Next Article in Journal
The Effects of Pectin Structure on Emulsifying, Rheological, and In Vitro Digestion Properties of Emulsion
Previous Article in Journal
Valorization of Common (Fagopyrum esculentum Moench.) and Tartary (Fagopyrum tataricum Gaertn.) Buckwheat in Gluten-Free Polenta Samples: Chemical-Physical and Sensory Characterization
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence of Listeria spp. in Soft Cheese and Ice Cream: Effect of Probiotic Bifidobacterium spp. on Survival of Listeria monocytogenes in Soft Cheese

by
Rania M. Ewida
1,
Walaa S. Hasan
2,
Mohamed Salem Elfaruk
3,4,
Raed Reshaid Alayouni
3,5,
Ahmed R. A. Hammam
3,6 and
Dalia G. Kamel
6,*
1
Food Hygiene (Milk Hygiene), Faculty of Veterinary Medicine, New Valley University, Kharga 72511, Egypt
2
College of Milk Hygiene, Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Assiut University, Assiut 71526, Egypt
3
Dairy and Food Science Department, South Dakota State University, Brookings, SD 57007, USA
4
Medical Technology College, Nalut University, Nalut 00218, Libya
5
Department of Food Science and Human Nutrition, College of Agriculture and Veterinary Medicine, Qassim University, Buraydah 51452, Saudi Arabia
6
Dairy Science Department, Faculty of Agriculture, Assiut University, Assiut 71526, Egypt
*
Author to whom correspondence should be addressed.
Foods 2022, 11(21), 3443; https://doi.org/10.3390/foods11213443
Submission received: 15 August 2022 / Revised: 20 September 2022 / Accepted: 1 October 2022 / Published: 30 October 2022
(This article belongs to the Section Dairy)

Abstract

:
Listeria monocytogenes is one of the most important emerging foodborne pathogens. The objectives of this work were to investigate the incidence of Listeria spp. and L. monocytogenes in soft cheese and ice cream in Assiut city, Egypt, and to examine the effect of some probiotic Bifidobacterium spp. (Bifidobacterium breve, Bifidobacterium animalis, or a mixture of the two) on the viability of L. monocytogenes in soft cheese. The existence of Listeria spp. and L. monocytogenes was examined in 30 samples of soft cheese and 30 samples of ice cream. Bacteriological analyses and molecular identification (using 16S rRNA gene and hlyA gene for Listeria spp. and L. monocytogenes, respectively) were performed on those samples. Additionally, Bifidobacterium spp. were incorporated in the making of soft cheese to study their inhibitory impacts on L. monocytogenes. Out of 60 samples of soft cheese and ice cream, 25 samples showed Listeria spp., while L. monocytogenes was found in only 2 soft cheese samples. Approximately 37% of soft cheese samples (11 out of 30) had Listeria spp. with about 18.0% (2 out of 11) exhibiting L. monocytogenes. In ice cream samples, Listeria spp. was presented by 47% (14 out of 30), while L. monocytogenes was not exhibited. Moreover, the addition of B. animalis to soft cheese in a concentration of 5% or combined with B. breve with a concentration of 2.5% for each resulted in decreasing L. monocytogenes efficiently during the ripening of soft cheese for 28 d. Listeria spp. is widely found in milk products. Probiotic bacteria, such as Bifidobacterium spp., can be utilized as a natural antimicrobial to preserve food and dairy products.

1. Introduction

Listeria spp. are ubiquitous and easily assimilated into the food chain. They are found in water, soil, feces, and on plant surfaces [1]. Listeria monocytogenes is the major species that causes foodborne diseases, and it has resulted in several outbreaks due to the consumption of raw milk or soft cheeses [2,3]. Additionally, Listeria can cause listeriosis in neonates, elderly, pregnant women, and immune-compromised patients, which threatens those people’s lives [4]. Listeriosis can result in slight symptoms (e.g., non-invasive febrile gastroenteritis) or severe symptoms (e.g., septicemia, meningitis, abortion) with a high chance of death [3,5]. Between 1998 and 2008, at least 25% of reported listeriosis outbreaks in the United States were caused by dairy products [6].
Ice cream and cheese are very common dairy products around the globe due to their nutritional values. There are several studies that reported the existence of Listeria spp. or L. monocytogenes in dairy products [7,8,9,10,11,12,13,14]. It was found that L. monocytogenes was presented in cheese samples at a ratio of 6.7% (6 out of 90 cheese samples) in Brazil, while 60 ice cream samples did not show any L. monocytogenes [12]. Another study reported that 8.2% of soft cheese samples (63 out of 769) had L. monocytogenes [8]. L. monocytogenes was also found at 3.5% (21 out of 603 samples) and 0.8% (2 out of 256 samples) in ice cream and soft cheese, respectively, in Chile [10].
L. monocytogenes can survive in extreme environmental conditions like freezing, vacuum, and ultraviolet (UV) as well as low-temperature long-time pasteurization [15,16,17]. Moreover, it can grow in a wide range of temperatures (1.0–45.0 °C), pH (4.4–9.0), and salt concentrations (up to 10%), which makes it difficult to control [18].
The application of chemical preservatives in food leads to many public health problems, such as the elevation of the chemical residues in food and increase microbial resistance, which eventually affect human health [19,20]. Today, natural biopreservative agents are utilized in food manufacture, since they do not affect consumer health, and they have many health benefits, such as increasing immune system response and protecting humans from infective microorganisms, for instance, food poisoning bacteria.
Probiotic bacteria are live microorganisms which can provide health benefits in a concentration of 5.0 to 7.0 log cfu/g [21]. Probiotic bacteria are one of the biopreservative highly used in dairy products. In Egypt, most of the soft cheeses are made using rennet only without any starter. Several studies have presented the possibility of using probiotics to inhibit growth L. monocytogenes in different dairy products [22,23,24,25,26]. Probiotics could have an antilisterial effect and might be utilized as additives to inhibit the growth of L. monocytogenes in food [27]. Bifidobacterium strains are some of the probiotic bacteria which have several benefits to human health, namely strengthening the immune system [28], inhibiting different entero-pathogens [29], preventing inflammatory bowel diseases [30], and reducing colon cancer risk [31,32]. Additionally, they improve lactose tolerance, calcium absorption, and vitamin synthesis while lowering serum cholesterol levels [33,34].
To the best of our knowledge, no study has presented the inhibitory effect of Bifidobacterium strains on the growth control of L. monocytogenes in soft cheese. Therefore, the objectives of this work were to investigate the incidence of Listeria spp. and L. monocytogenes in commercial soft cheese and ice cream in the city of Assiut, Egypt, and to examine the inhibitory effect of Bifidobacterium breve, Bifidobacterium animalis, or a mixture of the two on the growth control of L. monocytogenes in soft cheese.

2. Materials and Methods

2.1. Sample Preparations

Sixty samples of soft cheese and ice cream were obtained from various commercial markets in Assiut, Egypt, from January to June 2021. Each cheese sample was placed in a sterilized container under cooling conditions. The ice cream samples were immediately stored in iceboxes during transfer to the lab. A 25 g of each sample was prepared for analysis [35].

2.2. Isolation and Identification of Listeria spp.

The isolation and identification of Listeria spp. were performed, as described previously by Roberts and Greenwood [36], under aseptic conditions. A 225 mL of Listeria enrichment broth medium (CM0862, Oxoid, UK) containing Listeria oxford antimicrobic supplement (4240038, Biolife, Italy) was used to homogenize the sample and then incubated for 1–2 d at 30 °C. The abovementioned broth was then subcultured on an Oxford Listeria agar medium (CM0856, Oxoid, UK) adjunct with Oxoid™ Listeria selective supplement (SR0140, Oxoid, UK). The latter was then incubated at 30 °C for 48 h. The color of Listeria spp. colonies typically ranged from greyish green to brownish green with black zones of 1–3 mm diameter of aesculin hydrolysis.
Five Listeria spp. colonies were selected from each Petri dish of selective agar and cultivated on trypticase soy agar medium (CM0131, Oxoid, UK) supplemented with 0.6% yeast extract and subsequently placed into an incubator at 30 °C for 24 h to perform further analyses, including biochemical assays. Non-spore Gram-positive coccobacilli strains were examined for catalase, umbrella growth in motility, nitrate reduction, MR/VP, β-hemolysis production, CAMP tests (synergistic lysis of red blood cells) against Staphylococcus aureus, and acid formation from glucose, rhamnose, xylose, and mannitol fermentation [36,37].
Polymerase chain reaction (PCR). The DNA isolation of the suspected strains and the standard strain was streaked onto nutrient broth medium and then incubated overnight at 37 °C for DNA extraction by Patho Gene-spin TM DNA/RNA Extraction kit (iNtRON Biotechnology, Seongnam-Si, South Korea, ISO 9001/14001). This was performed following the instructions of the kit. The extracted DNA was stored at −20 °C [38].
The forward and reverse primer made as 907r (CCGTCAATTCCTTTGAGTTT’) and 27f (AGAGTTTGATCCTGGCTCAG) [39] were used to amplify a 900 bp region in the 16S rRNA gene for the detection of Listeria genus. Furthermore, another pair was created to detect L. monocytogenes isolates as F:GCAGTTGCAAGCGCTTGGAGTGAA and R:GCAACGTATCCTCCAGAGTGATCG were used to detect the harboring hlyA gene, which amplified a 456 bp fragment (Applied Biosystem, Foster City, CA, USA) [40].
We followed the same procedures as described previously in our study [41]. PCR was carried out on a total volume of 25 μL as follows: 12.5 μL of 2X PCR master mix (Green Master, Promega, Madison, WI, USA), 150 ng of the DNA template, 0.5 μM of each primer, and 25 μL Nuclease free water were thoroughly mixed in a PCR tube. The amplification occurred in Gradient Thermal Cycler (Veriti Applied Biosystem, USA), 2 min at 94 °C, then 35 cycles were run according to the following conditions: 2 min denaturation at 94 °C, annealing at 55 °C for 45 s, and extension at 72 °C for 2 min. Eventually, the mixture was kept for 7 min at 72 °C as a final extension.
PCR products were electrophoresed in 1% agarose gel (GX 040.90, Gen AGarose, L.E., Standard DNA/RNA agarose, Molecular Biology Grade, Inno–Train Diagnostic, D–61476, Kronberg/Taunus) containing ethidium bromide as 1 µL ml−1 electrophoresis buffer at 100 volts for 60 min. Using 100 bp DNA–ladder in (SCiE–PLAS, HU 10, 5636, Cambridge, UK). The data were recorded using high performance UV trans illuminator (UV, Inc., Leicester, UK). The images of the PCR end products were analyzed using DOC–It ® LS, Image acquisition software (Biodoc Analyzer, Biometra, Germany).

2.3. Effect of Some Bifidobacterium spp. on Survival of L. monocytogenes in Soft Cheese

Preparation of L. monocytogenes. The previous isolated L. monocytogenes were propagated in tryptic soy broth for 24 h at 37 °C. As described in a previous study [42] with some modifications, 1 mL of the culture was regularly diluted in peptone/saline solution to obtain the desired concentration and then added to the milk to yield a concentration of 10 log cfu mL−1.
Preparation of Bifidobacterium spp. The reference strains of Bifidobacterium breve (ATCC 15700) and Bifidobacterium animalis subsp. lactis (CIP 105265) were obtained from the Egyptian Microbial Culture Collection (Cairo, Egypt). The strains were propagated in MRS broth (de Man, Rogosa, and Sharpe broth, CM0361, Oxoid, UK) at 37 °C for 24 h under anaerobic conditions. One milliliter of the culture was diluted using a serial method in peptone/saline solution to attain the desired inoculum level and then added to the milk to produce a 10 log cfu mL−1 concentration.

