Piperine Derived from Piper nigrum L. Inhibits LPS-Induced Inflammatory through the MAPK and NF-κB Signalling Pathways in RAW264.7 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Chemicals
2.2. Extraction and Purification of Piperine
2.3. HPLC Determination of Piperine Purity
2.4. UPLC-Q-TOF-MS Analysis of Piperine
2.5. NMR Analysis
2.6. Cell Culture Conditions
2.7. Piperine Cytotoxicity Analysis
2.7.1. MTT Assay
2.7.2. LDH Assay
2.8. Morphological Observation of RAW 264.7 Cells
2.9. Determination of NO Content
2.10. ROS Levels
2.11. Measurement of Inflammatory Cytokines
2.12. RT–qPCR Analysis of Inflammatory Cytokines
2.13. Western Blot Analysis
2.14. Statistical Analysis
3. Results
3.1. HPLC and UPLC-Q-TOF-MS Analysis of Piperine
3.2. Cell Cytotoxicity and Microscopic Morphology of RAW264.7 Cells
3.3. Determination of NO Production and ROS Levels
3.4. Measurement of Inflammatory Cytokines
3.5. RT–qPCR Analysis of Inflammatory Cytokines
3.6. Effect of Piperine in the MAPK and NF-κB Signalling Pathways
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhu, F.; Mojel, R.; Li, G. Physicochemical properties of black pepper (Piper nigrum) starch. Carbohyd Polym. 2018, 181, 986–993. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Hu, X.; Xu, R.; Ba, Y.; Chen, X.; Wang, X.; Cao, B.; Wu, X. Amide alkaloids characterization and neuroprotective properties of Piper nigrum L.: A comparative study with fruits, pericarp, stalks and leaves. Food Chem. 2022, 368, 130832. [Google Scholar] [CrossRef] [PubMed]
- Bae, G.S.; Kim, M.S.; Jung, W.S.; Seo, S.W.; Yun, S.W.; Kim, S.G.; Park, R.K.; Kim, E.C.; Song, H.J.; Park, S.J. Inhibition of lipopolysaccharide-induced inflammatory responses by piperine. Eur. J. Pharmacol. 2010, 642, 154–162. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Krstin, S.; Wang, S.; Wink, M. Capsaicin and Piperine Can Overcome Multidrug Resistance in Cancer Cells to Doxorubicin. Molecules 2018, 23, 557. [Google Scholar] [CrossRef] [PubMed]
- Tasleem, F.; Azhar, I.; Ali, S.N.; Perveen, S.; Mahmood, Z.A. Analgesic and anti-inflammatory activities of Piper nigrum L. Asian Pac. J. Trop. Med. 2014, 7, S461–S468. [Google Scholar] [CrossRef]
- Yaffe, P.B.; Doucette, C.D.; Walsh, M.; Hoskin, D.W. Piperine impairs cell cycle progression and causes reactive oxygen species-dependent apoptosis in rectal cancer cells. Exp. Mol. Pathol. 2013, 94, 109–114. [Google Scholar] [CrossRef]
- Takooree, H.; Aumeeruddy, M.Z.; Rengasamy, K.R.R.; Venugopala, K.N.; Jeewon, R.; Zengin, G.; Mahomoodally, M.F. A systematic review on black pepper (Piper nigrum L.): From folk uses to pharmacological applications. Crit. Rev. Food Sci. 2019, 59, S210–S243. [Google Scholar] [CrossRef]
- Hritcu, L.; Noumedem, J.A.; Cioanca, O.; Hancianu, M.; Postu, P.; Mihasan, M. Anxiolytic and antidepressant profile of the methanolic extract of Piper nigrum fruits in beta-amyloid (1–42) rat model of Alzheimer’s disease. Behav. Brain Funct. 2015, 11, 13. [Google Scholar] [CrossRef]
- Nguyen, P.H.; Zhao, B.T.; Lee, J.H.; Kim, Y.H.; Min, B.S.; Woo, M.H. Isolation of benzoic and cinnamic acid derivatives from the grains of Sorghum bicolor and their inhibition of lipopolysaccharide-induced nitric oxide production in RAW 264.7 cells. Food Chem. 2015, 168, 512–519. [Google Scholar] [CrossRef]
