Next Article in Journal
Olive Pomace Oil versus High Oleic Sunflower Oil and Sunflower Oil: A Comparative Study in Healthy and Cardiovascular Risk Humans
Next Article in Special Issue
Quantitative Risk Assessment of Hepatitis a Virus Infection Arising from the Consumption of Fermented Clams in South Korea
Previous Article in Journal
Apricot Kernel: Bioactivity, Characterization, Applications, and Health Attributes
Previous Article in Special Issue
Safety Assessment of One Lactiplantibacillus plantarum Isolated from the Traditional Chinese Fermented Vegetables—Jiangshui
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 11
Issue 15
10.3390/foods11152185
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antibiotics Resistance and Virulence of Staphylococcus aureus Isolates Isolated from Raw Milk from Handmade Dairy Retail Stores in Hefei City, China

by
Hui Wang
1,
Jiawei Shen
1,
Chengfeng Zhu
1,
Kai Ma
1,
Mengcheng Fang
1,
Bingbing Li
1,
Wenhui Wang
1,2 and
Ting Xue
1,2,*
1
School of Life Sciences, Anhui Agricultural University, Hefei 230036, China
2
Food Procession Research Institute, Anhui Agricultural University, Hefei 230036, China
*
Author to whom correspondence should be addressed.
Foods 2022, 11(15), 2185; https://doi.org/10.3390/foods11152185
Submission received: 28 June 2022 / Revised: 13 July 2022 / Accepted: 21 July 2022 / Published: 22 July 2022
(This article belongs to the Special Issue Detection and Identification of Waterborne and Foodborne Microbes: Risk Assessment and Public Health)
Browse Figures
Review Reports Versions Notes

Abstract

:
Handmade dairy products, which retain the nutrients in milk to the greatest extent, have become popular in China recently. However, no investigation regarding the characteristics of Staphylococcus aureus (S. aureus) in raw milk of handmade dairy retail stores has been reported. Here, we investigated the antimicrobial susceptibility, virulence, biofilm formation, and genetic diversity of S. aureus in raw milk from handmade dairy retail stores in Hefei, China. After 10 months of long-term monitoring, 50 S. aureus strains were isolated from 69 different raw milk samples, of which 6 were positive for methicillin-resistant S. aureus (MRSA). The resistance rates of these isolates to ampicillin, erythromycin, kanamycin, tetracycline, sulfamethoxazole-trimethoprim, gentamicin, ofloxacin, oxacillin, chloramphenicol, and doxycycline were 56, 54, 40, 24, 22, 22, 18, 14, 8 and 6%, respectively. All 50 isolates were susceptible to vancomycin and 29 strains (58%) showed multidrug resistance phenotype. For enterotoxins genes, selp (14%) was detected the most frequently, followed by sea (6%), sec (4%), sei (4%), ser (4%), selj (4%), and seh (2%). By microplate assay, 32 and 68% of the strains showed moderate and strong biofilm formation ability, respectively. Fifty isolates were discriminated into nine spa types, and the most common spa typing was t034 (42%). The results of this study indicate that S. aureus from raw milk may constitute a risk concerning food poisoning, and more attention must be given to awareness and hygienic measures in the food industry.

1. Introduction

Staphylococcus aureus (S. aureus) is a kind of Gram-positive opportunistic pathogenic bacterium, which can cause a variety of zoonotic infections and toxin-type food poisoning [1]. The outbreaks of staphylococcal food poisoning (SFP) caused by S. aureus and its enterotoxins have been reported worldwide [2,3]. The Center for Disease Control and Prevention’s assessment of foodborne illness from 2006 to 2008 shows that there are 241,188 cases of SFP in the United States every year, resulting in 1064 hospitalizations and 6 deaths [4]. In China, microbes accounted for 53.7% of food poisoning cases in 2015. S. aureus is one of the most important pathogenic bacteria [5]. The onset of SFP is rapid, which makes patients feel nauseous, vomit, and experience abdominal cramps [2].
Dairy products account for a certain proportion of all reported SFP cases [6]. Milk and dairy products are favored by consumers as an essential source of protein, calcium, and vitamins [7,8]. Of these, milk powder, rich in micronutrients, is used worldwide as the main ingredient in infant formula [9]. Although dairy products have experienced a series of treatments such as high temperature, high pressure, and drying, there are still many reports of S. aureus detected in dairy products [10,11]. Currently, handmade retail products, such as handmade yogurt and cheese, are becoming more and more popular, but the way they are handled may be inadequate [12]. There may be a potential hazard of incomplete sterilization of food. Simultaneously, the source of raw milk is another important aspect to ensure the safety of final products. Residues of S. aureus in dairy products may pose a risk of food poisoning. Consequently, it is necessary to investigate the characteristics of S. aureus in the raw milk from handmade dairy retail stores.
S. aureus enterotoxins (SEs) are gastrointestinal exotoxins [13]. The SEs remain active in the digestive tract after being ingested by humans because they can resist proteolytic enzymes at high temperatures [6]. Previous studies have shown that SEs are considered to be the major cause of SFP [14]. Enterotoxin contains the classic SEs encoded by sea, seb, sec, sed, and see genes, novel enterotoxin encoded by seg, seh, sei, and ser genes, and enterotoxin-like (SEls) protein encoded by selj and selp genes [6,15]. Due to antibiotic abuse, the resistance of S. aureus is gradually increasing, and different regions show different epidemic trends. It was previously reported that S. aureus with antibiotic resistance has caused foodborne disease outbreaks [16,17], especially the methicillin-resistant S. aureus (MRSA) and multidrug resistance (MDR) S. aureus, posing a public health security challenge [18]. Biofilm substrates not only help bacteria store nutrients and water but also reduce the rate of antibiotic penetration [19,20]. Moreover, in the pathogenic process of S. aureus, biofilm is a crucial virulence factor, which helps bacteria survival in harsh environments [21,22,23,24]. As a result, it is important to monitor the antibiotics resistance trend and virulence-associated SEs gene and biofilm formation rate of S. aureus in the raw milk from handmade dairy retail stores.
The spa typing is a genotyping method based on DNA sequence, which is specially used for the typing of S. aureus [25]. The spa typing based on repeats in the staphylococcal protein A sequence allows higher discrimination than does multilocus sequence typing and it remains a popular typing method [26]. The spa gene can be genotyped by polymerase chain reaction (PCR) and DNA sequencing. Some studies have found that specific S. aureus lineages may be geographically prevalent and exhibit specific patterns of antibiotic resistance and virulence [27,28]. Accordingly, a better understanding of the genotypes of S. aureus isolates from raw milk may bring in more effective measures to reduce the occurrence of SFP and trace the source of infection [29]. The recent hotspot studies aimed to investigate the prevalence and molecular characteristics of S. aureus isolate from raw milk from dairy farms [27,30]. Unfortunately, there have been no reports on the prevalence and long-term detection of S. aureus in raw milk from handmade dairy products.
In this study, we conducted a ten-month detection of S. aureus in raw milk from handmade dairy products retail stores in Hefei city, China. The epidemic characteristics of S. aureus through strain isolation and identification, spa typing, drug resistance measurement, biofilm formation assay in vitro, and enterotoxin encoding genes detection were analyzed.

2. Materials and Methods

2.1. Collection of Raw Milk Samples

From August 2020 to May 2021, a total of 69 different raw milk samples were collected from handmade dairy products retail stores in Hefei, Anhui Province, China. The collected 50 mL raw milk was cryogenically refrigerated in a sterile tube and transported to the laboratory within 1 h for subsequent studies.

2.2. Identification and Isolation of S. aureus

In total, 50 mL raw milk was poured into 50 mL tryptic soy broth (TSB; Difco) with 7.5% NaCl and incubated for 16 h at 37 °C with continuous shaking. The cultures were spread on tryptic soy agar (TSA; Difco, Franklin Lakes, NJ, USA) plates cultivated for 16 h at 37 °C. A single colony was then cultivated overnight in 3 mL TSB. Genomic DNA of every isolate was extracted using TIANamp Bacteria DNA Kit (TianGen Biotech, Beijing, China), respectively, and 4 µg/mL lysostaphin was added if necessary. These strains were identified as S. aureus by 16S rDNA gene sequencing and PCR analysis of the thermonuclease (nuc) gene-specificity [31]. The confirmed S. aureus isolates were kept at −80 °C in 25% glycerol for further study. All primers used in this study are listed in Table 1.

2.3. Detection of mecA and Genes Encoding Enterotoxin

All S. aureus isolates were screened for mecA and genes encoding enterotoxin by PCR amplification using primers in Table 1. The primers were synthesized by Tsingke Biotechnology Co., Ltd. (Nanjing, China). The amplified mecA-gene-positive strain was defined as MRSA strain [32], with mecA-positive S. aureus N315 as the positive control [33]. Several genes encoding associated SEs were tested by PCR, including sea, seb, sec, sed, see, ser, seg, seh, sei, selj, and selp [15]. The SEs genes were amplified by PCR at 94 °C for 4 min, followed by 30 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 40 s, and final extension for 10 min at 72 °C.

2.4. Antibiotic Susceptibility Testing

Disk diffusion was conducted to test the antimicrobial susceptibility of all isolates in accordance with the guidelines of the Clinical and Laboratory Standards Institute (CLSI, 2015) [27]. Ampicillin (10 μg), gentamicin (10 μg), kanamycin (30 μg), tetracycline (30 μg), doxycycline (30 μg), sulfamethoxazole-trimethoprim (1.25/23.75 µg), chloramphenicol (30 μg), erythromycin (15 μg), and ofloxacin (5 μg) were used as antimicrobial agents (Oxoid, Basingstoke, UK). The sensitivity of vancomycin and oxacillin was tested by broth microdilution according to the guidelines of CLSI (CLSI, 2015). S. aureus ATCC25923 and ATCC29213 were used as quality control strains, and the testing experiment was repeated twice.

2.5. Biofilm Formation Assay

The method of biofilm quantification was performed as described previously and modified herein [34]. Briefly, all isolates were grown in TSB for 16 h; S. aureus from the overnight growth was diluted to an optical density at 600 nm (OD600) of around 0.03 in fresh TSB for the following subsequent assays. After being cultivated for 4 h at 37 °C with shaking at 180 rpm, the cultures were diluted with fresh TSB to an optical density at 600 nm (OD600) of about 1.00 and diluted at 1:100 with fresh TSB. The cultures were then transferred into sterile 96-well flat-bottomed tissue culture plates for the following incubation at 37 °C for 24 h. The adherent bacteria were stained with 0.2% crystal violet for 30 min and then washed three times with sterile phosphate-buffered saline (PBS). The biomass of the biofilm was dissolved with 33% acetic acid and then determined quantitatively by using a Micro ELISA auto-reader at the wavelength of 492 nm. For the biofilm production assays, S. aureus NCTC8325, a strong biofilm-former, was regarded as the positive control [35], and sterile TSB was selected as the negative control. An OD492nm value of 0.6 was applied as the cutoff point to distinguish between biofilm-formers and non-biofilm-formers (cutoff (ODc) = average OD + SD of 3 negative control) [36]. Biofilm formation was classified as strong (OD492 > 1.71), moderate (1.71 > OD492 > 0.6), and weak (OD492 < 0.6) [37].

2.6. spa Typing

The spa typing was performed by amplification of polymorphic X region of the S. aureus protein A gene (spa), using the standard primers spa-1113F (5′-TAAAGACGA-TCCTTCGGTGAGC-3′) and spa-1514R (5′-CAGCAGTAGTGCCGTTTGCTT-3′). The primers and protocol are available on the Ridom Spa Server database (http://www.spaserver.ridom.de, accessed on 3 October 2021). It was conducted according to methods described previously and modified as described herein [38]. Briefly, the PCR reaction mix contained 250 nmol of each primer, 12.5 µL of 2× PrimeSTAR® Max DNA Polymerase (Takara Bio Inc., Dalian, China), and 1 µL of DNA template, and genomic DNA was extracted according to the manufacturer’s TIANamp Bacteria DNA Kit instructions (TianGen Biotech, Beijing, China). The PCR was performed under the following conditions: initial denaturation at 98 °C for 5 min, 32 cycles at 98 °C for 10 s, 60 °C for 15 s, and 72 °C for 30 s, and a final extension of 10 min at 72 °C. All the PCR products were sequenced by Tsingke Biotechnology Co., Ltd. (Nanjing, China), and then spa type was identified using this database.

2.7. Statistical Analysis

Statistical analyses were performed using SPSS software (SPSS standard, version 18.0; SPSS, Inc., Chicago, IL, USA) to analyze the differences in the prevalence, antimicrobial resistance, distribution of virulence or enterotoxin-producing genes, and biofilm formation ability. A p < 0.05 was considered statistically significant.

3. Results

3.1. Isolation and Identification of S. aureus

A total of 69 consecutive and non-repetitive raw milk samples were collected during the 10-month monitoring of raw milk from artisanal dairy retail stores in downtown Hefei, China. A total of 50 S. aureus isolates were identified by 16S rDNA gene sequencing as well as by PCR analysis of the nuc gene specific to this species, and the detection rate of S. aureus in raw milk samples was 72.5%. Six of the S. aureus isolates harbored mecA gene and were identified as MRSA strains (Table 2, Figure 1).

3.2. spa Typing

The spa typing information of the 50 isolates is shown in Table 3 and Figure 1. They were divided into 9 spa types. The most prevalent spa type was t034 (42.0%, 21/50). The other 8 spa types were: t3904, t189, t4431, t030, t527, t2844, t267, and t4682, and their proportions were 14, 8, 10, 6, 8, 4, 4 and 4%, respectively.

3.3. Distribution of Enterotoxin Genes

The production of enterotoxin is a potential factor causing SPF. Eleven enterotoxin genes (including sea, seb, sec, sed, see, seg, seh, sei, ser, selj, and selp) were selected to test the potential of the S. aureus isolates to produce enterotoxin. Results showed that 7 enterotoxin genes were detected in the 50 S. aureus isolates (Table 4 and Figure 1). The enterotoxin genes seb, see, seg, and sed were not found in any isolate. As shown in Table 4, the 7 enterotoxin genes, selp, sea, sec, sei, ser, selj, and seh were detected in 7 (14%), 3 (6%), 2 (4%), 2 (4%), 2 (4%), 2 (4%), and 1 (2%) isolates, respectively. In total, these enterotoxin genes were identified in 24% (12/50) of the S. aureus isolates, and 6% (3/50) of the isolates contained 3 enterotoxin genes.