2.4. Manufacture of Soft Cheese with Bifidobacterium spp.

Soft cheese was manufactured from milk where 10 L of milk were pasteurized at 63 °C for 30 min and cooled to 40 °C. Then salt and rennet were added at a concentration of 15 g L−1 and 15 mL L−1, respectively [43,44]. The milk was divided into 4 aliquots; the first one was made without any additives, the second part was manufactured using B. breve (5%), the third part was made using B. animalis (5%), and the fourth part made through the addition of the two previous strains (2.5% for each strain). The treated milk was left for 45 min at 30 °C in an incubator until the curd was set, and then the whey was drained. Cheese samples were kept refrigerated at a low temperature (4 ± 2 °C) and analyzed for L. monocytogenes count, Bifidobacterium count, and pH at 0 h (after making the curd), 1, 2, 3, 7, 14, 21, and 28 d.

2.5. Bacteriological Examination of Soft Cheese

Under a complete septic condition, 10 g of each cheese sample were placed into a sterile mortar with sterile white sand. These samples were thoroughly ground and mixed with 90 mL of sterile 2% sodium citrate solution to obtain a dilution of 10−1, from which decimal serial dilutions were prepared [35,37]. Over a dry surface oxford Listeria selective agar (CM0856, Oxoid, UK) supplemented with Listeria selective supplement (SR0140, Oxoid, UK) and MRS agar (Himedia, India), 0.1 mL from every serial dilution of samples under examination was transferred and evenly spread using surface plating technique. The inoculated Oxford Listeria selective agar plates were incubated at 30 °C for 48 h [36], while inoculated MRS agar was incubated anaerobically at 37 °C for 7 d. The number of colonies in countable plates was enumerated and L. monocytogenes and Bifidobacterium counts per g were calculated and recorded.

2.6. Measurement of pH

The pH value of each sample was determined according to the standard methods [35] using a calibrated pH meter (with a buffer solution of pH 4.0 and 7.0) (Hanna, Portugal).

2.7. Statistical Analyses

Statistical analysis was performed using R software (R ×64−3.3.3, R Foundation for Statistical Computing) to study the effects of treatment and storage time and the interaction of those factors on the shelf-stability of soft cheese. Two-way ANOVA was performed to compare means at p < 0.05 using the Tukey test.

3. Results and Discussion

Table 1 shows the existence of Listeria spp. in soft cheese and ice cream samples. The incidence of Listeria spp. was 25 (41.66%) out of the obtained 60 samples of dairy products. Eleven samples (36.66%) were contaminated with Listeria spp. in soft cheese samples, while fourteen samples (46.66%) of the ice cream samples contained the same bacteria (Figure 1). These results were slightly lower than the results obtained and reported in another study [45], at which Listeria spp. was found in 40% of the examined cheese samples. However, the obtained data were higher than other values reported in different studies [37,46,47,48,49]. The differences in contamination of dairy products with Listeria spp. could be related to the properties of initial material as well as processing and environmental conditions.
Table 2 presents the presence of L. monocytogenes in cheese and ice cream samples. The frequency distribution of L. monocytogenes in the positively examined samples was two samples (18.18%) in the soft cheese samples (Figure 2). On the other hand, L. monocytogenes were not detected in the ice cream samples. The incidence values of L. monocytogenes in soft cheese samples is higher than the results pointed out by other researchers [47,49]. Moreover, the incidence of L. monocytogenes in the examined ice cream samples in this study is similar to another study [50], while the count of L. monocytogenes in this study is lower than the results carried out in other studies [45,46]. One study in Brazil detected L. monocytogenes in cheese samples at a ratio of 6.7%, and this was not found in ice cream samples [12]. Another study reported that 63 soft cheese samples out of 769 had L. monocytogenes [8]. L. monocytogenes was also found in Chile in 21 out of 603 ice cream samples and 2 out of 256 soft cheese samples [10].
The high incidence of Listeria spp. could be due to the use of unpasteurized milk, unsanitary production, and food storage, as Listeria spp., in particular, can maintain its growth rate in low salt concentration media and low temperatures (4 °C) [15,16,17,18]. As a result, the cheese could be the suitable media for the growth and multiplication of the different species of Listeria, including L. monocytogenes.
Table 3 exemplifies the inhibitory impact of Bifidobacterium spp. on L. monocytogenes in cheesemaking. The count of L. monocytogenes decreased gradually in the control sample until 28 d of storage at 4 °C. The count began at 10.5 log cfu g−1 and reached 5.3 log cfu g−1 by the end of the 28 d. On the other hand, the L. monocytogenes count decreased in the soft cheese made with B. breve during storage. It could not be detected in the sample at the end of storage with a reduction percentage of 100% at 28 d of storage. Moreover, the addition of B. animalis only or combined with B. breve to the soft cheese produced a high reduction rate that reached 100% after 21 d, and L. monocytogenes could not be isolated from soft cheese after 21 d of storage at 4 °C. In comparison between the percentage reduction of L. monocytogenes in soft cheese made with B. animalis and soft cheese made with the mix, the percentage reduction of the first treatment ranged from (13.0 to 100%), while the percentage reduction of the second treatment ranged from (1.8 to 100%). From those data, the optimum method for inhibiting the growth of L. monocytogenes (p < 0.05) is using B. animalis at a 5% concentration when making cheese. Many previous studies reported the effect of Bifidobacterium spp. against L. monocytogenes strain [51,52,53,54]. This is due to the ability of Bifidobacterium spp. to produce antibacterial peptides, such as bacteriocins, which have an inhibitory impact on the growth of L. monocytogenes [25,55].
Table 4 displays Bifidobacterium count in soft cheese made with Bifidobacterium spp. during storage for 28 d. Table 5 shows the pH of the cheese during storage for 28 d. As can be seen from Table 4, the B. breve and B. animalis counts gradually increased from 0 d until the end of 28 d in the soft cheese made using these bacteria and rennet. This might be due to the fact that pH did not decrease significantly (Table 5). The Bifidobacterium spp. increased from approximately 10.0 log cfu g−1 to around 11.0 log cfu g−1 with a slight change in pH in all treatments. Moreover, the high count of Bifidobacterium spp. In the finished product could provide many benefits to the health of consumers.
Strains of Bifidobacterium spp., such as B. animalis and B. breve, are used as adjunct cultures in several dairy products. Cultures of Bifidobacterium have been utilized efficiently in some cheese studies, since the pH and fat content of cheeses, as well as their buffering impact, may increase the viability of those microbes in terms of shelf-life [56]. In addition, the cheese matrix also has a role in sustaining the probiotic bacteria in low pH and bile salts present in the gastrointestinal tract of the human after cheese consumption [57]. Moreover, Bifidobacterium spp. has an inhibitory effect on intestinal pathogens, due to elevating the antibody production, blocking adhesion sites on the mucosal epithelium, decreasing the pH of the gut, blocking toxin receptor sites, and the secretion of antibacterial protein compounds, such as bacteriocins [58].