- Godara, R.; Verma, M.; Katoch, R.; Yadav, A.; Dutt, P.; Satti, N.K.; Katoch, M. In vitro acaricidal activity of Piper nigrum and Piper longum fruit extracts and their active components against Rhipicephalus (Boophilus) microplus ticks. Exp. Appl. Acarol. 2018, 75, 333–343. [Google Scholar] [CrossRef]
- Feng, Q.; Chen, W.D.; Wang, Y.D. Gut Microbiota: An Integral Moderator in Health and Disease. Front Microbiol. 2018, 9, 151. [Google Scholar] [CrossRef] [PubMed]
- Hou, X.F.; Pan, H.; Xu, L.H.; Zha, Q.B.; He, X.H.; Ouyang, D.Y. Piperine Suppresses the Expression of CXCL8 in Lipopolysaccharide-Activated SW480 and HT-29 Cells via Downregulating the Mitogen-Activated Protein Kinase Pathways. Inflammation 2015, 38, 1093–1102. [Google Scholar] [CrossRef]
- Ying, X.; Yu, K.; Chen, H.; Chen, J.; Hong, S.; Cheng, S.; Peng, L. Piperine inhibits LPS induced expression of inflammatory mediators in RAW 264.7 cells. Cell Immunol. 2013, 289, 49–54. [Google Scholar] [CrossRef]
- Medzhitov, R. Origin and physiological roles of inflammation. Nature 2008, 454, 428–435. [Google Scholar] [CrossRef] [PubMed]
- Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in Inflammatory Disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Liu, Z.; Li, L.; Zhang, J.; Zhao, Q.; Lin, N.; Zhong, W.Z.; Jiang, M. Immunomodulatory effects of the polysaccharide from Sinonovacula constricta on RAW264.7 macrophage cells. Food Sci. Nutr. 2022, 10, 1093–1102. [Google Scholar] [CrossRef] [PubMed]
- Xiang, L.; Hu, Y.F.; Wu, J.; Wang, L.; Huang, W.G.; Xu, C.S.; Meng, X.L.; Wang, P. Semi-Mechanism-Based Pharmacodynamic Model for the Anti-Inflammatory Effect of Baicalein in LPS-Stimulated RAW264.7 Macrophages. Front. Pharmacol. 2018, 9, 793. [Google Scholar] [CrossRef]
- Hilliard, A.; Mendonca, P.; Soliman, K.A. Involvement of NF-κB and MAPK signaling pathways in the preventive effects of Ganoderma lucidum on the inflammation of BV-2 microglial cells induced by LPS. J. Neuroimmunol. 2020, 345, 577269. [Google Scholar] [CrossRef]
- Wang, J.; Wang, H.; Zhang, H.; Liu, Z.; Ma, C.; Kang, W. Immunomodulation of ADPs-1a and ADPs-3a on RAW264.7 cells through NF-κB/MAPK signaling pathway. Int. J. Biol. Macromol. 2019, 132, 1024–1030. [Google Scholar] [CrossRef]
- Zhao, M.; Mei, F.; Lu, J.; Xiang, Q.; Xia, G.; Zhang, X. Gadus morhua Eggs Sialoglycoprotein Prevent Estrogen Deficiency-Induced High Bone Turnover by Controlling OPG/RANKL/TRAF6 Pathway and Serum Metabolism. Front. Nutr. 2022, 9, 871521. [Google Scholar] [CrossRef]
- Zhu, Y.; Liu, S.; Mei, F.; Zhao, M.; Xia, G.; Shen, X. Tilapia nilotica Head Lipids Improved Bone Loss by Regulating Inflammation and Serum Metabolism Through Gut Microbiota in Ovariectomized Rats. Front. Nutr. 2022, 8, 7927938. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Guo, Q.; Liang, Z.; Wang, M.; Wang, B.; Sun, W.D.; Geoffrey, I.W.; Wang, J.; Ma, C.; Kang, W.Y. Anti-inflammatory and antioxidant effects of Chaetoglobosin Vb in LPS-induced RAW264.7 cells: Achieved via the MAPK and NF-κB signaling pathways. Food Chem. Toxicol. 2021, 147, 111915. [Google Scholar] [CrossRef] [PubMed]
