Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Preparation of SPO
2.3. C. elegans Culture and Synchronization
2.4. Life Span Assay
2.5. Juglone Resistance Assay
2.6. Endogenous ROS Assay
2.7. Fat Accumulation Analysis
2.8. Quantification of T-SOD, CAT, MDA and TG
2.9. Gene Expression
2.10. Statistical Analysis
3. Results and Discussion
3.1. The Effect of SPO on C. elegans Lifespan and Oxidative Stress
3.2. Effect of SPO on Endogenous Oxidative Stress and Antioxidant Enzymes
3.3. Effect of SPO on Oxidative Stress-Related Gene Expression
3.4. Effect of SPO on Oxidative Stress of Mutants Induced with Juglone
3.5. Effects of SPO on Fat and TG Accumulation
3.6. Effects of SPO on Regulating Fat Metabolism
3.7. Effect of SPO on TG Level in Mutants
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- House, J. Consumer acceptance of insect-based foods in the Netherlands: Academic and commercial implications. Appetite 2016, 107, 47–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rao, P.U. Chemical Composition and Nutritional Evaluation of Spent Silk Worm Pupae. J. Agric. Food Chem. 1994, 42, 2201–2203. [Google Scholar] [CrossRef]
- Sreekantuswamy, H.S.; Siddalingaiah, K.S. Sterols and fatty acids from the neutral lipids of desilked silkworm pupae (Bombyx mori L.). Fette Seifen Anstrichm. 1981, 83, 97–99. [Google Scholar] [CrossRef]
- Connor, W.E. Importance of n-3 fatty acids in health and disease. Am. J. Clin. Nutr. 2000, 71, 171S–175S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Erkkilä, A.; de Mello, V.D.; Risérus, U.; Laaksonen, D.E. Dietary fatty acids and cardiovascular disease: An epidemiological approach. Prog. Lipid Res. 2008, 47, 172–187. [Google Scholar] [CrossRef]
- Balk, E.M.; Lichtenstein, A.H.; Chung, M.; Kupelnick, B.; Chew, P.; Lau, J. Effects of omega-3 fatty acids on coronary restenosis, intima–media thickness, and exercise tolerance: A systematic review. Atherosclerosis 2006, 184, 237–246. [Google Scholar] [CrossRef]
- Manosroi, A.; Boonpisuttinant, K.; Winitchai, S.; Manosroi, W.; Manosroi, J. Free radical scavenging and tyrosinase inhibition activity of oils and sericin extracted from Thai native silkworms (Bombyx mori). Pharm. Biol. 2010, 48, 855–860. [Google Scholar] [CrossRef] [Green Version]
- Hu, B.; Li, C.; Zhang, Z.; Zhao, Q.; Zhu, Y.; Su, