Quantitative PCR Assays for the Strain-Specific Identification and Enumeration of Probiotic Strain Lacticaseibacillus rhamnosus X253
Abstract
:1. Introduction
2. Materials and Methods
2.1. SNP Analysis
2.2. Extraction of Nucleic Acids
2.3. Design of Quantitative PCR Primers and Probes
2.4. Specificity
2.5. Stability during Passage
2.6. Sensitivity and Efficiency
2.7. Repeatability and Reproducibility
2.8. Spiked Sample Assay
2.9. Actual Product Assay
3. Results
3.1. SNP Analysis and Specificity
3.2. Stability during Passage
3.3. Sensitivity and Efficiency
3.4. Repeatability and Reproducibility
3.5. Assay of the Spiked Sample
3.6. Assay of the Actual Sample
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hill, C.; Guarner, F.; Reid, G.; Gibson, G.R.; Merenstein, D.J.; Pot, B.; Morelli, L.; Canani, R.B.; Flint, H.J.; Salminen, S.; et al. The International Scientific Association for Probiotics and Prebiotics (ISAPP) consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepatol. 2014, 11, 506–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Vadder, F.; Kovatcheva-Datchary, P.; Goncalves, D.; Vinera, J.; Zitoun, C.; Duchampt, A.; Bäckhed, F.; Mithieux, G. Microbiota-generated metabolites promote metabolic benefits via gut-brain neural circuits. Cell 2014, 156, 84–96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wiest, R.; Albillos, A.; Trauner, M.; Bajaj, J.S.; Jalan, R. Targeting the gut-liver axis in liver disease. J. Hepatol. 2017, 67, 1084–1103. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oh, S. Probiotics in Dairy Products. In Beneficial Microorganisms in Food and Nutraceuticals; Liong, M.T., Ed.; Springer International Publishing: Cham, Switzerland, 2015; pp. 203–219. [Google Scholar]
- Silva, M.; Jacobus, N.V.; Deneke, C.; Gorbach, S.L. Antimicrobial substance from a human Lactobacillus strain. Antimicrob. Agents Chemother. 1987, 31, 1231–1233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Velez, M.P.; Petrova, M.I.; Lebeer, S.; Verhoeven, T.L.; Claes, I.; Lambrichts, I.; Tynkkynen, S.; Vanderleyden, J.; De Keersmaecker, S.C. Characterization of MabA, a modulator of Lactobacillus rhamnosus GG adhesion and biofilm formation. FEMS Immunol. Med. Microbiol. 2010, 59, 386–398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Keersmaecker, S.C.J.; Verhoeven, T.L.A.; Desair, J.; Marchal, K.; Vanderleyden, J.; Nagy, I. Strong antimicrobial activity of Lactobacillus rhamnosus GG against Salmonella typhimurium is due to accumulation of lactic acid. FEMS Microbiol. Lett. 2006, 259, 89–96. [Google Scholar] [CrossRef] [Green Version]
- Agamennone, V.; Krul, C.A.M.; Rijkers, G.; Kort, R. A practical guide for probiotics applied to the case of antibiotic-associated diarrhea in The Netherlands. BMC Gastroenterol. 2018, 18, 103. [Google Scholar] [CrossRef] [PubMed]
- Halttunen, T.; Collado, M.C.; El-Nezami, H.; Meriluoto, J.; Salminen, S. Combining strains of lactic acid bacteria may reduce their toxin and heavy metal removal efficiency from aqueous solution. Lett. Appl. Microbiol. 2008, 46, 160–165. [Google Scholar] [CrossRef]
- Huang, D.; Yang, B.; Chen, Y.; Stanton, C.; Ross, R.P.; Zhao, J.; Zhang, H.; Chen, W. Comparative genomic analyses of Lactobacillus rhamnosus isolated from Chinese subjects. Food Biosci. 2020, 36, 100659. [Google Scholar] [CrossRef]
