. Plant. 2009, 137, 342–353. [Google Scholar] [CrossRef]
  39. Costa, J.H.; McDonald, A.E.; Arnholdt-Schmitt, B.; de Melo, D.F. A classification scheme for alternative oxidases reveals the taxonomic distribution and evolutionary history of the enzyme in angiosperms. Mitochondrion 2014, 19, 172–183. [Google Scholar] [CrossRef]
  40. Liu, C.; Wright, B.; Allen-Vercoe, E.; Gu, H.; Beiko, R. Phylogenetic Clustering of Genes Reveals Shared Evolutionary Trajectories and Putative Gene Functions. Genome Biol. Evol. 2018, 10, 2255–2265. [Google Scholar] [CrossRef]
  41. Wang, W.; Xia, M.; Chen, J.; Deng, F.; Yuan, R.; Zhang, X.; Shen, F. Genome-wide analysis of superoxide dismutase gene family in Gossypium raimondii and G. arboreum. Plant Gene 2016, 6, 18–29. [Google Scholar] [CrossRef]
  42. Wang, B.; Zhang, F.; Hu, J.; Gao, X.; Bian, P.; Liu, Y.; Wang, G. Cre-miR914-regulated RPL18 is involved with UV-B adaptation in Chlamydomonas reinhardtii. J. Plant Physiol. 2019, 232, 151–159. [Google Scholar] [CrossRef] [PubMed]
Processes 12 01654 g001
Figure 1. The mtDNA copy number levels of the treatment and control. (A) The AF, EB and ddC chemicals with different concentrations and combinations such as 5-AF (5 µg/mL), 7-AF (7 µg/mL), 2-EB (2 µg/mL), 6-EB (6 µg/mL), 5-AF+4-EB (mixture of AF (5 µg/mL) and EB (4 µg/mL)), 150-DDC+1.5 EB (mixture of ddC (150 mM) and EB (1.5 µg/mL)) and 200-DDC+2 EB (mixture of ddC (200 mM) and EB (2 µg/mL)) compared with the control (CK) were screened to obtain one which gave the minimum copy number so that it could be used in further experiments. (B) The results 5, 7 and 9 days after treatment (DAT) were checked as to which day gives the minimum mitochondrial copy number. A t-test was used to calculate significance (** p < 0.01). The mean and SD values were derived from three biological repetitions.
Figure 1. The mtDNA copy number levels of the treatment and control. (A) The AF, EB and ddC chemicals with different concentrations and combinations such as 5-AF (5 µg/mL), 7-AF (7 µg/mL), 2-EB (2 µg/mL), 6-EB (6 µg/mL), 5-AF+4-EB (mixture of AF (5 µg/mL) and EB (4 µg/mL)), 150-DDC+1.5 EB (mixture of ddC (150 mM) and EB (1.5 µg/mL)) and 200-DDC+2 EB (mixture of ddC (200 mM) and EB (2 µg/mL)) compared with the control (CK) were screened to obtain one which gave the minimum copy number so that it could be used in further experiments. (B) The results 5, 7 and 9 days after treatment (DAT) were checked as to which day gives the minimum mitochondrial copy number. A t-test was used to calculate significance (** p < 0.01). The mean and SD values were derived from three biological repetitions.
Processes 12 01654 g001
Processes 12 01654 g002
Figure 2. The mtDNA copy number levels of the AF treatment and control group. (A) The rrnL6, nad5 and cox1 genes from mitochondria were screened to obtain genes which gave the minimum copy number and could be used in further experiments. (B) Two strains of CR were screened to select the minimum mtDNA copy numbers. A t-test was used to calculate significance (** p < 0.01). The mean and SD values were derived from three biological and three technical repetitions.
Figure 2. The mtDNA copy number levels of the AF treatment and control group. (A) The rrnL6, nad5 and cox1 genes from mitochondria were screened to obtain genes which gave the minimum copy number and could be used in further experiments. (B) Two strains of CR were screened to select the minimum mtDNA copy numbers. A t-test was used to calculate significance (** p < 0.01). The mean and SD values were derived from three biological and three technical repetitions.
Processes 12 01654 g002
Processes 12 01654 g003
Figure 3. RT-qPCR results of seven designated genes studied to inhibit mETC in different studies. Asterisks indicate that the corresponding genes were distinctly up- or downregulated following different treatments by t-test (* p < 0.05, ** p < 0.01). The mean and SD values were derived from three biological and three technical repetitions.
Figure 3. RT-qPCR results of seven designated genes studied to inhibit mETC in different studies. Asterisks indicate that the corresponding genes were distinctly up- or downregulated following different treatments by t-test (* p < 0.05, ** p < 0.01). The mean and SD values were derived from three biological and three technical repetitions.
Processes 12 01654 g003
Processes 12 01654 g004
Figure 4. Chlamydomonas reinhardtii (Cr) AOX family gene structure and motif analysis: (A) Phylogenetic tree. (B) Gene structure for AOX. The gray horizontal line denotes intron regions, while the yellow horizontal line denotes exon regions. (C) AOX gene distribution on three Chlamydomonas reinhardtii chromosomes is shown schematically, along with the gene names in red on the left side. The scale on the left side indicates the location of the AOX genes on chromosomes. The top of each chromosome (Chr) is where you may find the chromosomal numbers.
Figure 4. Chlamydomonas reinhardtii (Cr) AOX family gene structure and motif analysis: (A) Phylogenetic tree. (B) Gene structure for AOX. The gray horizontal line denotes intron regions, while the yellow horizontal line denotes exon regions. (C) AOX gene distribution on three Chlamydomonas reinhardtii chromosomes is shown schematically, along with the gene names in red on the left side. The scale on the left side indicates the location of the AOX genes on chromosomes. The top of each chromosome (Chr) is where you may find the chromosomal numbers.
Processes 12 01654 g004
Processes 12 01654 g005
Figure 5. A phylogenetic and collinearity analysis of AOX proteins. (A) A phylogenetic analysis of AOX proteins from Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At) was carried out using the maximum likelihood method. There are four groups of AOX proteins, each of which is represented by a red, gray, purple and blue color. Genes from Chlamydomonas reinhardtii (Cr) are highlighted in blue. (B) Collinearity analysis of AOX proteins between Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At). The blue, green and orange colors represent ≤40%, ≤60% and ≤80% identity, respectively.
Figure 5. A phylogenetic and collinearity analysis of AOX proteins. (A) A phylogenetic analysis of AOX proteins from Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Coccomyxa subellipsoidea (Cs), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At) was carried out using the maximum likelihood method. There are four groups of AOX proteins, each of which is represented by a red, gray, purple and blue color. Genes from Chlamydomonas reinhardtii (Cr) are highlighted in blue. (B) Collinearity analysis of AOX proteins between Chlamydomonas reinhardtii (Cr), Marchantia polymorpha (Mp), Volvox carteri (Vc), Physcomitrella patens (Pp) and Arabidopsis thaliana (At). The blue, green and orange colors represent ≤40%, ≤60% and ≤80% identity, respectively.
Processes 12 01654 g005
Processes 12 01654 g006
Figure 6. Gene ontology enrichment analysis and target cleavage sites of CrmiRNAs in CrAOX genes of C. reinhardtii. (A) Predicted target cleavage sites of CrmiRNAs in CrAOX in C. reinhardtii. (B) Enriched GO molecular function, cellular component and biological process terms visualized as a network. (C) Enriched GO molecular function, cellular component and biological process terms visualized as a chart. GO enrichment analysis of CrAOX genes was performed and visualized using the online tool ShinyGO 0.80.
Figure 6. Gene ontology enrichment analysis and target cleavage sites of CrmiRNAs in CrAOX genes of C. reinhardtii. (A) Predicted target cleavage sites of CrmiRNAs in CrAOX in C. reinhardtii. (B) Enriched GO molecular function, cellular component and biological process terms visualized as a network. (C) Enriched GO molecular function, cellular component and biological process terms visualized as a chart. GO enrichment analysis of CrAOX genes was performed and visualized using the online tool ShinyGO 0.80.
Processes 12 01654 g006
Processes 12 01654 g007
Figure 7. The mtDNA copy number of AF treatments and their effect on the relative expression level of CrAOX genes. (A) mtDNA copy number after 7 days of AF treatment and after 45 days without treatment (DWT) after being recovered from AF treatment. (B) Relative expression level of CrAOX genes after 7 days of AF treatment and after 45 days without AF treatment. A t-test was used to calculate significance (* p < 0.05, ** p < 0.01). The mean and SD values were derived from three biological and three technical repetitions.
Figure 7. The mtDNA copy number of AF treatments and their effect on the relative expression level of CrAOX genes. (A) mtDNA copy number after 7 days of AF treatment and after 45 days without treatment (DWT) after being recovered from AF treatment. (B) Relative expression level of CrAOX genes after 7 days of AF treatment and after 45 days without AF treatment. A t-test was used to calculate significance (* p < 0.05, ** p < 0.01). The mean and SD values were derived from three biological and three technical repetitions.
Processes 12 01654 g007
Table 1. Lists the primers utilized in this study’s qRT-PCR gene expression investigation and mtDNA copy number.
Table 1. Lists the primers utilized in this study’s qRT-PCR gene expression investigation and mtDNA copy number.
Gene Name Primer Name Sequence (5′-3′) Length
AOX11-F
1-R		ATGCTTCAGACCGCACCTATG
GCGGAACCGAAGCTATGGAG		21
20
AOX22-F
2-R		CCTTTCGCTGCACTCCCA
ACACAAGCCCTGACATGCTG		18
20
AOX33-F
3-R		GATGAAGAGTGCAGCGCATTT
TTGAAGTTGTCCCAGCCCAG		21
20
AOX44-F
4-R		GGCCGTGTTCTACTACTGGG
CCACCCGTTGCATGAAGTTG		20
20
tubulin5-F
5-R		CTCGCTTCGCTTTGACGGTG
CGTGGTACGCCTTCTCGGC		20
19
rrnL66-F
6-R		ACAATTACGCTGAAAACAGTACCA
TCACTGTTTGTTATGCAAAACCTT		24
24
nad57-F
7-R		GCTGGCAGAATAAACGTTAAGCAA
TGGTTTGCTAATGTGGGGTGTCTTG		24
25
cox18-F
8-R		CAGCCCTAGCTTTGTTGCTA
TAGTGGTGGATAAGCGGTCC		20
20
CLPD249-F
9-R		TGTTTCTCCTTGTTCCACCTCTG
CCGGGTTGACGTCTGTCTTG		23
20
Table 2. Characteristics of the four CrAOXs genes identified in C. reinhardtii. Note: PSL—Protein sequence length, SCL—Subcellular localization, MW—Molecular Weight, II—Instability index.
Table 2. Characteristics of the four CrAOXs genes identified in C. reinhardtii. Note: PSL—Protein sequence length, SCL—Subcellular localization, MW—Molecular Weight, II—Instability index.
Gene NumberPhytozome IdentifierChromosome Localization (bp)PSL (aa)MW (kDa)pIHydrophilicityIISCL
CrAOX1Cre09.g395950Chr.9: 2124774–212905836038.354968.76−0.01343.52Mitochondrial
CrAOX2Cre03.g169550Chr.3: 3777960–378223434637.488349.300.02751.17Mitochondrial
CrAOX3Cre03.g172500Chr.3: 4108250–411271647153.820275.76−0.35249.47Mitochondrial
CrAOX4Cre07.g074050Chr.7: 5429513–543492241646.770416.47−0.17642.59Mitochondrial
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Khan, A.; Jihong, Z.; Luo, H.; Raza, A.; Hussain, Q.; Hu, Z. Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii. Processes 2024, 12, 1654. https://doi.org/10.3390/pr12081654

AMA Style

Khan A, Jihong Z, Luo H, Raza A, Hussain Q, Hu Z. Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii. Processes. 2024; 12(8):1654. https://doi.org/10.3390/pr12081654

Chicago/Turabian Style

Khan, Asadullah, Zuo Jihong, Haolin Luo, Ali Raza, Quaid Hussain, and Zhangli Hu. 2024. "Effect of Partial Elimination of Mitochondrial DNA on Genome-Wide Identified AOX Gene Family in Chlamydomonas reinhardtii" Processes 12, no. 8: 1654. https://doi.org/10.3390/pr12081654

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop