Effect of Melatonin on Fruit Quality via Decay Inhibition and Enhancement of Antioxidative Enzyme Activities and Genes Expression of Two Mango Cultivars during Cold Storage
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Melatonin Treatment
2.3. Quality Parameters
2.3.1. Weight Loss
2.3.2. Firmness
2.3.3. Decay Incidence Rate
2.3.4. Respiration Rate
2.4. Nutritional Parameters
2.4.1. Total Soluble Solid Content (TSS), Titratable Acidity (TA), and TSS:TA
2.4.2. Ascorbic Acid (AsA) Content
2.4.3. Total Phenol and Flavonoid Content
2.5. Malondialdehyde (MDA) Content
2.6. Enzymes Activities
2.6.1. Polyphenol Oxidase (PPO) Activity
2.6.2. Phenylalanine Ammonia-Lyase (PAL) Activity
2.6.3. Superoxide Dismutase (SOD) Activity
2.6.4. Ascorbate Peroxidase (APX) Activity
2.7. RNA Isolation and Gene Expression Analysis
2.8. Statistical Analysis
3. Results
3.1. Effects of MT on Quality Parameters
3.1.1. Weight Loss and Firmness
3.1.2. Decay Incidence and Respiration Rate
3.2. Effect of MT on Nutritional Parameters of Mango
3.2.1. TSS, TA, and TSS:TA
3.2.2. AsA Content
3.2.3. Total Flavonoid and Phenol Content
3.3. MDA Content
3.4. Effect of MT on Enzyme Activities
3.4.1. PPO and PAL Activity
3.4.2. SOD and APX Activity
3.5. Effect of MT on Gene Relative Expression
3.5.1. PAL and PPO Genes
3.5.2. MnSOD and APX Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tharanathan, R.; Yashoda, H.; Prabha, T. Mango(Mangifera indica L.), “The King of Fruits”—An Overview. Food Rev. Int. 2006, 22, 95–123. [Google Scholar] [CrossRef]
- Zhang, Z.; Zhu, Q.; Hu, M.; Gao, Z.; An, F.; Li, M.; Jiang, Y. Low-temperature conditioning induces chilling tolerance in stored mango fruit. Food Chem. 2017, 219, 76–84. [Google Scholar] [CrossRef] [PubMed]
- Cárdenas-Coronel, W.G.; Velez-de la Rocha, R.; Siller-Cepeda, J.H.; Osuna-Enciso, T.; Muy-Rangel, M.D.; Sañudo-Barajas, J.A. Changes in the composition of starch, pectins and hemicelluloses during the ripening stage of mango (Mangifera indica cv. Kent). Rev. Chapingo. Ser. Hortic. 2012, 18, 5–19. [Google Scholar]
- Xu, T.; Chen, Y.; Kang, H. Melatonin Is a Potential Target for Improving Post-Harvest Preservation of Fruits and Vegetables. Front. Plant Sci. 2019, 10, 1388. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arnao, M.B.; Ruiz, J.H. Melatonin: A New Plant Hormone and/or a Plant Master Regulator? Trends Plant Sci. 2019, 24, 38–48. [Google Scholar] [CrossRef] [PubMed]
- Hernández-Ruiz, J.; Arnao, M.B. Relationship of Melatonin and Salicylic Acid in Biotic/Abiotic Plant Stress Responses. Agronomy 2018, 8, 33. [Google Scholar] [CrossRef] [Green Version]
- Debnath, B.; Islam, W.; Li, M.; Sun, Y.; Lu, X.; Mitra, S.; Hussain, M.; Liu, S.; Qiu, D. Melatonin Mediates Enhancement of Stress Tolerance in Plants. Int. J. Mol. Sci. 2019, 20, 1040. [Google Scholar] [CrossRef] [Green Version]
- Shi, H.; Reiter, R.J.; Tan, D.-X.; Chan, Z. Indole-3-acetic acid INDUCIBLE 17 positively modulates natural leaf senescence through melatonin-mediated pathway in Arabidopsis. J. Pineal Res. 2014, 58, 26–33. [Google Scholar] [CrossRef]
- Bal, E. Physicochemical changes in ‘Santa Rosa’ plum fruit treated with melatonin during cold storage. J. Food Meas. Charact. 2019, 13, 1713–1720. [Google Scholar] [CrossRef]
- Hu, W.; Yang, H.; Tie, W.; Yan, Y.; Ding, Z.; Liu, Y.; Wu, C.; Wang, J.; Reiter, R.J.; Tan, D.-X.; et al. Natural Variation in Banana Varieties Highlights the Role of Melatonin in Postharvest Ripening and Quality. J. Agric. Food Chem. 2017, 65, 9987–9994. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.; Song, C.; Shao, J.; Bian, K.; Chen, W.; Yang, Z. Exogenous Melatonin Treatment Increases Chilling Tolerance and Induces Defense Response in Harvested Peach Fruit during Cold Storage. J. Agric. Food Chem. 2016, 64, 5215–5222. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Zheng, H.; Sheng, K.; Liu, W.; Zheng, L. Effects of melatonin treatment on the postharvest quality of strawberry fruit. Postharvest Biol. Technol. 2018, 139, 47–55. [Google Scholar] [CrossRef]
- Gao, H.; Lu, Z.; Yang, Y.; Wang, D.; Yang, T.; Cao, M.; Cao, W. Melatonin treatment reduces chilling injury in peach fruit through its regulation of membrane fatty acid contents and phenolic metabolism. Food Chem. 2018, 245, 659–666. [Google Scholar] [CrossRef] [PubMed]
- Rastegar, S.; Khankahdani, H.H.; Rahimzadeh, M. Effects of melatonin treatment on the biochemical changes and antioxidant enzyme activity of mango fruit during storage. Sci. Hortic. 2020, 259, 108835. [Google Scholar] [CrossRef]
- Liu, S.; Huang, H.; Huber, D.J.; Pan, Y.; Shi, X.; Zhang, Z. Delay of ripening and softening in ‘Guifei’ mango fruit by postharvest application of melatonin. Postharvest Biol. Technol. 2020, 163, 111136. [Google Scholar] [CrossRef]
- Bhardwaj, R.; Pareek, S.; González-Aguilar, G.A.; Domínguez-Avila, J.A. Changes in the activity of proline-metabolising enzymes is associated with increased cultivar-dependent chilling tolerance in mangos, in response to pre-storage melatonin application. Postharvest Biol. Technol. 2021, 182, 111702. [Google Scholar] [CrossRef]
- Cao, S.; Shao, J.; Shi, L.; Xu, L.; Shen, Z.; Chen, W.; Yang, Z. Melatonin increases chilling tolerance in postharvest peach fruit by alleviating oxidative damage. Sci. Rep. 2018, 8, 806. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Luo, Z.; Yang, M.; Li, D.; Qi, M.; Xu, Y.; Abdelshafy, A.M.; Ban, Z.; Wang, F.; Li, L. Role of exogenous melatonin in table grapes: First evidence on contribution to the phenolics-oriented response. Food Chem. 2020, 329, 127155. [Google Scholar] [CrossRef]
- Li, T.; Wu, Q.; Zhu, H.; Zhou, Y.; Jiang, Y.; Gao, H.; Yun, Z. Comparative transcriptomic and metabolic analysis reveals the effect of melatonin on delaying anthracnose incidence upon postharvest banana fruit peel. BMC Plant Biol. 2019, 19, 289. [Google Scholar] [CrossRef]
- Sharma, A.; Wang, J.; Xu, D.; Tao, S.; Chong, S.; Yan, D.; Li, Z.; Yuan, H.; Zheng, B. Melatonin regulates the functional components of photosynthesis, antioxidant system, gene expression, and metabolic pathways to induce drought resistance in grafted Carya cathayensis plants. Sci. Total Environ. 2020, 713, 136675. [Google Scholar] [CrossRef]
- Quality, A.P.; Supervision, S. Analysis on the Quality and Aroma Components of Main Mango Fruits in Guizhou. Chin. J. Trop. Crops 2020, 41, 2305–2313. [Google Scholar] [CrossRef]
- Ma, X.; Wu, H.; Liu, L.; Yao, Q.; Wang, S.; Zhan, R.; Xing, S.; Zhou, Y. Polyphenolic compounds and antioxidant properties in mango fruits. Sci. Hortic. 2011, 129, 102–107. [Google Scholar] [CrossRef]
- Zhang, Z.; Gao, Z.; Li, M.; Hu, M.; Gao, H.; Yang, D.; Yang, B. Hot Water Treatment Maintains Normal Ripening and Cell Wall Metabolism in Mango (Mangifera indica L.) Fruit. HortScience 2012, 47, 1466–1471. [Google Scholar] [CrossRef] [Green Version]
- Dong, J.; Kebbeh, M.; Yan, R.; Huan, C.; Jiang, T.; Zheng, X. Melatonin treatment delays ripening in mangoes associated with maintaining the membrane integrity of fruit exocarp during postharvest. Plant Physiol. Biochem. 2021, 169, 22–28. [Google Scholar] [CrossRef]
- Daniels, A.J.; Poblete-Echeverría, C.; Opara, U.L.; Nieuwoudt, H.H. Measuring Internal Maturity Parameters Contactless on Intact Table Grape Bunches Using NIR Spectroscopy. Front. Plant Sci. 2019, 10, 1517. [Google Scholar] [CrossRef] [Green Version]
- Wang, F.; Zhang, X.; Yang, Q.; Zhao, Q. Exogenous melatonin delays postharvest fruit senescence and maintains the quality of sweet cherries. Food Chem. 2019, 301, 125311. [Google Scholar] [CrossRef]
- Zhang, Y.; Huber, D.J.; Hu, M.; Jiang, G.; Gao, Z.; Xu, X.; Jiang, Y.; Zhang, Z. Delay of Postharvest Browning in Litchi Fruit by Melatonin via the Enhancing of Antioxidative Processes and Oxidation Repair. J. Agric. Food Chem. 2018, 66, 7475–7484. [Google Scholar] [CrossRef]
- Michailidis, M.; Tanou, G.; Sarrou, E.; Karagiannis, E.; Ganopoulos, I.; Martens, S.; Molassiotis, A. Pre- and Post-harvest Melatonin Application Boosted Phenolic Compounds Accumulation and Altered Respiratory Characters in Sweet Cherry Fruit. Front. Nutr. 2021, 8, 695061. [Google Scholar] [CrossRef]
- Aghdam, M.S.; Fard, J.R. Melatonin treatment attenuates postharvest decay and maintains nutritional quality of strawberry fruits (Fragaria×anannasa cv. Selva) by enhancing GABA shunt activity. Food Chem. 2017, 221, 1650–1657. [Google Scholar] [CrossRef]
- Han, Q.-H.; Huang, B.; Ding, C.-B.; Zhang, Z.-W.; Chen, Y.-E.; Hu, C.; Zhou, L.-J.; Huang, Y.; Liao, J.-Q.; Yuan, S.; et al. Effects of Melatonin on Anti-oxidative Systems and Photosystem II in Cold-Stressed Rice Seedlings. Front. Plant Sci. 2017, 8, 785. [Google Scholar] [CrossRef]
- Miranda, S.; Vilches, P.; Suazo, M.; Pavez, L.; García, K.; Méndez, M.A.; González, M.; Meisel, L.A.; Defilippi, B.G.; del Pozo, T. Melatonin triggers metabolic and gene expression changes leading to improved quality traits of two sweet cherry cultivars during cold storage. Food Chem. 2020, 319, 126360. [Google Scholar] [CrossRef]
- Hu, M.; Yang, D.; Huber, D.J.; Jiang, Y.; Li, M.; Gao, Z.; Zhang, Z. Reduction of postharvest anthracnose and enhancement of disease resistance in ripening mango fruit by nitric oxide treatment. Postharvest Biol. Technol. 2014, 97, 115–122. [Google Scholar] [CrossRef]
- Sun, H.; Li, L.; Wang, X.; Wu, S.; Wang, X. Ascorbate–glutathione cycle of mitochondria in osmoprimed soybean cotyledons in response to imbibitional chilling injury. J. Plant Physiol. 2011, 168, 226–232. [Google Scholar] [CrossRef]
- Hiwale, S. Mango (Mangifera indica L.). In Sustainable Horticulture in Semiarid Dry Lands; Springer: New Delhi, India, 2015; pp. 97–114. [Google Scholar] [CrossRef]
- Mühlbauer, W.; Müller, J. Mango (Mangifera indica L.); Woodhead Publishing Limited: Sawston, UK, 2020. [Google Scholar]
- Trejo-Márquez, M.; Ramírez-Villatoro, G.; De La Rosa, N.C. Polyphenol oxidase and peroxidase activities in mangoes stored at chilling temperature. Acta Hortic. 2010, 395–402. [Google Scholar] [CrossRef]
- Pennycooke, J.; Cox, S.; Stushnoff, C. Relationship of cold acclimation, total phenolic content and antioxidant capacity with chilling tolerance in petunia (Petunia × hybrida). Environ. Exp. Bot. 2005, 53, 225–232. [Google Scholar] [CrossRef]
- Wang, T.; Hu, M.; Yuan, D.; Yun, Z.; Gao, Z.; Su, Z.; Zhang, Z. Melatonin alleviates pericarp browning in litchi fruit by regulating membrane lipid and energy metabolisms. Postharvest Biol. Technol. 2019, 160, 111066. [Google Scholar] [CrossRef]
- Aydaş, S.B.; Ozturk, S.; Aslım, B. Phenylalanine ammonia lyase (PAL) enzyme activity and antioxidant properties of some cyanobacteria isolates. Food Chem. 2013, 136, 164–169. [Google Scholar] [CrossRef]
- Shewfelt, R.; Del Rosario, B. The Role of Lipid Peroxidation in Storage Disorders of Fresh Fruits and Vegetables. HortScience 2000, 35, 575–579. [Google Scholar] [CrossRef]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef]
- Cao, J.J.; Yu, Z.C.; Zhang, Y.; Li, B.H.; Liang, W.X.; Wang, C.X. Control efficiency of exogenous melatonin against post-harvest apple grey mold and its influence on the activity of defensive enzymes. Plant Physiol. J. 2017, 53, 1760. [Google Scholar] [CrossRef]
- Xia, H.; Ni, Z.; Hu, R.; Lin, L.; Deng, H.; Wang, J.; Tang, Y.; Sun, G.; Wang, X.; Li, H.; et al. Melatonin Alleviates Drought Stress by a Non-Enzymatic and Enzymatic Antioxidative System in Kiwifruit Seedlings. Int. J. Mol. Sci. 2020, 21, 852. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Gene ID | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|---|
MnSOD | 123228203 | TAACCGAATCCGTCCGCCTTGG | CCTCCGCCGTTGAACTTGATGG |
APX | 123203234 | CTTCTTCTCTGTCGTTCTCT | TCTCGCACTCTTCAACTG |
PAL | 123193566 | CTGGCTGGTATCAGTAGTG | CCTGGATGGTGCTTCAAT |
PPO | 123193265 | TAGCACACGCAGCGGAGTTGAA | CCCAGTTGCCACCTCATCCTCA |
ACTIN | 123216838 | AGACCACCTACAACTCCAT | ATCCTCCAATCCAGACACT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Njie, A.; Zhang, W.; Dong, X.; Lu, C.; Pan, X.; Liu, Q. Effect of Melatonin on Fruit Quality via Decay Inhibition and Enhancement of Antioxidative Enzyme Activities and Genes Expression of Two Mango Cultivars during Cold Storage. Foods 2022, 11, 3209. https://doi.org/10.3390/foods11203209
Njie A, Zhang W, Dong X, Lu C, Pan X, Liu Q. Effect of Melatonin on Fruit Quality via Decay Inhibition and Enhancement of Antioxidative Enzyme Activities and Genes Expression of Two Mango Cultivars during Cold Storage. Foods. 2022; 11(20):3209. https://doi.org/10.3390/foods11203209
Chicago/Turabian StyleNjie, Alagie, Wen’e Zhang, Xiaoqing Dong, Chengyu Lu, Xuejun Pan, and Qingguo Liu. 2022. "Effect of Melatonin on Fruit Quality via Decay Inhibition and Enhancement of Antioxidative Enzyme Activities and Genes Expression of Two Mango Cultivars during Cold Storage" Foods 11, no. 20: 3209. https://doi.org/10.3390/foods11203209