- Flach, J.; van der Waal, M.B.; Kardinaal, A.F.M.; Schloesser, J.; Ruijschop, R.M.A.J.; Claassen, E. Probiotic research priorities for the healthy adult population: A review on the health benefits of Lactobacillus rhamnosus GG and Bifidobacterium animalis subspecies lactis BB-12. Cogent Food Agric. 2018, 4, 1452839. [Google Scholar] [CrossRef]
- Infante, D.D.; Segarra, O.O.; Redecillas, S.S.; Alvarez, M.M.; Miserachs, M.M. Modification of stool’s water content in constipated infants: Management with an adapted infant formula. Nutr. J. 2011, 10, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, C.H.; Liou, J.S.; Huang, L.; Watanabe, K. Developing novel species-specific DNA markers for PCR-based species identification of the Lactobacillus sakei group. Lett. Appl. Microbiol. 2018, 66, 138–144. [Google Scholar] [CrossRef] [PubMed]
- Ahlroos, T.; Tynkkynen, S. Quantitative strain-specific detection of Lactobacillus rhamnosus GG in human faecal samples by real-time PCR. J. Appl. Microbiol. 2009, 106, 506–514. [Google Scholar] [CrossRef] [PubMed]
- Jarocki, P.; Komoń-Janczara, E.; Glibowska, A.; Dworniczak, M.; Pytka, M.; Korzeniowska-Kowal, A.; Wzorek, A.; Kordowska-Wiater, M. Molecular routes to specific identification of the Lactobacillus casei group at the species, subspecies and strain level. Int. J. Mol. Sci. 2020, 21, 2694. [Google Scholar] [CrossRef]
- Huang, C.H.; Li, S.W.; Huang, L.; Watanabe, K. Identification and classification for the Lactobacillus casei group. Front. Microbiol. 2018, 9, 1974. [Google Scholar] [CrossRef] [PubMed]
- Fenster, K.; Freeburg, B.; Hollard, C.; Wong, C.; Laursen, R.R.; Ouwehand, A. The production and delivery of probiotics: A review of a practical approach. Microorganisms 2019, 7, 83. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- de Melo Pereira, G.V.; de Oliveira Coelho, B.; Magalhães Júnior, A.I.; Thomaz-Soccol, V.; Soccol, C.R. How to select a probiotic? A review and update of methods and criteria. Biotechnol. Adv. 2018, 36, 2060–2076. [Google Scholar] [CrossRef]
- Ouwehand, A.C.; Invernici, M.M.; Furlaneto, F.; Messora, M.R. Effectiveness of multi-strain versus single-strain probiotics: Current status and recommendations for the future. J. Clin. Gastroenterol. 2018, 52 (Suppl. S1), S35–S40. [Google Scholar] [CrossRef] [PubMed]
- Frampton, M.; Houlston, R. Generation of artificial FASTQ files to evaluate the performance of next-generation sequencing pipelines. PLoS ONE 2012, 7, e49110. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; 1000 Genome Project Data Processing Subgroup. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tarasov, A.; Vilella, A.J.; Cuppen, E.; Nijman, I.J.; Prins, P. Sambamba: Fast processing of NGS alignment formats. Bioinformatics 2015, 31, 2032–2034. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Li, S.; Nie, Q.; Dong, S.; Shao, Y.; Yang, X.; Wu, Y.; Yang, Y.; Zhong, W. Neoadjuvant crizotinib in resectable locally advanced non–small cell lung cancer with ALK rearrangement. J. Thorac. Oncol. 2019, 14, 726–731. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Emam, A.; Wu, X.; Xu, S.; Wang, L.; Liu, S.; Wang, B. Stalled replication fork protection limits cGAS–STING and P-body-dependent innate immune signalling. Nat. Cell Biol. 2022, 24, 1154–1164. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, R.; Zhang, W.; Ye, R.; Pan, Z.; Li, G.; Su, S. One-step multiplex TaqMan probe-based method for real-time PCR detection of four canine diarrhea viruses. Mol. Cell. Probes 2020, 53, 101618. [Google Scholar] [CrossRef] [PubMed]
- Herbel, S.R.; Lauzat, B.; von Nickisch-Rosenegk, M.; Kuhn, M.; Murugaiyan, J.; Wieler, L.H.; Guenther, S. Species-specific quantification of probiotic Lactobacilli in yoghurt by quantitative real-time PCR. J. Appl. Microbiol. 2013, 115, 1402–1410. [Google Scholar] [CrossRef]
- Broeders, S.; Huber, I.; Grohmann, L.; Berben, G.; Taverniers, I.; Mazzara, M.; Roosens, N.; Morisset, D. Guidelines for validation of qualitative real-time PCR methods. Trends Food Sci. Technol. 2014, 37, 115–126. [Google Scholar] [CrossRef]
- Wickens, K.; Black, P.; Stanley, T.V.; Mitchell, E.; Barthow, C.; Fitzharris, P.; Purdie, G.; Crane, J. A protective effect of Lactobacillus rhamnosus HN001 against eczema in the first 2 years of life persists to age 4 years. Clin. Exp. Allergy 2012, 42, 1071–1079. [Google Scholar] [CrossRef]
- Segers, M.E.; Lebeer, S. Towards a better understanding of Lactobacillus rhamnosus GG-host interactions. Microb. Cell Fact. 2014, 13 (Suppl. S1), S7. [Google Scholar] [CrossRef] [Green Version]
- Thang, C.L.; Baurhoo, B.; Boye, J.I.; Simpson, B.K.; Zhao, X. Effects of Lactobacillus rhamnosus GG supplementation on cow’s milk allergy in a mouse model. Allergy Asthma Clin. Immunol. 2011, 7, 20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nikoskelainen, S.; Ouwehand, A.; Salminen, S.; Bylund, G. Protection of rainbow trout (Oncorhynchus mykiss) from furunculosis by Lactobacillus rhamnosus. Aquaculture 2001, 198, 229–236. [Google Scholar] [CrossRef]
- Berni Canani, R.; Di Costanzo, M.; Bedogni, G.; Amoroso, A.; Cosenza, L.; Di Scala, C.; Granata, V.; Nocerino, R. Extensively hydrolyzed casein formula containing Lactobacillus rhamnosus GG reduces the occurrence of other allergic manifestations in children with cow’s milk allergy: 3-year randomized controlled trial. J. Allergy Clin. Immunol. 2017, 139, 1906–1913. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brandt, K.; Alatossava, T. Specific identification of certain probiotic Lactobacillus rhamnosus strains with PCR primers based on phage-related sequences. Int. J. Food Microbiol. 2003, 84, 189–196. [Google Scholar] [CrossRef]
- Zhang, C.; Yu, X.; Wang, D.; Gui, Y.; Wang, C.; Li, Q.; Wang, J.; Yin, B.; Pan, Z.; Gu, R. Rapid strain-specific identification of two Lactobacillus rhamnosus strains using PCR based on gene family analysis. LWT-Food Sci. Technol. 2021, 146, 111395. [Google Scholar] [CrossRef]
- Leu, F.P.; Hingorani, M.M.; Turner, J.; O’Donnell, M. The delta subunit of DNA polymerase III holoenzyme serves as a sliding clamp unloader in Escherichia coli. J. Biol. Chem. 2000, 275, 34609–34618. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- de Ronde, M.W.J.; Ruijter, J.M.; Lanfear, D.; Bayes-Genis, A.; Kok, M.G.M.; Creemers, E.E.; Pinto, Y.M.; Pinto-Sietsma, S.J. Practical data handling pipeline improves performance of qPCR-based circulating miRNA measurements. RNA 2017, 23, 811–821. [Google Scholar] [CrossRef] [PubMed]
- Zi, C.; Zeng, D.; Ling, N.; Dai, J.; Xue, F.; Jiang, Y.; Li, B. An improved assay for rapid detection of viable Staphylococcus aureus cells by incorporating surfactant and PMA treatments in qPCR. BMC Microbiol. 2018, 18, 132. [Google Scholar] [CrossRef] [PubMed]
Species | Strain | Assembly No. | Scaffold Number | Genome Size (Mb) |
---|---|---|---|---|
L. rhamnosus | X253 (ref) | GCA_018228745.1 | 1 | 2.99 |
1.032 | GCA_006151905.1 | 1 | 2.94 | |
4B15 | GCA_002158925.1 | 1 | 3.05 | |
ATCC 11443 | GCA_003433395.1 | 1 | 2.99 | |
ATCC 8530 | GCA_000233755.1 | 1 | 2.96 | |
B6 | GCA_016599675.2 | 1 | 2.92 | |
BFE5264 | GCA_001988935.1 | 2 | 3.11 | |
BIO5326 | GCA_009720565.1 | 1 | 2.99 | |
BIO6870 | GCA_008831425.1 | 1 | 3.01 | |
BPL5 | GCA_900070175.1 | 1 | 3.02 | |
DSM 14870 | GCA_002287945.1 | 1 | 3.01 | |
GG (ATCC 53103) | GCA_000026505.1 | 1 | 3.01 | |
HN001 | GCA_000173255.2 | 96 | 2.91 | |
hsryfm 1301 | GCA_008727835.1 | 2 | 3.07 | |
JL-1 | GCA_015238575.1 | 1 | 3.01 | |
KF7 | GCA_016653515.1 | 4 | 3.25 | |
Lc 705 | GCA_000026525.1 | 2 | 3.03 | |
LOCK900 | GCA_000418475.1 | 1 | 2.88 | |
LOCK908 | GCA_000418495.1 | 1 | 2.99 | |
LR5 | GCA_002286235.1 | 1 | 2.97 | |
LRB | GCA_001721925.1 | 1 | 3.01 | |
LR-B1 | GCA_004010975.1 | 1 | 2.92 | |
LV108 | GCA_013167115.1 | 1 | 3.01 | |
MGYG-HGUT-01293 | GCA_902381635.1 | 1 | 2.99 | |
NCTC13710 | GCA_900636875.1 | 1 | 2.99 | |
NCTC13764 | GCA_900636965.1 | 94 | 2.98 | |
Pen | GCA_002076955.1 | 1 | 2.88 | |
R0011 | GCA_000235785.2 | 10 | 2.90 | |
SCT-10-10-60 | GCA_002960215.1 | 1 | 2.99 | |
TK-F8B | GCA_015377485.1 | 3 | 3.06 |
Gene | Primers and Probe | Length (bp) |
---|---|---|
holA | GGTTGGTCGTTTGCCTTATCA | 61 |
TTCAGTATCCACCAGCCCACTA | ||
FAM-ACTGGCCCATGCTT-BHQ1 |
Species | Strain | Source |
---|---|---|
Lacticaseibacillus rhamnosus | X253 | Isolated |
GG | Danisco | |
HN001 | Danisco | |
ATCC 7469 | CICC 1 | |
ATCC 8530 | CICC | |
ATCC 11443 | CICC | |
Lacticaseibacillus casei | Lc-11 | Danisco |
Lacticaseibacillus paracasei | Lpc-37 | Danisco |
Bifidobacterium animalis subsp. lactis | Bb-12 | Danisco |
Bi-07 | Danisco | |
HN019 | Danisco | |
DSMZ 10140 | Danisco | |
Lactobacillus acidophilus | NCFM | Danisco |
La-14 | Danisco | |
AS1.2686 | Danisco | |
Lp-115 | Danisco | |
Lactococcus lactis subsp. lactis | CICC 6246 | CICC |
Lactococcus lactis subsp. cremoris | CICC 20407 | CICC |
Lactococcus lactis subsp. hordniae | CICC 21034 | CICC |
Ligilactobacillus salivarius | Ls-33 | Danisco |
Lactobacillus delbrueckii subsp. bulgaricus | CICC 6097 | CICC |
Number of Generations | Cq | Mean Cq | RSD (%) | ||
---|---|---|---|---|---|
5 | 18.63 | 19.40 | 18.70 | 18.91 | 0.41 |
9 | 18.77 | 18.71 | 19.51 | 19.00 | |
15 | 19.27 | 18.69 | 18.63 | 18.86 | |
19 | 18.81 | 18.69 | 18.95 | 18.82 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, L.; Zhang, D.; Liu, Y.; Zhang, Y.-N.; Meng, D.-Q.; Xu, Q.; Zhong, J.; Jiang, Q.-Y.; Zhao, Y.; Wang, S.-J. Quantitative PCR Assays for the Strain-Specific Identification and Enumeration of Probiotic Strain Lacticaseibacillus rhamnosus X253. Foods 2022, 11, 2282. https://doi.org/10.3390/foods11152282
Zhao L, Zhang D, Liu Y, Zhang Y-N, Meng D-Q, Xu Q, Zhong J, Jiang Q-Y, Zhao Y, Wang S-J. Quantitative PCR Assays for the Strain-Specific Identification and Enumeration of Probiotic Strain Lacticaseibacillus rhamnosus X253. Foods. 2022; 11(15):2282. https://doi.org/10.3390/foods11152282
Chicago/Turabian StyleZhao, Lei, Dong Zhang, Yang Liu, Yi-Nan Zhang, Dong-Qing Meng, Qiong Xu, Jiang Zhong, Qiu-Yue Jiang, Yu Zhao, and Shi-Jie Wang. 2022. "Quantitative PCR Assays for the Strain-Specific Identification and Enumeration of Probiotic Strain Lacticaseibacillus rhamnosus X253" Foods 11, no. 15: 2282. https://doi.org/10.3390/foods11152282