4. Conclusions

In conclusion, the results obtained in this study demonstrate that soft cheese and ice cream can be contaminated by Listeria spp. Traditionally, soft cheese has been viewed as the source of L. monocytogenes infection. Modifications of the manufacture of soft cheese through the addition of certain species of Bifidobacterium, especially B. animalis, can lead to a significant antilisterial effect.

Author Contributions

Conceptualization, R.M.E., W.S.H. and D.G.K.; methodology, R.M.E., W.S.H. and D.G.K.; software, R.M.E., W.S.H., M.S.E., R.R.A., A.R.A.H. and D.G.K.; validation, R.M.E., W.S.H., M.S.E., R.R.A., A.R.A.H. and D.G.K.; formal analysis, R.M.E., W.S.H. and D.G.K.; investigation, R.M.E., W.S.H., M.S.E., R.R.A., A.R.A.H. and D.G.K.; resources, R.M.E., W.S.H., M.S.E., R.R.A., A.R.A.H. and D.G.K.; data curation, R.M.E., W.S.H. and D.G.K.; writing—original draft preparation, R.M.E., W.S.H., M.S.E., R.R.A., A.R.A.H. and D.G.K.; writing—review and editing, R.M.E., W.S.H., M.S.E., R.R.A., A.R.A.H. and D.G.K.; visualization, R.M.E., W.S.H., M.S.E., R.R.A., A.R.A.H. and D.G.K.; supervision, R.M.E., W.S.H. and D.G.K.; project administration, R.M.E., W.S.H. and D.G.K.; funding acquisition, R.M.E., W.S.H. and D.G.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Data Availability Statement

Data sharing not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rogga, K.J.; Samelis, J.; Kakouri, A.; Katsiari, M.C.; Savvaidis, I.N.; Kontominas, M.G. Survival of Listeria monocytogenes in Galotyri, a traditional Greek soft acid-curd cheese, stored aerobically at 4 °C and 12 °C. Int. Dairy J. 2005, 15, 59–67. [Google Scholar] [CrossRef]
  2. Rahimi, E.; Ameri, M.; Momtaz, H. Prevalence and antimicrobial resistance of Listeria species isolated from milk and dairy products in Iran. Food Control 2010, 21, 1448–1452. [Google Scholar] [CrossRef]
  3. Kevenk, T.O.; Terzi Gulel, G. Prevalence, Antimicrobial Resistance and Serotype Distribution of Listeria monocytogenes Isolated from Raw Milk and Dairy Products. J. Food Saf. 2016, 36, 11–18. [Google Scholar] [CrossRef]
  4. Rahimi, E.; Momtaz, H.; Sharifzadeh, A.; Behzadnia, A.; Ashtari, M.S.; Esfahani, S.Z.; Riahi, M.; Momeni, M. Prevalence and antimicrobial resistance of Listeria species isolated from traditional dairy products in Chahar Mahal & Bakhtiyari, Iran. Bulg. J. Vet. Med. 2012, 15, 115–122. [Google Scholar]
  5. Shamloo, E.; Jalali, M.; Mirlohi, M.; Madani, G.; Metcalf, D.; Merasi, M.R. Prevalence of Listeria species in raw milk and traditional dairy products in Isfahan, Iran. Int. J. Environ. Health Eng. 2015, 4, 1. [Google Scholar] [CrossRef]
  6. Allerberger, F.; Wagner, M. Listeriosis: A resurgent foodborne infection. Clin. Microbiol. Infect. 2010, 16, 16–23. [Google Scholar] [CrossRef] [Green Version]
  7. Ottesen, A.; Ramachandran, P.; Reed, E.; White, J.R.; Hasan, N.; Subramanian, P.; Ryan, G.; Jarvis, K.; Grim, C.; Daquiqan, N.; et al. Enrichment dynamics of Listeria monocytogenes and the associated microbiome from naturally contaminated ice cream linked to a listeriosis outbreak. BMC Microbiol. 2016, 16, 275. [Google Scholar] [CrossRef] [Green Version]
  8. Greenwood, M.H.; Roberts, D.; Burden, P. The occurrence of Listeria species in milk and dairy products: A national survey in England and Wales. Int. J. Food Microbiol. 1991, 12, 197–206. [Google Scholar] [CrossRef]
  9. Kozak, J.; Balmer, T.; Byrne, R.; Fisher, K. Prevalence of Listeria monocytogenes in foods: Incidence in dairy products. Food Control 1996, 7, 215–221. [Google Scholar] [CrossRef]
  10. Cordano, A. Occurrence of Listeria monocytogenes in food in Chile. Int. J. Food Microbiol. 2001, 70, 175–178. [Google Scholar] [CrossRef]
  11. Pouillot, R.; Klontz, K.C.; Chen, Y.; Burall, L.S.; Macarisin, D.; Doyle, M.; Bally, K.M.; Strain, E.; Datta, A.R.; Hammack, T.S.; et al. Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015. Emerg. Infect. Dis. 2016, 22, 2113–2119. [Google Scholar] [CrossRef] [PubMed]
  12. Abrahão, W.M.; Abrahão, P.R.D.S.; Monteiro, C.L.B.; Pontarolo, R. Occurrence of Listeria monocytogenes in cheese and ice cream produced in the State of Paraná, Brazil. Rev. Bras. Ciênc. Farm. 2008, 44, 289–296. [Google Scholar] [CrossRef]
  13. Manfreda, G.; De Cesare, A.; Stella, S.; Cozzi, M.; Cantoni, C. Occurrence and ribotypes of Listeria monocytogenes in Gorgonzola cheeses. Int. J. Food Microbiol. 2005, 102, 287–293. [Google Scholar] [CrossRef]
  14. Colak, H.; Hampikyan, H.; Bingol, E.B.; Ulusoy, B. Prevalence of L. monocytogenes and Salmonella spp. in Tulum cheese. Food Control 2007, 18, 576–579. [Google Scholar] [CrossRef]
  15. Gill, C.O.; Reichel, M.P. Growth of the cold-tolerant pathogens Yersinia enterocolitica, Aeromonas hydrophila and Listeria monocytogenes on high-pH beef packaged under vacuum or carbon dioxide. Food Microbiol. 1989, 6, 223–230. [Google Scholar] [CrossRef]
  16. Yousef, A.H.E.; Marth, E.L.H. Inactivation of Listeria monocytogenes by Ultraviolet Energy. J. Food Sci. 1988, 53, 571–573. [Google Scholar] [CrossRef]
  17. Farber, J.M.; Sanders, G.W.; Speirs, J.I.; D’Aoust, J.-Y.; Emmons, D.B.; McKellar, R. Thermal resistance of Listeria monocytogenes in inoculated and naturally contaminated raw milk. Int. J. Food Microbiol. 1988, 7, 277–286. [Google Scholar] [CrossRef]
  18. Seeliger, H.P.R.; Jones, D. Genus Listeria. In Bergey’s Manual of Systematic Bacteriology; Sneath, P.H.A., Mair, N.S., Sharpe, M.E., Holt, J.G., Eds.; Williams & Wilkins: Baltimore, MD, USA, 1986; pp. 1235–1245. [Google Scholar]
  19. Hammam, A.R.A.; Ahmed, M.S.I. Technological aspects, health benefits, and sensory properties of probiotic cheese. SN Appl. Sci. 2019, 1, 1113. [Google Scholar] [CrossRef] [Green Version]
  20. Hassanzadazar, H.; Ehsani, A.; Mardani, K. Antibacterial activity of Enterococcus faecium derived from Koopeh cheese against Listeria monocytogenes in probiotic ultra-filtrated cheese. In Veterinary Research Forum: An International Quarterly Journal; Faculty of Veterinary Medicine, Urmia University: Urmia, Iran, 2014; Volume 5, p. 169. [Google Scholar]
  21. Wu, M.; Dong, Q.; Ma, Y.; Yang, S.; Zohaib Aslam, M.; Liu, Y.; Li, Z. Potential antimicrobial activities of probiotics and their derivatives against Listeria monocytogenes in food field: A review. Food Res. Int. 2022, 160, 111733. [Google Scholar] [CrossRef]
  22. Jesus, A.L.T.; Fernandes, M.S.; Kamimura, B.A.; Prado-Silva, L.; Silva, R.; Esmerino, E.A.; Cruz, A.G.; Sant’Ana, A.S. Growth potential of Listeria monocytogenes in probiotic cottage cheese formulations with reduced sodium content. Food Res. Int. 2016, 81, 180–187. [Google Scholar] [CrossRef]
  23. Martinez, R.C.R.; Staliano, C.D.; Vieira, A.D.S.; Villarreal, M.L.M.; Todorov, S.D.; Saad, S.M.I.; de Melo Franco, B.D.G. Bacteriocin production and inhibition of Listeria monocytogenes by Lactobacillus sakei subsp. sakei 2a in a potentially synbiotic cheese spread. Food Microbiol. 2015, 48, 143–152. [Google Scholar] [CrossRef] [PubMed]
  24. Prezzi, L.E.; Lee, S.H.I.; Nunes, V.M.R.; Corassin, C.H.; Pimentel, T.C.; Rocha, R.S.; Ramos, G.L.P.A.; Guimarães, J.T.; Balthazar, C.F.; Duarte, M.C.K.H.; et al. Effect of Lactobacillus rhamnosus on growth of Listeria monocytogenes and Staphylococcus aureus in a probiotic Minas Frescal cheese. Food Microbiol. 2020, 92, 103557. [Google Scholar] [CrossRef] [PubMed]
  25. Agriopoulou, S.; Stamatelopoulou, E.; Sachadyn-Król, M.; Varzakas, T. Lactic Acid Bacteria as Antibacterial Agents to Extend the Shelf Life of Fresh and Minimally Processed Fruits and Vegetables: Quality and Safety Aspects. Microorganisms 2020, 8, 952. [Google Scholar] [CrossRef] [PubMed]
  26. Saavedra, J.M.; Tschernia, A. Human studies with probiotics and prebiotics: Clinical implications. Br. J. Nutr. 2002, 87, S241–S246. [Google Scholar] [CrossRef] [PubMed]
  27. Shu, Q.; Qu, F.; Gill, H.S. Probiotic treatment using Bifidobacterium lactis HN019 reduces weanling diarrhea associated with rotavirus and Escherichia coli infection in a piglet model. J. Pediatr. Gastroenterol. Nutr. 2001, 33, 171–177. [Google Scholar] [CrossRef]
  28. Marteau, P.R. Probiotics in clinical conditions. Clin. Rev. Allergy Immunol. 2002, 22, 255–273. [Google Scholar] [CrossRef]
  29. Yazawa, K.; Fujimori, M.; Nakamura, T.; Sasaki, T.; Amano, J.; Kano, Y.; Taniguchi, S. Bifidobacterium longum as a delivery system for gene therapy of chemically induced rat mammary tumors. Breast Cancer Res. Treat. 2001, 66, 165–170. [Google Scholar] [CrossRef]
  30. Li, X.; Fu, G.-F.; Fan, Y.-R.; Liu, W.-H.; Liu, X.-J.; Wang, J.-J.; Xu, G.-X. Bifidobacterium adolescentis as a delivery system of endostatin for cancer gene therapy: Selective inhibitor of angiogenesis and hypoxic tumor growth. Cancer Gene Ther. 2003, 10, 105–111. [Google Scholar] [CrossRef] [Green Version]
  31. Palacios, M.C.; Haros, M.; Rosell, C.M.; Sanz, Y. Selection of phytate-degrading human bifidobacteria and application in whole wheat dough fermentation. Food Microbiol. 2008, 25, 169–176. [Google Scholar] [CrossRef]
  32. Wu, X.-L.; Li, Y.-F.; Zhou, B.-Y.; Wu, L.-J.; Wu, Z.-J. Effects of bifidobacteria on respiratory and gastrointestinal tracts in neonates receiving mechanical ventilation. Chin. J. Contemp. Pediatrics 2011, 13, 704–707. [Google Scholar]
  33. Wehr, H.M.; Frank, J.F. Standard Methods for the Examination of Dairy Products, 17th ed.; American Public Health Association: Washington, DC, USA, 2004; ISBN 0875530028. [Google Scholar]
  34. Roberts, D.; Greenwood, M. Practical Food Microbiology; Roberts, D., Greenwood, M., Eds.; Blackwell Publishing Ltd.: Malden, MA, USA, 2003; ISBN 9781405100755. [Google Scholar]
  35. Elshinaway, S.; Meshref, A.; Zeinhom, M.; Hafez, D. Incidence of listeria species in some dairy products in beni-suef governorate. Assiut Vet. Med. J. 2017, 63, 5–13. [Google Scholar] [CrossRef]
  36. Elbassiony, T.A.; Abd EL Mgeed, A.S.M.; Ewida, R.M. Prevalence of Some Spore Forming Food Poisoning Bacteria in Milk and Some Milk Products. J. Adv. Vet. Res. 2021, 11, 243–246. [Google Scholar]
  37. Beasley, S.S.; Saris, P.E.J. Nisin-Producing Lactococcus lactis Strains Isolated from Human Milk. Appl. Environ. Microbiol. 2004, 70, 5051–5053. [Google Scholar] [CrossRef] [PubMed]
  38. Paziak-Domańska, B.; Bogusławska, E.; Więckowska-Szakiel, M.; Kotłowski, R.; Różalska, B.; Chmiela, M.; Kur, J.; Dąbrowski, W.; Rudnicka, W. Evaluation of the API test, phosphatidylinositol-specific phospholipase C activity and PCR method in identification of Listeria monocytogenes in meat foods. FEMS Microbiol. Lett. 1999, 171, 209–214. [Google Scholar] [CrossRef]
  39. Ewida, R.M.; El-Magiud, D.S.M.A. Species adulteration in raw milk samples using polymerase chain reaction-restriction fragment length polymorphism. Vet. World 2018, 11, 830–833. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Dean, J.P.; Zottola, E.A. Use of Nisin in Ice Cream and Effect on the Survival of Listeria monocytogenes. J. Food Prot. 1996, 59, 476–480. [Google Scholar] [CrossRef]
  41. Ahmed, M.E.; Rathnakumar, K.; Awasti, N.; Elfaruk, M.S.; Hammam, A.R.A. Influence of probiotic adjunct cultures on the characteristics of low-fat Feta cheese. Food Sci. Nutr. 2021, 9, 1512–1520. [Google Scholar] [CrossRef]
  42. Hamdy, A.M.; Ahmed, M.E.; Mehta, D.; Elfaruk, M.S.; Hammam, A.R.A.; El-Derwy, Y.M.A. Enhancement of low-fat Feta cheese characteristics using probiotic bacteria. Food Sci. Nutr. 2021, 9, 62–70. [Google Scholar] [CrossRef]
  43. El-Zamkan, M.A.; Hendy, B.A.; Diab, H.M.; Marraiki, N.; Batiha, G.E.-S.; Saber, H.; Younis, W.; Thangamani, S.; Alzahrani, K.J.; Ahmed, A.S. Control of Virulent Listeria monocytogenes Originating from Dairy Products and Cattle Environment Using Marine Algal Extracts, Silver Nanoparticles Thereof, and Quaternary Disinfectants. Infect. Drug Resist. 2021, 14, 2721–2739. [Google Scholar] [CrossRef]
  44. Youssef, M.; Ramadan, H.; Al-Ashmawy, M. Prevalence of Listeria species in raw milk, ice cream and yogurt and effect of selected natural herbal extract on its survival. Mansoura Vet. Med. J. 2020, 21, 99–106. [Google Scholar] [CrossRef]
  45. Şanlibaba, P.; Uymaz Tezel, B.; Çakmak, G.A. Detection of Listeria spp. In raw milk and dairy products retailed in ankara. J. Food 2018, 43, 273–282. [Google Scholar] [CrossRef] [Green Version]
  46. Reda, W.W.; Abdel-Moein, K.; Hegazi, A.; Mohamed, Y.; Abdel-Razik, K. Listeria monocytogenes: An emerging food-borne pathogen and its public health implications. J. Infect. Dev. Ctries. 2016, 10, 149–154. [Google Scholar] [CrossRef] [PubMed]
  47. Abd El Tawab, A.A.; Maarouf, A.A.A.; Mahdy, Z.A.M. Bacteriological and Molecular studies of Listeria species in milk and milk products at El-Kaliobia Governorate. Benha Vet. Med. J. 2015, 29, 170–181. [Google Scholar] [CrossRef]
  48. Abdeen, E.E.; Mousa, W.S.; Harb, O.H.; Fath-Elbab, G.A.; Nooruzzaman, M.; Gaber, A.; Alsanie, W.F.; Abdeen, A. Prevalence, Antibiogram and Genetic Characterization of Listeria monocytogenes from Food Products in Egypt. Foods 2021, 10, 1381. [Google Scholar] [CrossRef] [PubMed]
  49. Bialonska, D.; Ramnani, P.; Kasimsetty, S.G.; Muntha, K.R.; Gibson, G.R.; Ferreira, D. The influence of pomegranate by-product and punicalagins on selected groups of human intestinal microbiota. Int. J. Food Microbiol. 2010, 140, 175–182. [Google Scholar] [CrossRef]
  50. Akinyemi, K.; Oluwa, O.; Omomigbehin, E. Antimicrobial activity of crude extracts of three medicinal plants used in South-West Nigerian folk medicine on some food borne bacterial pathogens. Afr. J. Tradit. Complement. Altern. Med. 2006, 3, 13–22. [Google Scholar] [CrossRef] [Green Version]
  51. Voidarou, C.; Alexopoulos, A.; Tsinas, A.; Rozos, G.; Tzora, A.; Skoufos, I.; Varzakas, T.; Bezirtzoglou, E. Effectiveness of Bacteriocin-Producing Lactic Acid Bacteria and Bifidobacterium Isolated from Honeycombs against Spoilage Microorganisms and Pathogens Isolated from Fruits and Vegetables. Appl. Sci. 2020, 10, 7309. [Google Scholar] [CrossRef]
  52. Rios-Covian, D.; Nogacka, A.; Salazar, N.; Hernández-Barranco, A.M.; Cuesta, I.; Gueimonde, M.; de los Reyes Gavilán, C.G. Bifidobacterium breve IPLA20005 affects in vitro the expression of hly and luxS genes, related to the virulence of Listeria monocytogenes Lm23. Can. J. Microbiol. 2018, 64, 215–221. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Othman, H.E.; Abdelsamei, H.M.; Abdou, A.M.; Ibrahim, E.M.A.; Elbaba, A.H. Comparative studies of Listeria monocytogenes survival in bifidus and traditional yoghurt during production and storage. Benha Vet. Med. J. 2017, 32, 121–126. [Google Scholar] [CrossRef]
  54. Toure, R.; Kheadr, E.; Lacroix, C.; Moroni, O.; Fliss, I. Production of antibacterial substances by bifidobacterial isolates from infant stool active against Listeria monocytogenes. J. Appl. Microbiol. 2003, 95, 1058–1069. [Google Scholar] [CrossRef]
  55. Martinez, F.A.C.; Balciunas, E.M.; Converti, A.; Cotter, P.D.; de Souza Oliveira, R.P. Bacteriocin production by Bifidobacterium spp. A review. Biotechnol. Adv. 2013, 31, 482–488. [Google Scholar] [CrossRef] [PubMed]
  56. Murtaza, M.A.; Huma, N.; Shabbir, M.A.; Murtaza, M.S.; Anees-ur-Rehman, M. Survival of micro-organisms and organic acid profile of probiotic Cheddar cheese from buffalo milk during accelerated ripening. Int. J. Dairy Technol. 2017, 70, 562–571. [Google Scholar] [CrossRef]
  57. De Almeida, J.D.S.O.; Dias, C.O.; Pinto, S.S.; Pereira, L.C.; Verruck, S.; Fritzen-Freire, C.B.; Amante, E.R.; Prudêncio, E.S.; Amboni, R.D.M.C. Probiotic Mascarpone-type cheese: Characterisation and cell viability during storage and simulated gastrointestinal conditions. Int. J. Dairy Technol. 2018, 71, 195–203. [Google Scholar] [CrossRef]
  58. Fooks, L.J.; Fuller, R.; Gibson, G.R. Prebiotics, probiotics and human gut microbiology. Int. Dairy J. 1999, 9, 53–61. [Google Scholar] [CrossRef]
Figure 1. Polymerase chain reaction (PCR) products of amplified 16S rRNA of Listeria spp. Lane M = DNA ladder 50 bp; Lane 1–9 = positive strains with specific bands at 900 bp; Lane 10 = positive control (L. monocytogenes ATCC 7644); Lane 11 = negative control (Bifidobacterium breve ATCC 15700).
Figure 1. Polymerase chain reaction (PCR) products of amplified 16S rRNA of Listeria spp. Lane M = DNA ladder 50 bp; Lane 1–9 = positive strains with specific bands at 900 bp; Lane 10 = positive control (L. monocytogenes ATCC 7644); Lane 11 = negative control (Bifidobacterium breve ATCC 15700).
Foods 11 03443 g001
Figure 2. Polymerase chain reaction (PCR) products of hlyA fragments from Listeria monocytogenes. Lane M = DNA ladder 50 bp; Lane 1 and 2 = positive samples with specific bands at 456 bp; Lane 3 = positive control (L. monocytogenes ATCC 7644); Lane 4 = negative control.
Figure 2. Polymerase chain reaction (PCR) products of hlyA fragments from Listeria monocytogenes. Lane M = DNA ladder 50 bp; Lane 1 and 2 = positive samples with specific bands at 456 bp; Lane 3 = positive control (L. monocytogenes ATCC 7644); Lane 4 = negative control.
Foods 11 03443 g002
Table 1. Listeria spp. in the examined soft cheese and ice cream samples.
Table 1. Listeria spp. in the examined soft cheese and ice cream samples.
SamplesNo.No. of Contaminated Samples
No. %
Soft cheese301136.66
Ice cream301446.66
Total602541.66
Table 2. Listeria monocytogenes recovered from the examined soft cheese and ice cream samples.
Table 2. Listeria monocytogenes recovered from the examined soft cheese and ice cream samples.
SamplesNo.No. of Contaminated Samples
No. %
Soft cheese11218.18
Ice cream14-0
Total2528.00
Table 3. Count (log cfu g−1) and percentage reduction of L. monocytogenes inoculated in manufactured soft cheese with Bifidobacterium spp. stored at 4 ± 2 °C.
Table 3. Count (log cfu g−1) and percentage reduction of L. monocytogenes inoculated in manufactured soft cheese with Bifidobacterium spp. stored at 4 ± 2 °C.
Storage Time (d)Treatments 1SEMp-Value 2
Rennet CheeseB. breve CheeseB. animalis CheeseMixed Culture Cheese
CountCountRed.
%
CountRed.
%
CountRed.
%
TrtTimeTrt × Time
010.4810.311.69.1213.010.291.80.16
111.308.7722.45.1154.85.3153.00.77
29.166.4629.54.0555.84.7847.80.59
37.394.2542.53.0858.33.5352.20.51
76.233.6641.32.9253.12.9952.00.41
145.473.3838.22.5653.22.6851.00.35
215.233.0441.90.001000.001000.66
285.300.001000.001000.001000.69
SEM0.470.65 0.57 0.64
Mean7.57 a4.98 b 3.35 d 3.69 c <0.05<0.05<0.05
a–d Means in the same row not sharing a common superscript are different at p < 0.05. 1 Treatments: Rennet cheese = Soft cheese made with rennet only; B. breve cheese = Soft cheese made with 5% B. breve; B. animalis cheese = Soft cheese made with 5% B. animalis; Mixed culture cheese = Soft cheese made with 2.5% B. breve and 2.5% B. animalis. 2 p-values for the effect of treatment (Trt), Time, and Treatment × Time.
Table 4. Count of Bifidobacterium spp. (log cfu g−1) in manufactured soft cheese stored at 4 ± 2 °C.
Table 4. Count of Bifidobacterium spp. (log cfu g−1) in manufactured soft cheese stored at 4 ± 2 °C.
Storage Time (d)Treatments 1SEMp-Value 2
Rennet CheeseB. breve CheeseB. animalis CheeseMixed Culture CheeseTrtTimeTrt × Time
0ND 310.649.9810.551.36
1ND10.7010.5010.831.39
2ND10.9710.7211.111.43
3ND11.1111.1111.321.46
7ND12.5012.7812.811.66
14ND15.2214.8314.761.95
21ND15.6316.3016.702.12
28ND16.5315.1816.012.08
SEM0.000.480.480.48
Mean0.0012.91 b12.67 c13.01 a <0.05<0.05<0.05
a–c Means in the same row not sharing a common superscript are different at p < 0.05. 1 Treatments: Rennet cheese = Soft cheese made with rennet only; B. breve cheese = Soft cheese made with 5% B. breve; B. animalis cheese = Soft cheese made with 5% B. animalis; Mixed culture cheese = Soft cheese made with 2.5% B. breve and 2.5% B. animalis. 2 p-values for the effect of treatment (Trt), Time, and Treatment × Time. 3 ND= not detected.
Table 5. The pH of manufactured soft cheese with Bifidobacterium spp. stored at 4 ± 2 °C.
Table 5. The pH of manufactured soft cheese with Bifidobacterium spp. stored at 4 ± 2 °C.
Storage Time (d)Treatments 1SEMp-Value 2
Rennet CheeseB. breve CheeseB. animalis CheeseMixed Culture CheeseTrtTimeTrt × Time
06.506.205.705.760.10
16.356.135.515.660.10
25.905.775.145.410.09
36.425.805.305.320.14
76.436.385.755.890.09
146.466.405.705.750.11
216.486.425.695.720.11
286.506.455.655.690.12
SEM0.040.050.040.04
Mean6.38 a6.19 b5.55 d5.65 c <0.05<0.05<0.05
a–d Means in the same row not sharing a common superscript are different at p < 0.05. 1 Treatments: Rennet cheese = Soft cheese made with rennet only; B. breve cheese = Soft cheese made with 5% B. breve; B. animalis cheese = Soft cheese made with 5% B. animalis; Mixed culture cheese = Soft cheese made with 2.5% B. breve and 2.5% B. animalis. 2 p-values for the effect of treatment (Trt), Time, and Treatment × Time.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ewida, R.M.; Hasan, W.S.; Elfaruk, M.S.; Alayouni, R.R.; Hammam, A.R.A.; Kamel, D.G. Occurrence of Listeria spp. in Soft Cheese and Ice Cream: Effect of Probiotic Bifidobacterium spp. on Survival of Listeria monocytogenes in Soft Cheese. Foods 2022, 11, 3443. https://doi.org/10.3390/foods11213443

AMA Style

Ewida RM, Hasan WS, Elfaruk MS, Alayouni RR, Hammam ARA, Kamel DG. Occurrence of Listeria spp. in Soft Cheese and Ice Cream: Effect of Probiotic Bifidobacterium spp. on Survival of Listeria monocytogenes in Soft Cheese. Foods. 2022; 11(21):3443. https://doi.org/10.3390/foods11213443

Chicago/Turabian Style

Ewida, Rania M., Walaa S. Hasan, Mohamed Salem Elfaruk, Raed Reshaid Alayouni, Ahmed R. A. Hammam, and Dalia G. Kamel. 2022. "Occurrence of Listeria spp. in Soft Cheese and Ice Cream: Effect of Probiotic Bifidobacterium spp. on Survival of Listeria monocytogenes in Soft Cheese" Foods 11, no. 21: 3443. https://doi.org/10.3390/foods11213443

APA Style

Ewida, R. M., Hasan, W. S., Elfaruk, M. S., Alayouni, R. R., Hammam, A. R. A., & Kamel, D. G. (2022). Occurrence of Listeria spp. in Soft Cheese and Ice Cream: Effect of Probiotic Bifidobacterium spp. on Survival of Listeria monocytogenes in Soft Cheese. Foods, 11(21), 3443. https://doi.org/10.3390/foods11213443

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop