Stress Response Mechanisms of Salmonella Enteritidis to Sodium Hypochlorite at the Proteomic Level
Abstract
:1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. Effect of Sodium Hypochlorite on Bacterial Survival Ability
2.3. Quantification of Intracellular Reactive Oxygen Species (ROS)
2.4. Protein Extraction, Quantification, and Digestion
2.5. TMT Labeling and High-pH Pre-fractionation
2.6. Nano-Liquid Chromatography-Mass Spectrometry/Mass Spectrometry Analysis
2.7. Peptide Analysis and Protein Identification
2.8. Bioinformatics Analysis
2.9. Gene Expression Analysis
2.10. Membrane Fatty Acid Composition Analysis
2.11. Swimming Motility Assay
2.12. Statistical Analysis
3. Results and Discussion
3.1. Selection for the Sublethal Concentration of Sodium Hypochlorite to Treat S. Enteritidis
3.2. ROS Production in S. Enteritidis in Response to Sodium Hypochlorite
3.3. Overview of Quantitative Proteomics Results
3.4. Comparision between Proteomics Data and Gene Expression Profiles
3.5. Functional Characterization of Differentially Abundant Proteins
3.5.1. Cellular Metabolism
3.5.2. Two-Component System
3.5.3. ABC Transporter
3.5.4. Phosphotransferase System
3.5.5. Flagellar Assembly
3.6. Fatty Acid Composition in S. Enteritidis in Response to Sodium Hypochlorite
3.7. Flagellar Motility in S. Enteritidis in Response to Sodium Hypochlorite
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Moe, A.Z.; Paulsen, P.; Pichpol, D.; Fries, R.; Irsigler, H.; Baumann, M.P.O.; Oo, K.N. Prevalence and antimicrobial resistance of Salmonella isolates from chicken carcasses in retail markets in Yangon, Myanmar. J. Food Prot. 2017, 80, 947–951. [Google Scholar] [CrossRef]
- Mezal, E.H.; Sabol, A.; Khan, M.A.; Ali, N.; Stefanova, R.; Khan, A.A. Isolation and molecular characterization of Salmonella enterica serovar Enteritidis from poultry house and clinical samples during 2010. Food Microbiol. 2014, 38, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Pearce, M.E.; Alikhan, N.F.; Dallman, T.J.; Zhou, Z.; Grant, K.; Maiden, M.C.J. Comparative analysis of core genome MLST and SNP typing within a European Salmonella serovar Enteritidis outbreak. Int. J. Food Microbiol. 2018, 274, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Humphrey, T. Salmonella, stress responses and food safety. Nat. Rev. Microbiol. 2004, 2, 504–509. [Google Scholar] [CrossRef] [PubMed]
- Ricke, S.C.; Dawoud, T.M.; Kim, S.A.; Park, S.H.; Kwon, Y.M. Salmonella cold stress response: Mechanisms and occurrence in foods. Adv. Appl. Microbiol. 2018, 104, 1–38. [Google Scholar] [PubMed]
- Byun, K.H.; Han, S.H.; Yoon, J.; Park, S.H.; Ha, S.D. Efficacy of chlorine-based disinfectants (sodium hypochlorite and chlorine dioxide) on Salmonella Enteritidis planktonic cells, biofilms on food contact surfaces and chicken skin. Food Control 2021, 123, 107838. [Google Scholar] [CrossRef]
- Van Houdt, R.; Michiels, C.W. Biofilm formation and the food industry, a focus on the bacterial outer surface: Biofilm formation and the bacterial outer surface. J. Appl. Microbiol. 2010, 109, 1117–1131. [Google Scholar] [CrossRef]
- Wang, S.; Phillippy, A.M.; Deng, K.; Rui, X.; Li, Z.; Tortorello, M.L.; Zhang, W. Transcriptomic responses of Salmonella enterica serovars Enteritidis and Typhimurium to chlorine-based oxidative stress. Appl. Environ. Microbiol. 2010, 76, 5013–5024. [Google Scholar] [CrossRef]
- Capita, R.; Buzón-Durán, L.; Riesco-Peláez, F.; Alonso-Calleja, C. Effect of sub-lethal concentrations of biocides on the structural parameters and viability of the biofilms formed by Salmonella Typhimurium. Foodborne Pathog. Dis. 2017, 14, 350–356. [Google Scholar] [CrossRef]
- Wang, S.; Deng, K.; Zaremba, S.; Deng, X.; Lin, C.; Wang, Q.; Tortorello, M.L.; Zhang, W. Transcriptomic response of Escherichia coli O157:H7 to oxidative stress. Appl. Environ. Microbiol. 2009, 75, 6110–6123. [Google Scholar] [CrossRef] [Green Version]
- Cabezas, C.E.; Briones, A.C.; Aguirre, C.; Pardo-Esté, C.; Castro-Severyn, J.; Salinas, C.R.; Baquedano, M.S.; Hidalgo, A.A.; Fuentes, J.A.; Morales, E.H.; et al. The transcription factor SlyA from Salmonella Typhimurium regulates genes in response to hydrogen peroxide and sodium hypochlorite. Res. Microbiol. 2018, 169, 263–278. [Google Scholar] [CrossRef] [PubMed]
- Collao, B.; Morales, E.H.; Gil, F.; Polanco, R.; Calderón, I.L.; Saavedra, C.P. Differential expression of the transcription factors MarA, Rob, and SoxS of Salmonella Typhimurium in response to sodium hypochlorite: Down-regulation of rob by MarA and SoxS. Arch. Microbiol. 2012, 194, 933–942. [Google Scholar] [CrossRef] [PubMed]
- Arunima, A.; Yelamanchi, S.D.; Padhi, C.; Jaiswal, S.; Ryan, D.; Gupta, B.; Sathe, G.; Advani, J.; Gowda, H.; Prasad, T.S.K.; et al. “Omics” of food-borne gastroenteritis: Global proteomic and mutagenic analysis of Salmonella enterica serovar Enteritidis. OMICS 2017, 21, 571–583. [Google Scholar] [CrossRef] [PubMed]
- He, S.; Qin, X.; Wong, C.W.Y.; Shi, C.; Wang, S.; Shi, X. Ethanol adaptation strategies in Salmonella enterica serovar Enteritidis revealed by global proteomic and mutagenic analyses. Appl. Environ. Microbiol. 2019, 85, e01107–e01119. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Yu, Y.; Lv, Z.; Shen, J.; Ke, Y.; Xiao, X. Proteomics study unveils ROS balance in acid-adapted Salmonella Enteritidis. Food Microbiol. 2020, 92, 103585. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Wang, W.; Zhang, R.; Xu, J.; Wang, R.; Wang, L.; Zhao, X.; Li, J. First acetyl-proteome profiling of Salmonella Typhimurium revealed involvement of lysine acetylation in drug resistance. Vet. Microbiol. 2018, 226, 1–8. [Google Scholar] [CrossRef]
- Maserati, A.; Lourenco, A.; Diez-Gonzalez, F.; Fink, R.C. iTRAQ-based global proteomic analysis of Salmonella enterica serovar Typhimurium in response to desiccation, low water activity, and thermal treatment. Appl. Environ. Microbiol. 2018, 84, e00393-18. [Google Scholar] [CrossRef] [PubMed]
- He, S.; Cui, Y.; Qin, X.; Zhang, F.; Shi, C.; Paoli, G.C.; Shi, X. Influence of ethanol adaptation on Salmonella enterica serovar Enteritidis survival in acidic environments and expression of acid tolerance-related genes. Food Microbiol. 2018, 72, 193–198. [Google Scholar] [CrossRef]
- Qin, X.; Dong, R.; He, S.; Zhou, X.; Zhang, Z.; Cui, Y.; Shi, X. Characterization of the role of ybgC in lysozyme resistance of Salmonella Enteritidis. Food Control 2020, 109, 106732. [Google Scholar] [CrossRef]
- He, S.; Zhan, Z.; Shi, C.; Wang, S.; Shi, X. Ethanol at subinhibitory concentrations enhances biofilm formation in Salmonella Enteritidis. Foods 2022, 11, 2237. [Google Scholar] [CrossRef]
- Zhong, Q.; Tian, J.; Wang, J.; Fang, X.; Liao, Z. iTRAQ-based proteomic analysis of the viable but nonculturable state of Vibrio parahaemolyticus ATCC 17802 induced by food preservative and low temperature. Food Control 2018, 85, 369–375. [Google Scholar] [CrossRef]
- Baron, F.; Bonnassie, S.; Alabdeh, M.; Cochet, M.F.; Nau, F.; Guérin-Dubiard, C.; Gautier, M.; Andrews, S.C.; Jan, S. Global gene-expression analysis of the response of Salmonella Enteritidis to egg white exposure reveals multiple egg white-imposed stress responses. Front. Microbiol. 2017, 8, 829. [Google Scholar] [CrossRef] [PubMed]
- He, S.; Cui, Y.; Dong, R.; Chang, J.; Cai, H.; Liu, H.; Shi, X. Global transcriptomic analysis of ethanol tolerance response in Salmonella Enteritidis. Curr. Res. Food Sci. 2022, 5, 798–806. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Yu, Y.; Zhou, D.; Li, R.; Xiao, X.; Wu, H. Global transcriptomic acid tolerance response in Salmonella Enteritidis. LWT-Food Sci. Technol. 2018, 92, 330–338. [Google Scholar] [CrossRef]
- Dunn, L.L.; Smith, D.M.; Critzer, F.J. Transcriptomic behavior of Salmonella enterica Newport in response to oxidative sanitizers. J. Food Prot. 2020, 83, 221–232. [Google Scholar] [CrossRef]
- Murret-Labarthe, C.; Kerhoas, M.; Dufresne, K.; Daigle, F. New roles for two-component system response regulators of Salmonella enterica serovar Typhi during host cell interactions. Microorganisms 2020, 8, 722. [Google Scholar] [CrossRef]
- Teplitski, M.; Al-Agely, A.; Ahmer, B.M.M. Contribution of the SirA regulon to biofilm formation in Salmonella enterica serovar Typhimurium. Microbiology 2006, 152, 3411–3424. [Google Scholar] [CrossRef]
- de Pina, L.C.; da Silva, F.S.H.; Galvão, T.C.; Pauer, H.; Ferreira, R.B.R.; Antunes, L.C.M. The role of two-component regulatory systems in environmental sensing and virulence in Salmonella. Crit. Rev. Microbiol. 2021, 47, 397–434. [Google Scholar] [CrossRef]
- Cha, H.; Pos, K.M. Cooperative transport mechanism and proton-coupling in the multidrug efflux transporter complex ArcAB-TolC. In Membrane Transport Mechanism: 3D Structure and Beyond; Springer: Berlin/Heidelberg, Germany, 2014; pp. 207–232. [Google Scholar]
- Christensen, O.; Harvat, E.M.; Thöny-Meyer, L.; Ferguson, S.J.; Stevens, J.M. Loss of ATP hydrolysis activity by CcmAB results in loss of c-type cytochrome synthesis and incomplete processing of CcmE. FEBS J. 2007, 274, 2322–2332. [Google Scholar] [CrossRef]
- Radford, D.; Strange, P.; Lepp, D.; Hernandez, M.; Rehman, M.A.; Diarra, M.S.; Balamurugan, S. Genomic and proteomic analyses of Salmonella enterica serovar Enteritidis identifying mechanisms of induced de novo tolerance to ceftiofur. Front. Microbiol. 2018, 9, 2123. [Google Scholar] [CrossRef] [Green Version]
- Elgrably-Weiss, M.; Park, S.; Schlosser-Silverman, E.; Rosenshine, I.; Imlay, J.; Altuvia, S.A. Salmonella enterica serovar Typhimurium hema mutant is highly susceptible to oxidative DNA damage. J. Bacteriol. 2002, 184, 3774–3784. [Google Scholar] [CrossRef] [PubMed]
- Bowden, S.D.; Rowley, G.; Hinton, J.C.D.; Thompson, A. Glucose and glycolysis are required for the successful infection of macrophages and mice by Salmonella enterica serovar Typhimurium. Infect. Immun. 2009, 77, 3117–3126. [Google Scholar] [CrossRef] [PubMed]
- Okochi, M.; Kurimoto, M.; Shimizu, K.; Honda, H. Increase of organic solvent tolerance by overexpression of manXYZ in Escherichia coli. Appl. Microbiol. Biotechnol. 2007, 73, 1394–1399. [Google Scholar] [CrossRef] [PubMed]
- Pomposiello, P.J.; Bennik, M.H.J.; Demple, B. Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate. J. Bacteriol. 2001, 183, 3890–3902. [Google Scholar] [CrossRef]
- Li, H.; Bhaskara, A.; Megalis, C.; Tortorello, M.L. Transcriptomic analysis of Salmonella desiccation resistance. Foodborne Pathog. Dis. 2012, 9, 1143–1151. [Google Scholar] [CrossRef]
- Cui, X.; Hu, C.; Ou, L.; Kuramitsu, Y.; Masuda, Y.; Honjoh, K.; Miyamoto, T. Transcriptional analysis on heat resistance and recovery from thermal damage in Salmonella under high salt condition. LWT-Food Sci. Technol. 2019, 106, 194–200. [Google Scholar] [CrossRef]
- Finn, S.; Händler, K.; Condell, O.; Colgan, A.; Cooney, S.; McClure, P.; Amézquita, A.; Hinton, J.C.D.; Fanning, S. Prop is required for the survival of desiccated Salmonella enterica serovar Typhimurium cells on a stainless steel surface. Appl. Environ. Microbiol. 2013, 79, 4376–4384. [Google Scholar] [CrossRef]
- Ryan, D.; Pati, N.B.; Ojha, U.K.; Padhi, C.; Ray, S.; Jaiswal, S.; Singh, G.P.; Mannala, G.K.; Schultze, T.; Chakraborty, T.; et al. Global transcriptome and mutagenic analyses of the acid tolerance response of Salmonella enterica serovar Typhimurium. Appl. Environ. Microbiol. 2015, 81, 8054–8065. [Google Scholar] [CrossRef]
- Yoon, Y.; Lee, H.; Lee, S.; Kim, S.; Choi, K.H. Membrane fluidity-related adaptive response mechanisms of foodborne bacterial pathogens under environmental stresses. Food Res. Int. 2015, 72, 25–36. [Google Scholar] [CrossRef]
- Yang, Y.; Kadim, M.I.; Khoo, W.J.; Zheng, Q.; Setyawati, M.I.; Shin, Y.J.; Yuk, H.G. Membrane lipid composition and stress/virulence related gene expression of Salmonella Enteritidis cells adapted to lactic acid and trisodium phosphate and their resistance to lethal heat and acid stress. Int. J. Food Microbiol. 2014, 191, 24–31. [Google Scholar] [CrossRef]
- Lories, B.; Belpaire, T.E.; Yssel, A.; Ramon, H.; Steenackers, H.P. Agaric acid reduces Salmonella biofilm formation by inhibiting flagellar motility. Biofilm 2020, 2, 100022. [Google Scholar] [CrossRef] [PubMed]
Gene | Sequence (5′ to 3′) |
---|---|
16S rRNA | F: CAGAAGAAGCACCGGCTAAC |
R: GACTCAAGCCTGCCAGTTTC | |
cbiG | F: TCCCGTACTGCACTGGAAAC |
R: CTTTTAACGCCAGCGGATCG | |
cysD | F: TCAATCCGTTCGTTCACGGT |
R: GGATTTTTCCTCATCGCGCC | |
fliS | F: CGATGTTGTCGCGAAAGGTG |
R: CGCAATCTCACCGCCTTTTT | |
fliZ | F: TGCAGGACGGTTTTCTCGAT |
R: CTGGCGGTAAAGGGGGATTT | |
folA | F: CGATGCGCCGGAAATTATGG |
R: CCGGAAAATGGGTATCGCCT | |
glpA | F: CATGTCATTAACCGCTGCCG |
R: TCGACTTCATCTGCGGTGAC | |
ilvM | F: CGGTCGGTCGACTTACTGTT |
R: TTTGTTGTGATGTGGCAGCG | |
pckA | F: ACGCAGTATGCTGAAGTGCT |
R: TTGCGCGCGTATCTTTGATG | |
pgtP | F: TGGTACTCTGCGCGATTGTT |
R: ATTGAAGACCACCAGAGCGG | |
rfaY | F: AGAAGGGTTTACGGCGCTTA |
R: TCCCTCTCACCTCGTCAGAA | |
rpmE2 | F: CGACACCAGCGCAAATGAAT |
R: GATATGTCACGCCGTCCAGT | |
speF | F: ATTGATGGTAAGCCGTGGCA |
R: TGTTCTCCCGGAACGAAGTG | |
tdcD | F: GAAAAAGCCTGGCACGAAGG |
R: CCATCCAGCCGATGTAACGA | |
znuA | F: CATTGCTGATGGCGTTACGG |
R: CGCCCTGTAAGCGTTTTACG |
Fatty Acid | Control Group | Treated Group |
---|---|---|
C12:0 | 1.99 ± 0.31 | 6.25 ± 2.39 * |
C14:0 | 4.94 ± 0.20 | 2.56 ± 0.68 |
C14:1n5 | 0.45 ± 0.13 | 3.46 ± 2.17 |
C15:0 | 18.03 ± 3.65 | 32.80 ± 2.08 * |
C16:0 | 36.89 ± 0.23 | 34.40 ± 7.63 |
C16:1n6 | 10.90 ± 1.67 | 3.61 ± 0.46 * |
C17:0 | 1.07 ± 0.59 | 2.69 ± 0.37 |
C17:1n7 | 3.94 ± 1.49 | 0.99 ± 0.56 |
C18:0 | 7.70 ± 1.80 | 11.64 ± 3.15 |
C18:1n9c | 14.11 ± 2.42 | 1.61 ± 1.95 * |
UFA/SFA ratio | 0.39 ± 0.04 | 0.09 ± 0.03 * |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, D.; He, S.; Dong, R.; Cui, Y.; Shi, X. Stress Response Mechanisms of Salmonella Enteritidis to Sodium Hypochlorite at the Proteomic Level. Foods 2022, 11, 2912. https://doi.org/10.3390/foods11182912
Li D, He S, Dong R, Cui Y, Shi X. Stress Response Mechanisms of Salmonella Enteritidis to Sodium Hypochlorite at the Proteomic Level. Foods. 2022; 11(18):2912. https://doi.org/10.3390/foods11182912
Chicago/Turabian StyleLi, Danhong, Shoukui He, Rui Dong, Yan Cui, and Xianming Shi. 2022. "Stress Response Mechanisms of Salmonella Enteritidis to Sodium Hypochlorite at the Proteomic Level" Foods 11, no. 18: 2912. https://doi.org/10.3390/foods11182912
APA StyleLi, D., He, S., Dong, R., Cui, Y., & Shi, X. (2022). Stress Response Mechanisms of Salmonella Enteritidis to Sodium Hypochlorite at the Proteomic Level. Foods, 11(18), 2912. https://doi.org/10.3390/foods11182912