3.4. Antimicrobial Susceptibility Testing

The antimicrobial susceptibility data of the 50 S. aureus isolates are shown in Table 5 and Figure 1. These isolates showed the highest resistance rate to ampicillin (56%, 28/50), followed by resistance to erythromycin (54%, 27/50), kanamycin (40%, 20/50), tetracycline (24%, 12/50), sulfamethoxazole-trimethoprim (22%, 11/50), gentamicin (22%, 11/50), ofloxacin (18%, 9/50), oxacillin (14%, 7/50), chloramphenicol (8%, 4/50), and doxycycline (6%, 3/50). All the S. aureus isolates were susceptible to vancomycin (0%, 0/50). Moreover, 8 strains (16%) were sensitive to all tested antimicrobial agents, 5 strains (10%) were resistant to one antimicrobial agent, and 8 strains (16%) were resistant to two antimicrobial agents. Beyond expectation, we found that 29 strains (58%) showed MDR phenotype (resistance to three or more types of antimicrobials). Additionally, the 6 strains of MRSA were resistant to ampicillin and oxacillin (100%).
Table 6 and Figure 1 exhibit the relationship between spa typing and MRSA. The percentages of MRSA in spa types t030 and t4431 strains were 100 and 60%, respectively. The isolates with spa types of t3904, t189, t4431, t527, t2844, t267, and t4682 were all non-MRSA strains.

3.5. Detection of the Biofilm Formation Capacity of S. aureus

The biofilm-forming abilities of all the 50 S. aureus isolates were confirmed by microtiter plate and MicroELISA auto reader assay. As shown in Figure 2A, the positive control strain NCTC8325 formed dense biofilm after incubation at 37 °C for 24 h. As shown in Figure 1, 68% (34/50) of the isolates formed strong biofilms, while 32% (16/50) of the isolates formed moderate biofilms. The 50 S. aureus isolates from raw milk samples in artisanal dairy retail stores were identified as 9 spa types (Table 3 and Figure 1). The biofilm formation abilities of 6 strains of type t3094 were higher than that of NCTC8325, while 5 strains of type t4431, 2 strains of type t2844, and 2 strains of type t4682 were lower than that of NCTC8325. The other spa-type strains (t3904, t189, t4431, t030, t527, and t267), compared with NCTC8325, showed no obvious characteristic difference in biofilm formation ability (Figure 2B, Figure 1). These results further confirm that S. aureus of different spa types isolated from raw milk generally has a strong ability to form biofilm in vitro, which may cause harm to public health security.

4. Discussion

Previous studies showed that S. aureus, particularly those strains with MDR phenotypes and capacity of producing biofilm and enterotoxins, might contaminate raw milk and dairy products, which may cause an extremely grave public health issue [17,39,40,41]. In the present investigation, we conducted 10-month monitoring of handmade dairy retail stores in Hefei, China to evaluate the antibiotics resistance, virulence, and biofilm formation of S. aureus isolates in raw milk.
In our research, 72.5% (50/69) of raw milk samples were positive for S. aureus during 10 months of monitoring. The data were consistent with several previous reports, which demonstrated that the detection rate of S. aureus in raw milk was 66.7% in Malaysia [42], 77.4% in southern Xinjiang, China [27], and 83% in Italy [43]. On the contrary, comparing the detection rate of S. aureus in raw milk (27.7%) and that of ready-to-eat (RTE) food (12.5%) in some areas of China, our results show that the detection rate is higher [44,45]. Overall, it is common to detect S. aureus in raw milk that is subsequently processed into fermented yogurt, pasteurized milk, and powder. The reasons are that there might be inappropriate hygiene conditions in raw milk processing areas in different regions and raw milk might come from cows infected by S. aureus. Additionally, through spa typing, the statistics emphasized the genetic diversity of S. aureus isolates from raw milk. The 50 S. aureus isolates from the raw milk of artisanal dairy retail stores were grouped into 9 spa types. Among them, four spa types (t189, t034, t030, and t267), which have been repeatedly reported as isolated S. aureus in dairy farms, hospitals, and foods in China, were also identified in these isolates [5,28,29].
The results of the antimicrobial susceptibility test indicated that more than half of the S. aureus isolates were resistant to ampicillin and erythromycin. This result was not surprising, because β-lactams and macrolides were widely prescribed to treat bovine mastitis caused by Staphylococcus and Streptococcus/Enterococcus [46,47]. Previous studies performed in China revealed that the prevalence of erythromycin resistance was 58.7% in Shandong, 44.6% in southern Xinjiang, and 46.3% in northern areas [27,30,44], which is similar to our data. However, compared with the erythromycin resistance rate of S. aureus isolates from retail food in Beijing, our results were significantly higher [48]. For kanamycin resistance, our results were higher than isolates of S. aureus from raw milk as well as dairy products in other areas of China [44,49]. It was shown that 74% of the isolates showed resistance to two or more antibiotics, and 58% of the S. aureus isolates were MDR, which was consistent with another study [44]. However, other researchers claimed lower rates of S. aureus of MDR [50,51]. In recent years, the emergence of MDR S. aureus, especially MRSA, has become an increasingly serious public health concern [52,53]. In our data, six S. aureus isolates containing mecA were identified as MRSA strains (12%), which was higher than that observed (0.9%) in RTE foods from Shanxi Province, China [54]. By contrast, several studies have shown that the detection rates of MRSA isolated from raw milk and relevant products are similar to our data [49,55]. This increasing prevalence of S. aureus observed in this study may be due to antibiotics abuse and other factors that have led to the emergence of MDR S. aureus. Consequently, the prevalence of MDR S. aureus and MRSA from raw milk used to prepare pasteurized milk and fermented yogurt, as well as the spread of antibiotic-resistant strains, may represent a potential hazard to consumers.
In China, SFP was the third most common bacterial disease from 2011 to 2016, after Vibrio parahaemolyticus and Salmonella [56]. It has been confirmed that SFP triggered by S. aureus is related to the expression of SEs. The discovery of enterotoxin genes in S. aureus isolated from food in different regions is thought to be common [5,57,58]. Therefore, this study assessed the presence of genes encoding SEs in all the 50 S. aureus isolates. Results data indicated that 24% of all isolates harbored one or more genes encoding selp, sea, sec, sei, ser, selj, and seh, and 6% of isolates contained three enterotoxin genes. In other regions of China, the percentage of S. aureus isolates from raw milk or dairy products carrying SEs genes is higher than that in this study [59,60,61,62]. Additionally, sea has been widely considered the most common reason for SFP globally [63,64]. For instance, the sea was the enterotoxin gene with the highest detection rate in clinical isolates of S. aureus involved in food poisoning events in China [17]. The sea gene detected in this study was consistent with previous studies. However, the dominance of selp observed in the present study was not consistent with previous findings. The prevalence difference of genes encoding SEs in S. aureus may be due to the different geographical locations of these strains. Overall, S. aureus isolated from raw milk used to prepare pasteurized milk and fermented yogurt carried few SEs genes, which is optimistic.
The biofilm formation ability of S. aureus has been increasingly recognized as a significant virulence trait [65]. A previous study demonstrated that bacteria form biofilm on the surface of dairy processing equipment; thus, the organisms inside the biofilm might be more able to withstand temperature and pH changes than planktonic organisms [66]. A subsequent study tried to establish an association between S. aureus genotype, spa type, and biofilm formation ability [38]. For this reason, this study also investigated the relationship between the ability of in vitro biofilm formation and spa typing of all S. aureus isolates. We found that all 50 S. aureus from raw milk could form biofilm, although at different intensities, and these results agreed with two previous investigations conducted in Beijing and Xingjiang, China [27,36]. On the contrary, a study conducted in Brazil showed that approximately 45% of S. aureus strains isolated from raw milk had the capacity for biofilm formation [67]. Simultaneously, our data indicated that there was a failure of a specific relationship between the ability of biofilm formation and the type of spa, which was consistent with the research results from E. Thiran et al. [38]. The reasons may be that staphylococcal protein A is a vital virulence factor of S. aureus, which plays a role in proteinaceous biofilm formation and is highly conserved [68,69], but the biofilm formation of S. aureus was regulated by multiple genes (such as SigB factor). A previous study showed that a point mutation (Q225P) of SigB promoted the formation of biofilm [70]. Therefore, there might not be a definite relationship between the spa type and biofilm formation ability. In short, the high prevalence of biofilm formation in S. aureus isolates demonstrates the necessity for artisanal dairy retailers to refine their quality assurance systems to reduce and eliminate these strains.

5. Conclusions

The monitoring of the antibiotics resistance, virulence, and biofilm formation of S. aureus in raw milk from artisanal dairy retail stores was conducted in the present study. The present investigation reveals that the detection rate of S. aureus in raw milk was 72.5% (50/69), and 58% (29/50) and 12% (6/50) isolates exhibited MDR and MRSA phenotypes, respectively. Furthermore, the high positive rate of biofilm formation and low detection rate of SEs genes were the main characteristics of these isolates. Considering its clinical significance, this study suggests that raw milk as a possible transmission route of S. aureus cannot be neglected. To prevent the spread of S. aureus, effective measures should be taken during the processing of raw milk to ensure the safety of relevant products.

Author Contributions

Methodology, Investigation, Experiments, Writing—original draft and editing, H.W.; Experiments, Software, Data curation, Writing—review and editing, J.S.; Experiments, Investigation, C.Z.; Methodology, Investigation, Resources, K.M.; Methodology, Writing—review and editing, M.F.; Writing—review and editing, B.L.; Conceptualization, Data curation, Writing—review and editing, W.W.; Conceptualization, Writing—review and editing, Supervision and Funding acquisition, T.X. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China [grant numbers: 31672571].

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhou, K.; Li, C.; Chen, D.; Pan, Y.; Tao, Y.; Qu, W.; Liu, Z.; Wang, X.; Xie, S. A review on nanosystems as an effective approach against infections of Staphylococcus aureus. Int. J. Nanomed. 2018, 13, 7333–7347. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Hennekinne, J.-A.; De Buyser, M.-L.; Dragacci, S. Staphylococcus aurieus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Wang, C.; Xiao, R.; Wang, S.; Yang, X.; Bai, Z.; Li, X.; Rong, Z.; Shen, B.; Wang, S. Magnetic quantum dot based lateral flow assay biosensor for multiplex and sensitive detection of protein toxins in food samples. Biosens. Bioelectron. 2019, 146, 111754. [Google Scholar] [CrossRef] [PubMed]
  4. Scallan, E.; Hoekstra, R.M.; Angulo, F.J.; Tauxe, R.V.; Widdowson, M.-A.; Roy, S.L.; Jones, J.L.; Griffin, P.M. Foodborne illness acquired in the United States—Major pathogens. Emerg. Infect. Dis. 2011, 17, 7–15. [Google Scholar] [CrossRef] [PubMed]
  5. Wu, S.; Huang, J.; Wu, Q.; Zhang, F.; Zhang, J.; Lei, T.; Chen, M.; Ding, Y.; Xue, L. Prevalence and Characterization of Staphylococcus aureus Isolated From Retail Vegetables in China. Front. Microbiol. 2018, 9, 1263. [Google Scholar] [CrossRef] [PubMed]
  6. Benkerroum, N. Staphylococcal enterotoxins and enterotoxin-like toxins with special reference to dairy products: An overview. Crit. Rev. Food Sci. Nutr. 2018, 58, 1943–1970. [Google Scholar] [CrossRef]
  7. Yang, M.; Cong, M.; Peng, X.; Wu, J.; Wu, R.; Liu, B.; Ye, W.; Yue, X. Quantitative proteomic analysis of milk fat globule membrane (MFGM) proteins in human and bovine colostrum and mature milk samples through iTRAQ labeling. Food Funct. 2016, 7, 2438–2450. [Google Scholar] [CrossRef]
  8. Qiao, Q.; Guo, X.; Wen, F.; Chen, L.; Xu, Q.; Zheng, N.; Cheng, J.; Xue, X.; Wang, J. Aptamer-Based Fluorescence Quenching Approach for Detection of Aflatoxin M1 in Milk. Front. Chem. 2021, 9, 653869. [Google Scholar] [CrossRef]
  9. Zhang, L.; Van Dijk, A.D.J.; Hettinga, K. An interactomics overview of the human and bovine milk proteome over lactation. Proteome Sci. 2016, 15, 1. [Google Scholar] [CrossRef] [Green Version]
  10. Aragão, B.B.; Trajano, S.C.; Silva, J.G.; Silva, B.P.; Oliveira, R.P.; Junior, J.W.P.; Peixoto, R.M.; Mota, R.A. Short communication: High frequency of β-lactam-resistant Staphylococcus aureus in artisanal coalho cheese made from goat milk produced in northeastern Brazil. J. Dairy Sci. 2019, 102, 6923–6927. [Google Scholar] [CrossRef]
  11. Song, Q.; Zhu, Z.; Chang, Y.; Shen, X.; Gao, H.; Yang, Y. Prevalence and Characteristics of enterotoxin B-Producing Staphylococcus aureus Isolated from Food Sources: A Particular Cluster of ST188 Strains was Identified. J. Food Sci. 2016, 81, M715–M718. [Google Scholar] [CrossRef] [PubMed]
  12. Bellio, A.; Chiesa, F.; Gallina, S.; Bianchi, D.M.; Macori, G.; Bossi, D.; Nia, Y.; Mutel, I.; Messio, S.; Hennekinne, J.-A.; et al. Insight Into the Distribution of Staphylococci and Their Enterotoxins in Cheeses Under Natural Conditions. Front. Microbiol. 2019, 9, 3233. [Google Scholar] [CrossRef] [PubMed]
  13. Argudín, M.Á.; Mendoza, M.C.; Rodicio, M.R. Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef]
  14. Fisher, E.L.; Otto, M.; Cheung, G.Y.C. Basis of Virulence in Enterotoxin-Mediated Staphylococcal Food Poisoning. Front. Microbiol. 2018, 9, 436. [Google Scholar] [CrossRef] [PubMed]
  15. Johler, S.; Macori, G.; Bellio, A.; Acutis, P.L.; Gallina, S.; Decastelli, L. Short communication: Characterization of Staphylococcus aureus isolated along the raw milk cheese production process in artisan dairies in Italy. J. Dairy Sci. 2018, 101, 2915–2920. [Google Scholar] [CrossRef] [PubMed]
  16. Hyeon, J.-Y.; Chung, G.T.; Bing, S.H.; Kwon, K.S.; Lee, H.H.; Kim, S.J.; Jeon, S.E.; Kang, Y.H.; Kim, J. A Foodborne Outbreak of Staphylococcus aureus associated with Fried chicken in Republic of Korea. J. Microbiol. Biotechnol. 2013, 23, 85–87. [Google Scholar] [CrossRef] [Green Version]
  17. Yan, X.; Wang, B.; Tao, X.; Hu, Q.; Cui, Z.; Zhang, J.; Lin, Y.; You, Y.; Shi, X.; Grundmann, H. Characterization of Staphylococcus aureus Strains associated with food poisoning in Shenzhen, China. Appl. Environ. Microbiol. 2012, 78, 6637–6642. [Google Scholar] [CrossRef] [Green Version]
  18. Wang, W.; Baloch, Z.; Jiang, T.; Zhang, C.; Peng, Z.; Li, F.; Fanning, S.; Ma, A.; Xu, J. Enterotoxigenicity and Antimicrobial Resistance of Staphylococcus aureus Isolated from Retail Food in China. Front. Microbiol. 2017, 8, 2256. [Google Scholar] [CrossRef]
  19. Høiby, N.; Bjarnsholt, T.; Givskov, M.; Molin, S.; Ciofu, O. Antibiotic resistance of bacterial biofilms. Int. J. Antimicrob. Agents 2010, 35, 322–332. [Google Scholar] [CrossRef] [Green Version]
  20. Xu, Z.; Zhou, X.; Yang, W.; Zhang, Y.; Ye, Z.; Hu, S.; Ye, C.; Li, Y.; Lan, Y.; Shen, J.; et al. In vitro antimicrobial effects and mechanism of air plasma-activated water on Staphylococcus aureus biofilm. Plasma Process. Polym. 2020, 17, 1900270. [Google Scholar] [CrossRef]
  21. Khoramian, B.; Jabalameli, F.; Niasari-Naslaji, A.; Taherikalani, M.; Emaneini, M. Comparison of virulence factors and biofilm formation among Staphylococcus aureus strains isolated from human and bovine infections. Microb. Pathog. 2015, 88, 73–77. [Google Scholar] [CrossRef] [PubMed]
  22. Vergara, A.; Normanno, G.; Di Ciccio, P.; Pedonese, F.; Nuvoloni, R.; Parisi, A.; Santagada, G.; Colagiorgi, A.; Zanardi, E.; Ghidini, S.; et al. Biofilm Formation and Its Relationship with the Molecular Characteristics of Food-Related Methicillin-Resistant Staphylococcus aureus (MRSA). J. Food Sci. 2017, 82, 2364–2370. [Google Scholar] [CrossRef] [PubMed]
  23. Bai, X.; Nakatsu, C.H.; Bhunia, A.K. Bacterial Biofilms and Their Implications in Pathogenesis and Food Safety. Foods 2021, 10, 2117. [Google Scholar] [CrossRef] [PubMed]
  24. Ruan, X.; Deng, X.; Tan, M.; Wang, Y.; Hu, J.; Sun, Y.; Yu, C.; Zhang, M.; Jiang, N.; Jiang, R. Effect of resveratrol on the biofilm formation and physiological properties of avian pathogenic Escherichia coli. J. Proteom. 2021, 249, 104357. [Google Scholar] [CrossRef]
  25. Oliveira, D.C.; Crisóstomo, I.; Santos-Sanches, I.; Major, P.; Alves, C.R.; Aires-De-Sousa, M.; Thege, M.K.; de Lencastre, H. Comparison of DNA Sequencing of the protein A Gene polymorphic region with other molecular typing techniques for typing Two epidemiologically diverse collections of methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2001, 39, 574–580. [Google Scholar] [CrossRef] [Green Version]
  26. Harmsen, D.; Claus, H.; Witte, W.; Rothgäger, J.; Claus, H.; Turnwald, D.; Vogel, U. Typing of Methicillin-resistant Staphylococcus aureus in a University hospital setting by using novel software for spa repeat determination and database management. J. Clin. Microbiol. 2003, 41, 5442–5448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Ren, Q.; Liao, G.; Wu, Z.; Lv, J.; Chen, W. Prevalence and characterization of Staphylococcus aureus isolates from subclinical bovine mastitis in southern Xinjiang, China. J. Dairy Sci. 2020, 103, 3368–3380. [Google Scholar] [CrossRef] [Green Version]
  28. Dai, Y.; Liu, J.; Guo, W.; Meng, H.; Huang, Q.; He, L.; Gao, Q.; Lv, H.; Liu, Y.; Wang, Y.; et al. Decreasing methicillin-resistant Staphylococcus aureus (MRSA) infections is attributable to the disappearance of predominant MRSA ST239 clones, Shanghai, 2008–2017. Emerg. Microbes Infect. 2019, 8, 471–478. [Google Scholar] [CrossRef] [Green Version]
  29. Li, T.; Lu, H.; Wang, X.; Gao, Q.; Dai, Y.; Shang, J.; Li, M. Molecular Characteristics of Staphylococcus aureus Causing Bovine Mastitis between 2014 and 2015. Front. Cell. Infect. Microbiol. 2017, 7, 127. [Google Scholar] [CrossRef] [Green Version]
  30. Zhao, X.N.; Yuan, X.M.; Hu, M.; Zhang, Y.; Li, L.L.; Zhang, Q.; Yuan, X.X.; Wang, W.B.; Liu, Y.Q. Prevalence and charac-terization of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus isolated from bulk tank milk in Shandong dairy farms. Food Control 2021, 50, 688–695. [Google Scholar] [CrossRef] [Green Version]
  31. Brakstad, O.G.; Aasbakk, K.; Maeland, J.A. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 1992, 30, 1654–1660. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Peacock, S.J.; Paterson, G.K. Mechanisms of Methicillin Resistance in Staphylococcus aureus. Annu. Rev. Biochem. 2015, 84, 577–601. [Google Scholar] [CrossRef] [PubMed]
  33. Aiba, Y.; Katayama, Y.; Hishinuma, T.; Murakami-Kuroda, H.; Cui, L.; Hiramatsu, K. Mutation of RNA Polymerase beta-subunit Gene promotes heterogeneous-to-homogeneous conversion of beta-Lactam resistance in methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 2013, 57, 4861–4871. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Yu, D.; Zhao, L.; Xue, T.; Sun, B. Staphylococcus aureus autoinducer-2 quorum sensing decreases biofilm formation in an icaR-dependent manner. BMC Microbiol. 2012, 12, 288. [Google Scholar] [CrossRef] [Green Version]
  35. Xue, T.; Chen, X.; Shang, F. Short communication: Effects of lactose and milk on the expression of biofilm-associated genes in Staphylococcus aureus strains isolated from a dairy cow with mastitis. J. Dairy Sci. 2014, 97, 6129–6134. [Google Scholar] [CrossRef]
  36. Wang, W.; Lin, X.; Jiang, T.; Peng, Z.; Xu, J.; Yi, L.; Li, F.; Fanning, S.; Baloch, Z. Prevalence and Characterization of Staphylococcus aureus Cultured From Raw Milk Taken From Dairy Cows With Mastitis in Beijing, China. Front. Microbiol. 2018, 9, 1123. [Google Scholar] [CrossRef]
  37. Díez-García, M.; Capita, R.; Alonso-Calleja, C. Influence of serotype on the growth kinetics and the ability to form biofilms of Salmonella isolates from poultry. Food Microbiol. 2012, 31, 173–180. [Google Scholar] [CrossRef]
  38. Thiran, E.; Di Ciccio, P.A.; Graber, H.U.; Zanardi, E.; Ianieri, A.; Hummerjohann, J. Biofilm formation of Staphylococcus aureus dairy isolates representing different genotypes. J. Dairy Sci. 2018, 101, 1000–1012. [Google Scholar] [CrossRef] [Green Version]
  39. Ahmed, A.A.-H.; Maharik, N.M.S.; Valero, A.; Kamal, S.M. Incidence of enterotoxigenic Staphylococcus aureus in milk and Egyptian artisanal dairy products. Food Control 2019, 104, 20–27. [Google Scholar] [CrossRef]
  40. Fetsch, A.; Contzen, M.; Hartelt, K.; Kleiser, A.; Maassen, S.; Rau, J.; Kraushaar, B.; Layer, F.; Strommenger, B. Staphylococcus aureus food-poisoning outbreak associated with the consumption of ice-cream. Int. J. Food Microbiol. 2014, 187, 1–6. [Google Scholar] [CrossRef]
  41. Tang, J.; Tang, C.; Chen, J.; Du, Y.; Yang, X.N.; Wang, C.; Zhang, H.; Yue, H. Phenotypic Characterization and prevalence of enterotoxin genes in Staphylococcus aureus Isolates from outbreaks of illness in Chengdu City. Foodborne Pathog. Dis. 2011, 8, 1317–1320. [Google Scholar] [CrossRef] [PubMed]
  42. André, M.C.D.; Campos, M.R.H.; Borges, L.J.; Kipnis, A.; Pimenta, F.C.; Serafini, Á.B. Comparison of Staphylococcus aureus isolates from food handlers, raw bovine milk and Minas Frescal cheese by antibiogram and pulsed-field gel electrophoresis following SmaI digestion. Food Control 2008, 19, 200–207. [Google Scholar] [CrossRef]
  43. Johler, S.; Weder, D.; Bridy, C.; Huguenin, M.-C.; Robert, L.; Hummerjohann, J.; Stephan, R. Outbreak of staphylococcal food poisoning among children and staff at a Swiss boarding school due to soft cheese made from raw milk. J. Dairy Sci. 2015, 98, 2944–2948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Liu, H.; Li, S.; Meng, L.; Dong, L.; Zhao, S.; Lan, X.; Wang, J.; Zheng, N. Prevalence, antimicrobial susceptibility, and molecular characterization of Staphylococcus aureus isolated from dairy herds in northern China. J. Dairy Sci. 2017, 100, 8796–8803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Yang, X.; Yu, S.; Wu, Q.; Zhang, J.; Wu, S.; Rong, D. Multilocus Sequence Typing and Virulence-Associated Gene Profile Analysis of Staphylococcus aureus Isolates From Retail Ready-to-Eat Food in China. Front. Microbiol. 2018, 9, 197. [Google Scholar] [CrossRef]
  46. Entorf, M.; Feßler, A.T.; Kaspar, H.; Kadlec, K.; Peters, T.; Schwarz, S. Comparative erythromycin and tylosin susceptibility testing of streptococci from bovine mastitis. Vet. Microbiol. 2016, 194, 36–42. [Google Scholar] [CrossRef]
  47. Aslantaş, Ö.; Demir, C. Investigation of the antibiotic resistance and biofilm-forming ability of Staphylococcus aureus from subclinical bovine mastitis cases. J. Dairy Sci. 2016, 99, 8607–8613. [Google Scholar] [CrossRef] [Green Version]
  48. Li, H.; Tang, T.; Stegger, M.; Dalsgaard, A.; Liu, T.; Leisner, J.J. Characterization of antimicrobial-resistant Staphylococcus aureus from retail foods in Beijing, China. Food Microbiol. 2021, 93, 103603. [Google Scholar] [CrossRef]
  49. Shi, C.; Yu, Z.; Ho, H.; Wang, J.; Wu, W.; Xing, M.; Wang, Y.; Rahman, S.M.E.; Han, R. Occurrence, Antimicrobial Resistance Patterns, and Genetic Characterization of Staphylococcus aureus Isolated from Raw Milk in the Dairy Farms over Two Seasons in China. Microb. Drug Resist. 2021, 27, 99–110. [Google Scholar] [CrossRef]
  50. Haran, K.P.; Godden, S.M.; Boxrud, D.; Jawahir, S.; Bender, J.B.; Sreevatsan, S. Prevalence and characterization of Staphylococcus aureus, Including methicillin-resistant Staphylococcus aureus, Isolated from bulk tank milk from Minnesota Dairy farms. J. Clin. Microbiol. 2012, 50, 688–695. [Google Scholar] [CrossRef] [Green Version]
  51. Jamali, H.; Paydar, M.; Radmehr, B.; Ismail, S.; Dadrasnia, A. Prevalence and antimicrobial resistance of Staphylococcus aureus isolated from raw milk and dairy products. Food Control 2015, 54, 383–388. [Google Scholar] [CrossRef]
  52. Cilloniz, C.; Dominedò, C.; Gabarrús, A.; Garcia-Vidal, C.; Becerril, J.; Tovar, D.; Moreno, E.; Pericás, J.M.; Vargas, C.R.; Torres, A. Methicillin-susceptible Staphylococcus aureus in community-acquired pneumonia: Risk factors and outcomes. J. Infect. 2020, 82, 76–83. [Google Scholar] [CrossRef] [PubMed]
  53. Li, L.; Zhou, L.; Wang, L.; Xue, H.; Zhao, X. Characterization of Methicillin-resistant and -susceptible Staphylococcal isolates from Bovine milk in northwestern china. PLoS ONE 2015, 10, e0116699. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Wang, X.; Li, G.; Xia, X.; Yang, B.; Xi, M.; Meng, J. Antimicrobial Susceptibility and molecular typing of methicillin-resistant Staphylococcus aureus in retail foods in Shaanxi, China. Foodborne Pathog. Dis. 2014, 11, 281–286. [Google Scholar] [CrossRef]
  55. Bhargava, K.; Zhang, Y. Multidrug-resistant coagulase-negative Staphylococci in food animals. J. Appl. Microbiol. 2012, 113, 1027–1036. [Google Scholar] [CrossRef] [PubMed]
  56. Liu, J.; Bai, L.; Li, W.; Han, H.; Fu, P.; Ma, X.; Bi, Z.; Yang, X.; Zhang, X.; Zhen, S.; et al. Trends of foodborne diseases in China: Lessons from laboratory-based surveillance since 2011. Front. Med. 2018, 12, 48–57. [Google Scholar] [CrossRef]
  57. Lawrynowicz-Paciorek, M.; Kochman, M.; Piekarska, K.; Grochowska, A.; Windyga, B. The distribution of enterotoxin and enterotoxin-like genes in Staphylococcus aureus strains isolated from nasal carriers and food samples. Int. J. Food Microbiol. 2007, 117, 319–323. [Google Scholar] [CrossRef]
  58. Pinchuk, I.V.; Beswick, E.J.; Reyes, V.E. Staphylococcal enterotoxins. Toxins 2010, 2, 2177–2197. [Google Scholar] [CrossRef] [Green Version]
  59. Xing, X.; Zhang, Y.; Wu, Q.; Wang, X.; Ge, W.; Wu, C. Prevalence and characterization of Staphylococcus aureus isolated from goat milk powder processing plants. Food Control 2016, 59, 644–650. [Google Scholar] [CrossRef]
  60. Cai, H.; Kou, X.; Ji, H.; Wang, X.; Wang, H.; Zhang, Y.; Lu, S.; Li, B.; Dong, J.; Wang, Q.; et al. Prevalence and characteristics of Staphylococcus aureus isolated from Kazak cheese in Xinjiang, China. Food Control 2020, 123, 107759. [Google Scholar] [CrossRef]
  61. Chao, G.; Bao, G.; Cao, Y.; Yan, W.; Wang, Y.; Zhang, X.; Zhou, L.; Wu, Y. Prevalence and diversity of enterotoxin genes with genetic background of Staphylococcus aureus isolates from different origins in China. Int. J. Food Microbiol. 2015, 211, 142–147. [Google Scholar] [CrossRef] [PubMed]
  62. Cheng, J.; Wang, Y.; Cao, Y.; Yan, W.; Niu, X.; Zhou, L.; Chen, J.; Sun, Y.; Li, C.; Zhang, X.; et al. The Distribution of 18 Enterotoxin and Enterotoxin-Like Genes in Staphylococcus aureus Strains from Different Sources in East China. Foodborne Pathog. Dis. 2016, 13, 171–176. [Google Scholar] [CrossRef] [PubMed]
  63. Vázquez-Sánchez, D.; López-Cabo, M.; Saá-Ibusquiza, P.; Rodríguez-Herrera, J.J. Incidence and characterization of Staphylococcus aureus in fishery products marketed in Galicia (Northwest Spain). Int. J. Food Microbiol. 2012, 157, 286–296. [Google Scholar] [CrossRef] [Green Version]
  64. Xue, X.; Wang, J.; Mei, L.; Wang, Z.; Qi, K.; Yang, B. Recognition and enrichment specificity of Fe3O4 magnetic nanoparticles surface modified by chitosan and Staphylococcus aureus enterotoxins A antiserum. Colloids Surf. B Biointerfaces 2013, 103, 107–113. [Google Scholar] [CrossRef] [PubMed]
  65. Ma, D.; Mandell, J.B.; Donegan, N.P.; Cheung, A.L.; Ma, W.; Rothenberger, S.; Shanks, R.M.Q.; Richardson, A.R.; Urish, K.L. The Toxin-Antitoxin MazEF Drives Staphylococcus aureus Biofilm Formation, Antibiotic Tolerance, and Chronic Infection. mBio 2019, 10, e01658-19. [Google Scholar] [CrossRef] [Green Version]
  66. Zou, M.; Liu, D. A systematic characterization of the distribution, biofilm-forming potential and the resistance of the biofilms to the CIP processes of the bacteria in a milk powder processing factory. Food Res. Int. 2018, 113, 316–326. [Google Scholar] [CrossRef]
  67. Lee, S.H.; Mangolin, B.L.; Goncalves, J.L.; Neeff, D.V.; Silva, M.P.; Cruz, A.G.; Oliveira, C.A. Biofilm-producing ability of Staphylococcus aureus isolates from Brazilian dairy farms. J. Dairy Sci. 2014, 97, 1812–1816. [Google Scholar] [CrossRef]
  68. Merino, N.; Toledo-Arana, A.; Vergara-Irigaray, M.; Valle, J.; Solano, C.; Calvo, E.; Lopez, J.A.; Foster, T.J.; Penadés, J.R.; Lasa, I. Protein A-Mediated Multicellular Behavior in Staphylococcus aureus. J. Bacteriol. 2009, 191, 832–843. [Google Scholar] [CrossRef] [Green Version]
  69. Baum, C.; Haslinger-Löffler, B.; Westh, H.; Boye, K.; Peters, G.; Neumann, C.; Kahl, B.C. Non-spa-typeable clinical Staphylococcus aureus Strains are naturally occurring protein A mutants. J. Clin. Microbiol. 2009, 47, 3624–3629. [Google Scholar] [CrossRef] [Green Version]
  70. Liu, H.; Shang, W.; Hu, Z.; Zheng, Y.; Yuan, J.; Hu, Q.; Peng, H.; Cai, X.; Tan, L.; Li, S.; et al. A novel SigB(Q225P) mutation in Staphylococcus aureus retains virulence but promotes biofilm formation. Emerg. Microbes Infect. 2018, 7, 1–12. [Google Scholar] [CrossRef] [Green Version]
Foods 11 02185 g001 550
Figure 1. Antimicrobial susceptibility testing (AST), enterotoxin genes, mecA gene, biofilm formation, and molecular characterization of 50 S. aureus isolates from raw milk in Hefei, China. Fifty isolates were grouped into nine spa types. The results of AST are shown in different colors according to isolates’ diameter of inhibition zone in response to different antimicrobial agents. Blue squares indicate susceptibility, yellow squares indicate resistance. The detection of enterotoxin genes and mecA genes is summarized on a heat map. Red squares denote that the studied genes were detected in those isolates. Blue squares denote that those isolates lack the studied genes. The ability of isolates to form biofilms is shown in different colors. Brown squares represent strong biofilm isolates formed. Black squares represent moderate biofilm isolates formed. Antimicrobial agents used are abbreviated as follows: AMP = ampicillin; OXA = oxacillin; CN = gentamicin; KAN = kanamycin; TE = tetracycline; DOX = doxycycline; SXT = sulphamethoxazole-trimethoprim; CM = chloramphenicol; ERM = erythromycin; OFX = ofloxacin; VAN = vancomycin. All isolates were tested for antimicrobial susceptibility according to the guidelines of the CLSI.
Figure 1. Antimicrobial susceptibility testing (AST), enterotoxin genes, mecA gene, biofilm formation, and molecular characterization of 50 S. aureus isolates from raw milk in Hefei, China. Fifty isolates were grouped into nine spa types. The results of AST are shown in different colors according to isolates’ diameter of inhibition zone in response to different antimicrobial agents. Blue squares indicate susceptibility, yellow squares indicate resistance. The detection of enterotoxin genes and mecA genes is summarized on a heat map. Red squares denote that the studied genes were detected in those isolates. Blue squares denote that those isolates lack the studied genes. The ability of isolates to form biofilms is shown in different colors. Brown squares represent strong biofilm isolates formed. Black squares represent moderate biofilm isolates formed. Antimicrobial agents used are abbreviated as follows: AMP = ampicillin; OXA = oxacillin; CN = gentamicin; KAN = kanamycin; TE = tetracycline; DOX = doxycycline; SXT = sulphamethoxazole-trimethoprim; CM = chloramphenicol; ERM = erythromycin; OFX = ofloxacin; VAN = vancomycin. All isolates were tested for antimicrobial susceptibility according to the guidelines of the CLSI.
Foods 11 02185 g001
Foods 11 02185 g002 550
Figure 2. Biofilm formation ability of S. aureus NCTC8325 and 50 isolates. (A) As the positive control, detection of biofilm formation ability of S. aureus NCTC8325 by microtiter plate and a MicroELISA autoreader at a wavelength of 492 nm in single wavelength mode. (B) Detection of biofilm formation ability of 50 isolates by a MicroELISA autoreader at a wavelength of 492 nm in a single wavelength mode. Error bars indicate SD. The results represent the means of three independent experiments.
Figure 2. Biofilm formation ability of S. aureus NCTC8325 and 50 isolates. (A) As the positive control, detection of biofilm formation ability of S. aureus NCTC8325 by microtiter plate and a MicroELISA autoreader at a wavelength of 492 nm in single wavelength mode. (B) Detection of biofilm formation ability of 50 isolates by a MicroELISA autoreader at a wavelength of 492 nm in a single wavelength mode. Error bars indicate SD. The results represent the means of three independent experiments.
Foods 11 02185 g002
Table
Table 1. Oligonucleotide primers used in this study.
Table 1. Oligonucleotide primers used in this study.
GenePrimerPrimer Sequence (5′–3′)Product Size (bp)Reference or Source
16S27-FAGAGTTTGATCCTGGCTCAG1510This study
1492-RTACCTTGTTACGACTT
nucSAnuc-FAGTATATAGTGCAACTTCAAC448This study
SAnuc-RATCAGCGTTGTCTTCGCTCCAA
mecAmecA-FGTTGTAGTTGTCGGGTTT445This study
mecA-RCCACATTGTTTCGGTCTA
spaspa-1113F
spa-1514R		TAAAGACGATCCTTCGGTGAGC
CAGCAGTAGTGCCGTTTGCTT		variableRidom
seaGSEAR-1GGTTATCAATGTGCGGGTGG102[15]
GSEAR-2CGGCACTTTTTTCTCTTCGG
sebGSEBR-1GTATGGTGGTGTAACTGAGC164[15]
GSEBR-2CCAAATAGTGACGAGTTAGG
secGSECR-1AGATGAAGTAGTTGATGTGTATGG451[15]
GSECR-2CACACTTTTAGAATCAACCG
sedGSEDR-1CCAATAATAGGAGAAAATAAAAG278[15]
GSEDR-2ATTGGTATTTTTTTTCGTTC
seeSA-UTGTATGTATGGAGGTGTAAC213[15]
SA-E revGCCAAAGCTGTCTGAG
segSEG-FGTTAGAGGAGGTTTTATG198[15]
SEG-RTTCCTTCAACAGGTGGAGA
sehSEH-FCAACTGCTGATTTAGCTCAG173[15]
SEH-RCCCAAACATTAGCACCA
seiSEI-FGGCCACTTTATCAGGACA328[15]
SEI-RAACTTACAGGCAGTCCA
serSER 1AGATGTGTTTGGAATACCCTAT123[15]
SER 2CTATCAGCTGTGGAGTGCAT
seljSEJ-FGTTCTGGTGGTAAACCA131[15]
SEJ-RGCGGAACAACAGTTCTGA
selpSEP-FTCAAAAGACACCGCCAA396[15]
SEP-RATTGTCCTTGAGCACCA
Table
Table 2. Prevalence of S. aureus in raw milk of artisanal dairy retail stores in Hefei, China.
Table 2. Prevalence of S. aureus in raw milk of artisanal dairy retail stores in Hefei, China.
Monitoring
Period (Month)		No. of SamplesNo. of MRSA 1
Isolates		No. of Non-MRSA
Isolates		No. and Proportion of Positive Samples of S. aureus
106964450 (72.5%)
1 MRSA = methicillin-resistant S. aureus.
Table
Table 3. spa types of the isolated S. aureus.
Table 3. spa types of the isolated S. aureus.
spa Typespa Repeat SuccessionNo. and Proportion of Isolates
t390407-23-12-21-17-34-34-34-347 (14%)
t18907-23-12-21-17-344 (8%)
t443107-12-21-17-13-34-33-135 (10%)
t03408-16-02-25-02-25-34-24-2521 (42%)
t03015-12-16-02-24-243 (6%)
t52707-23-12-21-17-34-34-34-34-34-33-344 (8%)
t284407-16-34-33-342 (4%)
t26707-23-12-21-17-34-34-34-33-342 (4%)
t468226-34-34-34-33-342 (4%)
Table
Table 4. Distribution of enterotoxin genes.
Table 4. Distribution of enterotoxin genes.
Enterotoxin GenesIsolate Code No.Detection Rate
sea49, 504%
seb/0
sec2, 46, 476%
sed/0
see/0
seg/0
sei7, 264%
seh72%
ser46, 474%
selj46, 474%
selp7, 8, 9, 19, 34, 35, 4214%
Table
Table 5. Antimicrobial susceptibility of the study isolates to the 11 antimicrobial agents.
Table 5. Antimicrobial susceptibility of the study isolates to the 11 antimicrobial agents.
Antibiotic ClassAntimicrobialNo. and Proportion of Resistant Isolates
β-LactamsAmpicillin28 (56%)
Oxacillin7 (14%)
AminoglycosidesGentamicin11 (22%)
Kanamycin20 (40%)
TetracyclinesTetracycline12 (24%)
Doxycycline3 (6%)
SulfonamidesSulfamethoxazole-trimethoprim11 (22%)
ChloramphenicolChloramphenicol4 (8%)
GlycopeptidesVancomycin0 (0%)
MacrolidesErythromycin27 (54%)
QuinolonesOfloxacin9 (18%)
No resistance to an antimicrobial agent 8 (16%)
Resistant to 1 antimicrobial agent 5 (10%)
Resistant to 2 antimicrobial agents 8 (16%)
Multi-drug resistant 29 (58%)
Table
Table 6. Relationship between spa typing and MRSA.
Table 6. Relationship between spa typing and MRSA.
spa Type (No)No. of IsolatesNo. and Proportion of Positive Samples of MRSA
t390470 (0%)
t18940 (0%)
t443153 (60%)
t034210 (0%)
t03033 (100%)
t52740 (0%)
t284420 (0%)
t26720 (0%)
t468220 (0%)
Total506 (12%)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Wang, H.; Shen, J.; Zhu, C.; Ma, K.; Fang, M.; Li, B.; Wang, W.; Xue, T. Antibiotics Resistance and Virulence of Staphylococcus aureus Isolates Isolated from Raw Milk from Handmade Dairy Retail Stores in Hefei City, China. Foods 2022, 11, 2185. https://doi.org/10.3390/foods11152185

AMA Style

Wang H, Shen J, Zhu C, Ma K, Fang M, Li B, Wang W, Xue T. Antibiotics Resistance and Virulence of Staphylococcus aureus Isolates Isolated from Raw Milk from Handmade Dairy Retail Stores in Hefei City, China. Foods. 2022; 11(15):2185. https://doi.org/10.3390/foods11152185

Chicago/Turabian Style

Wang, Hui, Jiawei Shen, Chengfeng Zhu, Kai Ma, Mengcheng Fang, Bingbing Li, Wenhui Wang, and Ting Xue. 2022. "Antibiotics Resistance and Virulence of Staphylococcus aureus Isolates Isolated from Raw Milk from Handmade Dairy Retail Stores in Hefei City, China" Foods 11, no. 15: 2185. https://doi.org/10.3390/foods11152185

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop