Antimicrobial Susceptibility of Fresh Produce-Associated Enterobacteriaceae and Enterococci in Oman
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection and Bacterial Isolation and Identification
2.2. Susceptibility of Bacteria to Chlorhexidine
2.3. Identification of Resistance Genes
2.4. Antibiotic Susceptibility Tests
2.5. Antibiotic Resistance Index (ARI)
2.6. Data Analyses
3. Results
3.1. Susceptibility of Enterobacteriaceae and Enterococci to Chlorhexidine
3.2. Resistance Genes in Enterobacteriaceae and Enterococci
3.3. Antibiotic Resistance of Enterobacteriaceae and Enterococci
3.4. Association between Bacterial Susceptibility to Chlorhexidine and Their Resistance to Antibiotics
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McDonnell, G.; Russell, A.D. Antiseptics and disinfectants: Activity, action and resistance. Clin. Microbiol. Rev. 1999, 12, 147–179. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beier, R.C.; Bischoff, K.M.; Ziprin, R.L.; Poole, T.L.; Nisbet, D.J. Chlorhexidine susceptibility, virulence factors and antibiotic resistance of beta-hemolytic Escherichia coli isolated from neonatal swine with diarrhea. Bull. Environ. Contam. Toxicol. 2005, 75, 835–844. [Google Scholar] [CrossRef] [PubMed]
- Septimus, E.J.; Schweizer, M.L. Decolonization in prevention of health care-associated infections. Clin. Microbiol. Rev. 2016, 29, 201–222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prag, G.; Falk-Brynhildsen, K.; Jacobsson, S.; Hellmark, B.; Unemo, M.; Söderquist, B. Decreased susceptibility to chlorhexidine and prevalence of disinfectant resistance genes among clinical isolates of Staphylococcus epidermidis. Apmis 2014, 122, 961–967. [Google Scholar] [CrossRef] [PubMed]
- Blair, J.M.A.; Webber, M.A.; Baylay, A.J.; Ogbolu, D.O.; Piddock, L.J.V. Molecular mechanisms of antibiotic resistance. Nat. Rev. Microbiol. 2015, 13, 42–51. [Google Scholar] [CrossRef]
- Langsrud, S.; Sidhua, M.S.; Heirb, E.; Holcka, A.L. Bacterial disinfectant resistance—A challenge for the food industry. Int. Biodeterior. Biodegrad. 2003, 51, 283–290. [Google Scholar] [CrossRef]
- Meade, E.; Slattery, M.A.; Garvey, M. Biocidal resistance in clinically relevant microbial species: A major public health risk. Pathogens 2021, 10, 598. [Google Scholar] [CrossRef]
- Chapman, J.S. Disinfectant resistance mechanisms, cross-resistance and co-resistance. Int. Biodeterior. Biodegrad. 2003, 51, 271–276. [Google Scholar] [CrossRef]
- Condell, O.; Iversen, C.; Cooney, S.; Power, K.A.; Walsh, C.; Burgess, C.; Fanning, S. Efficacy of biocides used in the modern food industry to control Salmonella enterica and links between biocide tolerance and resistance to clinically relevant antimicrobial compounds. Appl. Environ. Microbiol. 2012, 78, 3087–3097. [Google Scholar] [CrossRef] [Green Version]
- Huddleston, J.R. Horizontal gene transfer in the human gastrointestinal tract: Potential spread of antibiotic resistance genes. Infect. Drug Resist. 2014, 7, 167–176. [Google Scholar] [CrossRef]
- Russell, A.D. Bacterial resistance to disinfectants: Present knowledge and future problems. J. Hosp. Infect. 1998, 43, S57–S68. [Google Scholar] [CrossRef]
- Davidson, P.M.; Harrison, M.A. Resistance and adaptation to food antimicrobials, sanitizers, and other process controls. Food Technol. 2002, 56, 69–78. [Google Scholar]
- Ruimy, R.; Brisaboi, A.S.; Bernede, C.; Skurnik, D.; Barnat, S.; Arlet, G.; Momcilovic, S.; Elbaz, S.; Moury, F.; Vibet, M.A.; et al. Organic and conventional fruits and vegetables contain equivalent counts of Gram-negative bacteria expressing resistance to antibacterial agents. Environ. Microbiol. 2010, 12, 608–6015. [Google Scholar] [CrossRef] [PubMed]
- Sundheim, G.; Langsrud, S.; Heir, E.; Holck, A.L. Bacterial resistance to disinfectants containing quaternary ammonium compounds. Int. Biodeterior. Biodegrad. 1998, 41, 235–239. [Google Scholar] [CrossRef]
- Horner, C.; Mawer, D.; Wilcox, M. Reduced susceptibility to chlorhexidine in staphylococci: Is it increasing and does it matter? J. Antimicrob. Chemother. 2012, 67, 2547–2559. [Google Scholar] [CrossRef] [PubMed]
- Hassan, K.A.; Jackson, S.M.; Penesyan, A.; Patching, S.G.; Tetu, S.G.; Eijkelkamp, B.A.; Brown, M.H.; Henderson, P.J.; Paulsen, I.T. Transcriptomic and biochemical analyses identify a family of chlorhexidine efflux proteins. Proc. Natl. Acad. Sci. USA 2013, 110, 20254–20259. [Google Scholar] [CrossRef] [Green Version]
- Hernández, M.; Borrull, F.; Calull, M. Analysis of antibiotics in biological samples by capillary electrophoresis. Trends Anal. Chem. 2003, 22, 416–427. [Google Scholar] [CrossRef]
- Teuber, M. Spread of antibiotic resistance with food-borne pathogens. Cell. Mol. Life Sci. 1999, 56, 755–763. [Google Scholar] [CrossRef]
- Forslund, K.; Sunagawa, S.; Kultima, J.R.; Mende, D.R.; Arumugam, M.; Typas, A.; Bork, P. Country-specific antibiotic use practices impact the human gut resistome. Genome Res. 2013, 23, 1163–1169. [Google Scholar] [CrossRef] [Green Version]
- Boehme, S.; Werner, G.; Klare, I.; Reissbrodt, R.; Witte, W. Occurrence of antibiotic-resistant enterobacteria in agricultural foodstuffs. Mol. Nutr. Food Res. 2004, 48, 522–531. [Google Scholar] [CrossRef]
- Ayrapetyan, M.; Williams, T.C.; Oliver, J.D. Bridging the gap between viable but non-culturable and antibiotic persistent bacteria. Trends Microbiol. 2015, 23, 7–13. [Google Scholar] [CrossRef] [PubMed]
- Mathur, S.; Singh, R. Antibiotic resistance in food lactic acid bacteria—A review. Int. J. Food Microbiol. 2005, 105, 281–295. [Google Scholar] [CrossRef] [PubMed]
- Berg, G.; Erlacher, A.; Smalla, K.; Krause, R. Vegetable microbiomes: Is there a connection among opportunistic infections, human health and our ‘gut feeling’? Microb. Biotechnol. 2014, 7, 487–495. [Google Scholar] [CrossRef]
- Abriouel, H.; Omar, N.; Molinos, A.C.; López, R.L.; Grande, M.J.; Martínez-Viedma, P.; Ortega, E.; Cañamero, M.M.; Galvez, A. Comparative analysis of genetic diversity and incidence of virulence factors and antibiotic resistance among enterococcal populations from raw fruit and vegetable foods, water and soil and clinical samples. Int. J. Food Microbiol. 2008, 123, 38–49. [Google Scholar] [CrossRef] [PubMed]
- Al-Kharousi, Z.S.; Guizani, N.; Al-Sadi, A.M.; Al-Bulushi, I.M.; Shaharoona, B. Hiding in fresh fruits and vegetables: Opportunistic pathogens may cross geographical barriers. Int. J. Microbiol. 2016, 2016, 4292417. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Al-Kharousi, Z.S.; Guizani, N.; Al-Sadi, A.M.; Al-Bulushi, I.M. Antibiotic resistance of Enterobacteriaceae isolated from fresh fruits and vegetables and characterization of their AmpC β-lactamase. J. Food Prot. 2019, 82, 1857–1863. [Google Scholar] [CrossRef] [PubMed]
- McGann, P.; Milillo, M.; Kwak, Y.I.; Quintero, R.; Waterman, P.E.; Lesho, E. Rapid and simultaneous detection of the chlorhexidine and mupirocin resistance genes qacA/B and mupA in clinical isolates of methicillin-resistant Staphylococcus aureus. Diagn. Microbiol. Infect. Dis. 2013, 77, 270–272. [Google Scholar] [CrossRef] [PubMed]
- Jaglic, Z.; Cervinkova, D. Genetic basis of resistance to quaternary ammonium compounds-the qac genes and their role: A review. Vet. Med. 2012, 57, 275–281. [Google Scholar] [CrossRef] [Green Version]
- Rosser, S.J.; Young, H.K. Identification and characterization of class 1 integrons in bacteria from an aquatic environment. J. Antimicrob. Chemother. 1999, 44, 11–18. [Google Scholar] [CrossRef]
- Gaze, W.H.; Abdouslam, N.; Hawkey, P.M.; Wellington, E.M.H. Incidence of class 1 integrons in a quaternary ammonium compound-polluted environment. Antimicrob. Agents Chemother. 2005, 49, 1802–1807. [Google Scholar] [CrossRef] [Green Version]
- Bischoff, M.; Bauer, J.; Preikschat, P.; Schwaiger, K.; Lle, G.M.; Lzel, C.H. First detection of the antiseptic resistance gene qacA/B in Enterococcus faecalis. Microb. Drug Resist. 2012, 18, 7–12. [Google Scholar] [CrossRef] [PubMed]
- Gillings, M.R.; Holley, M.P.; Stokes, H.W. Evidence for dynamic exchange of qac gene cassettes between class 1 integrons and other integrons in freshwater biofilms. FEMS Microbiol. Lett. 2009, 296, 282–288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, Twenty-Fifth Informational Supplement, M100-S25; CLSI: Wayne, PA, USA, 2015. [Google Scholar]
- Krishna, M.P.; Varghese, R.; Mohamed Hatha, A.A. Heavy metal tolerance and multiple drug resistance of heterotrophic bacterial isolates from metal contaminated soil. South Pac. J. Nat. Appl. Sci. 2012, 30, 58–64. [Google Scholar] [CrossRef] [Green Version]
- Burgos, M.J.G.; Aguayo, M.C.L.; Pulido, R.P.; Gálvez, A.; López, R.L. Multilocus sequence typing and antimicrobial resistance in Enterococcus faecium isolates from fresh produce. Antonie Leeuwenhoek 2014, 105, 413–421. [Google Scholar] [CrossRef] [PubMed]
- Fang, C.-T.; Chen, H.-C.; Chuang, Y.-P.; Chang, S.-C.; Wang, J.-T. Cloning of a cation efflux pump gene associated with chlorhexidine resistance in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2002, 46, 2024–2028. [Google Scholar] [CrossRef] [Green Version]
- Aarestrup, F.M.; Hasman, H. Susceptibility of different bacterial species isolated from food animals to copper sulphate, zinc chloride and antimicrobial substances used for disinfection. Vet. Microbiol. 2004, 100, 83–89. [Google Scholar] [CrossRef]
- Shalamanov, D.; Petkova, T.; Kanev, K.; Popivanov, I.; Bogdanov, N.; Tzvetanov, T.; Penkov, E. Effects of biocides on morphology of microorganisms. BMMR 2011, 14, 202–211. [Google Scholar]
- Grape, M.; Farra, A.; Kronvall, G.; Sundström, L. Integrons and gene cassettes in clinical isolates of co-trimoxazole-resistant Gram-negative bacteria. Clin. Microbiol. Infect. 2005, 11, 185–192. [Google Scholar] [CrossRef] [Green Version]
- Fernández Fuentes, M.; Morente, E.; Abriouel, H.; Pulido, R.; Gálvez, A. Antimicrobial resistance determinants in antibiotic and biocide-resistant Gram-negative bacteria from organic foods. Food Control. 2014, 37, 9–14. [Google Scholar] [CrossRef]
- Johnston, L.M.; Jaykus, L.A. Antimicrobial resistance of Enterococcus species isolated from produce. Appl. Environ. Microbiol. 2004, 70, 3133–3137. [Google Scholar] [CrossRef] [Green Version]
- Al-Kharousi, Z.S.; Guizani, N.; Al-Sadi, A.M.; Al-Bulushi, I.M. Tetracycline resistance in enterococci and Escherichia coli isolated from fresh produce and why it matters. Int. J. Food Stud. 2021, 10, 359–370. [Google Scholar] [CrossRef]
- Steward, C.D.; Raney, P.M.; Morrell, A.K.; Williams, P.P.; McDougal, L.K.; Jevitt, L.; McGowan, J.E., Jr.; Tenover, F.C. Testing for induction of clindamycin resistance in erythromycin-resistant isolates of Staphylococcus aureus. J. Clin. Microbiol. 2005, 43, 1716–1721. [Google Scholar] [CrossRef] [PubMed]
- McGowan, L.L.; Jackson, C.R.; Barrett, J.B.; Hiott, L.M.; Fedorkacray, P.J. Prevalence and antimicrobial resistance of enterococci isolated from retail fruits, vegetables and meats. J. Food Prot. 2006, 69, 2976–2982. [Google Scholar] [CrossRef] [PubMed]
- Hollenbeck, B.L.; Rice, L.B. Intrinsic and acquired resistance mechanisms in enterococcus. Virulence 2012, 3, 421–433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Swenson, J.M.; Clark, N.C.; Sahm, D.F.; Ferraro, M.J.; Doern, G.; Hindler, J.; Jorgensen, J.H.; Pfaller, M.A.; Reller, L.B.; Weinsteinet, M.P. Molecular characterization and multilaboratory evaluation of Enterococcus faecalis ATCC 51299 for quality control of screening tests for vancomycin and high-level aminoglycoside resistance in enterococci. J. Clin. Microbiol. 1995, 33, 3019–3021. [Google Scholar] [CrossRef] [Green Version]
- Al-Bahri, S.N.; Al-Mashani, B.M.; Al-Ansari, A.S.; El-Shafie, A.E.; Mahmoud, I.Y. Escherichia coli tetracycline efflux determinants in relation to tetracycline residues in chicken. Asian Pac. J. Trop. Med. 2013, 6, 718–722. [Google Scholar]
- Al-Za’abi, M.; Shafiq, S.; Al Riyami, D.; Ali, B.H. Utilization pattern of vancomycin in a university teaching hospital in Oman: Comparison with international guidelines. Trop. J. Pharm. Res. 2013, 12, 117–121. [Google Scholar] [CrossRef]
- Kücken, D.; Feucht, H.; Kaulfers, P. Association of qacE and qacEΔ1 with multiple resistance to antibiotics and antiseptics in clinical isolates of Gram-negative bacteria. FEMS Microbiol. Lett. 2000, 183, 95–98. [Google Scholar] [CrossRef]
Targeted Gene | Primer Sequence 5′–3′ | Amplicon Size | Ref. |
---|---|---|---|
IntI 1 | IntA: ATCATCGTCGTAGAGACGTCGG | 892 | [29,30] |
IntB: GTCAAGGTTCTGGACCAGTTGC | |||
qacA/B | FW: GCAGAAAGTGCAGAGTTCG | 360 | [31] |
RV: CCAGTCCAATCATGCCTG | |||
smr (qacC + qacD) | FW: GCCATAAGTACTGAAGTTATTGGA | 194 | [31] |
RV: GACTACGGTTGTTAAGACTAAACCT | |||
qacG | MRG288: CGCTGATAATGAAGCCGAC | 280 | [32] |
MRG287: TTGGTTATTTCTGGCTACG | |||
qacE | MRG292: AGCCCCATACCTACAAAG | 192 | [32] |
MRG291: AGCTTGCCCCTTCCGC | |||
qacEΔ1 | FW: GGCTTTACTAAGCTTGCCCC | 202 | [31] |
RV: AGCCCCATACCTACAAAGCC |
Bacteria No. | Identity (PCR) | Source | Gene | Accession # |
---|---|---|---|---|
1 | E. coli | Cabbage, Oman | IntI 1 | LT548588 |
7 | E. coli | Radish, China | IntI 1 | LT548589 |
94 | K. pneumoniae | Banana, Philippines | IntI 1 | - |
1 | E. coli | Cabbage, Oman | qacE | LT548593 |
4 | E. coli | Lettuce, Jordan | qacE | - |
1 | E. coli | Cabbage, Oman | qacEΔ1 | LT548590 |
75 | E. ludwigii | Cucumber, UAE | qacEΔ1 | - |
52 | E. cloacae | Cabbage, Oman | qacG | LT548591 |
75 | E. ludwigii | Cucumber, UAE | qacG | LT548592 |
84 | E. cloacae | Lettuce, Iran | qacG | - |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Kharousi, Z.S.; Guizani, N.; Al-Sadi, A.M.; Al-Bulushi, I.M. Antimicrobial Susceptibility of Fresh Produce-Associated Enterobacteriaceae and Enterococci in Oman. Foods 2022, 11, 3085. https://doi.org/10.3390/foods11193085
Al-Kharousi ZS, Guizani N, Al-Sadi AM, Al-Bulushi IM. Antimicrobial Susceptibility of Fresh Produce-Associated Enterobacteriaceae and Enterococci in Oman. Foods. 2022; 11(19):3085. https://doi.org/10.3390/foods11193085
Chicago/Turabian StyleAl-Kharousi, Zahra S., Nejib Guizani, Abdullah M. Al-Sadi, and Ismail M. Al-Bulushi. 2022. "Antimicrobial Susceptibility of Fresh Produce-Associated Enterobacteriaceae and Enterococci in Oman" Foods 11, no. 19: 3085. https://doi.org/10.3390/foods11193085