- Mei, F.F.; Meng, K.K.; Gu, Z.P.; Yun, Y.H.; Zhang, W.M.; Zhang, C.H.; Zhong, Q.P.; Pan, F.B.; Shen, X.R.; Xia, G.H.; et al. Arecanut (Areca catechu L.) seed polyphenol-ameliorated osteoporosis by altering gut microbiome via LYZ and the immune system in estrogen-deficient rats. J. Agric. Food Chem. 2021, 69, 246–258. [Google Scholar] [CrossRef] [PubMed]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox. Sign. 2014, 20, 1126–1167. [Google Scholar] [CrossRef]
- Neurath, M.F. Cytokines in inflammatory bowel disease. Nat. Rev. Immunol. 2014, 14, 329–342. [Google Scholar] [CrossRef] [PubMed]
- Son, H.J.; Eo, H.J.; Park, G.H.; Jeong, J.B. Heracleum moellendorffii root extracts exert immunostimulatory activity through TLR2/4-dependent MAPK activation in mouse macrophages, RAW264.7 cells. Food Sci. Nutr. 2021, 9, 514–521. [Google Scholar] [CrossRef]
- Gao, R.; Shu, W.; Shen, Y.; Sun, Q.; Jin, W.; Li, D.; Li, Y.; Yuan, L. Peptide fraction from sturgeon muscle by pepsin hydrolysis exerts anti-inflammatory effects in LPS-stimulated RAW264.7 macrophages via MAPK and NF-κB pathways. Food Sci. Hum. Well. 2021, 10, 103–111. [Google Scholar] [CrossRef]
- Ren, D.; Lin, D.; Alim, A.; Zheng, Q.; Yang, X. Chemical characterization of a novel polysaccharide ASKP-1 from Artemisia sphaerocephala Krasch seed and its macrophage activation via MAPK, PI3k/Akt and NF-κB signaling pathways in RAW264.7 cells. Food Funct. 2017, 8, 1299–1312. [Google Scholar] [CrossRef]
- Hwang, P.A.; Chien, S.Y.; Chan, Y.L.; Lu, K.; Wu, C.H.; Kong, Z.L.; Wu, C.J. Inhibition of Lipopolysaccharide (LPS) -induced inflammatory responses by Sargassum hemiphyllum sulfated polysaccharide extract in RAW 264.7 macrophage cells. J. Agric. Food Chem. 2011, 59, 2062–2068. [Google Scholar] [CrossRef]
- Hirayama, D.; Iida, T.; Nakase, H. The Phagocytic Function of Macrophage-Enforcing Innate Immunity and Tissue Homeostasis. Int. J. Mol. Sci. 2018, 19, 92. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Zeng, Y.; Cui, Y.; Liu, H.; Dong, C.; Sun, Y. Structural characterization, antioxidant and immunomodulatory activities of a neutral polysaccharide from Cordyceps militaris cultivated on hull-less barley. Carbohyd. Polym. 2020, 235, 115969. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Zhao, M.; Qing, Y.; Luo, Y.; Xia, G.; Li, Y. Study on immunostimulatory activity and extraction process optimization of polysaccharides from Caulerpa lentillifera. Int. J. Biol. Macromol. 2020, 143, 677–684. [Google Scholar] [CrossRef] [PubMed]
- Sun, T.; Zhang, S.; Yang, W.; Zhao, Z.; Yang, D. Housefly Pupae-Derived Antioxidant Peptides Exerting Neuroprotective Effects on Hydrogen Peroxide-Induced Oxidative Damage in PC12 Cells. Molecules 2019, 24, 4486. [Google Scholar] [CrossRef]
- Kumar, V.P.; Prashanth, K.V.H.; Venkatesh, Y.P. Structural analyses and immunomodulatory properties of fructo-oligosaccharides from onion (Allium cepa). Carbohydr Polym. 2015, 117, 115–122. [Google Scholar] [CrossRef] [PubMed]
- Parameswaran, N.; Patial, S. Tumor Necrosis Factor-α Signaling in Macrophages. Crit. Rev. Eukaryot. Gene Expr. 2010, 20, 87–103. [Google Scholar] [CrossRef]
- Rincon, M. Interleukin-6: From an inflammatory marker to a target for inflammatory diseases. Trends Immunol. 2012, 33, 571–577. [Google Scholar] [CrossRef]
- Ren, K.; Orres, R. Role of interleukin-1β during pain and inflammation. Brain Res. Rev. 2009, 60, 57–64. [Google Scholar] [CrossRef]
- Xu, J.; Zhao, Y.; Aisa, H.A. Anti-inflammatory effect of pomegranate flower in lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. Pharm. Biol. 2017, 55, 2095–2101. [Google Scholar] [CrossRef]
- Berkoz, M. Diosmin suppresses the proinflammatory mediators in lipopolysaccharide-induced RAW264.7 macrophages via NF-κB and MAPKs signal pathways. Gen. Physiol. Biophys. 2019, 38, 315–324. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, L.; Xu, S.; Pan, J.; Zhang, Q.; Lu, R. Surface-Layer Protein from Lactobacillus acidophilus NCFM Inhibits Lipopolysaccharide-Induced Inflammation through MAPK and NF-κB Signaling Pathways in RAW264.7 Cells. J. Agric. Food Chem. 2018, 66, 7655–7662. [Google Scholar] [CrossRef]
- Ham, Y.M.; Ko, Y.J.; Song, S.M.; Kim, J.; Kim, K.N.; Yun, J.H.; Cho, J.H.; Ahn, G.; Yoon, W.J. Anti-inflammatory effect of litsenolide B2 isolated from Litsea japonica fruit via suppressing NF-κB and MAPK pathways in LPS-induced RAW264.7 cells. J. Funct. Foods 2015, 13, 80–88. [Google Scholar] [CrossRef]
- Yang, P.; Han, Y.; Gui, L.; Sun, J.; Chen, Y.L.; Song, R.; Guo, J.Z.; Xie, Y.N.; Lu, D.; Sun, L. Gastrodin attenuation of the inflammatory response in H9c2 cardiomyocytes involves inhibition of NF-κB and MAPKs activation via the phosphatidylinositol 3-kinase signaling. Biochem. Pharmacol. 2013, 85, 1124–1133. [Google Scholar] [CrossRef] [PubMed]
- Feng, C.; Luo, Y.; Nian, Y.; Liu, D.; Yin, X.; Wu, J.; Zhang, J. Diallyl Disulfide Suppresses the Inflammation and Apoptosis Resistance Induced by DCA Through ROS and the NF-κB Signaling Pathway in Human Barrett’s Epithelial Cells. Inflammation 2017, 40, 818–831. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.S.; Ahn, C.B.; Je, J.Y. Anti-inflammatory action of high molecular weight Mytilus edulis hydrolysates fraction in LPS-induced RAW264.7 macrophage via NF-kappaB and MAPK pathways. Food Chem. 2016, 9, 14. [Google Scholar] [CrossRef]
Gene. | Primer Sequence (5′–3′) | Orientation | Length/bp | Tm/°C |
---|---|---|---|---|
GAPDH | CCTCGTCCCGTAGACAAAATG | Forward | 133 | 60 |
TGAGGTCAATGAAGGGGTCGT | Reverse | 60 | ||
TNF-α | CCCTCACACTCACAAACCACC | Forward | 93 | 60 |
CTTTGAGATCCATGCCGTTG | Reverse | 60 | ||
IL-1β | GCATCCAGCTTCAAATCTCGC | Forward | 256 | 60 |
TGTTCATCTCGGAGCCTGTAGTG | Reverse | 60 | ||
IL-6 | AGTTGTGCAATGGCAATTCTGA | Forward | 229 | 60 |
CTCTGAAGGACTCTGGCTTTGTC | Reverse | 60 | ||
IL-10 | AATAAGCTCCAAGACCAAGGTGT | Forward | 81 | 60 |
CATCATGTATGCTTCTATGCAGTTG | Reverse | 60 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duan, Z.; Xie, H.; Yu, S.; Wang, S.; Yang, H. Piperine Derived from Piper nigrum L. Inhibits LPS-Induced Inflammatory through the MAPK and NF-κB Signalling Pathways in RAW264.7 Cells. Foods 2022, 11, 2990. https://doi.org/10.3390/foods11192990
Duan Z, Xie H, Yu S, Wang S, Yang H. Piperine Derived from Piper nigrum L. Inhibits LPS-Induced Inflammatory through the MAPK and NF-κB Signalling Pathways in RAW264.7 Cells. Foods. 2022; 11(19):2990. https://doi.org/10.3390/foods11192990
Chicago/Turabian StyleDuan, Zhouwei, Hui Xie, Shasha Yu, Shiping Wang, and Hong Yang. 2022. "Piperine Derived from Piper nigrum L. Inhibits LPS-Induced Inflammatory through the MAPK and NF-κB Signalling Pathways in RAW264.7 Cells" Foods 11, no. 19: 2990. https://doi.org/10.3390/foods11192990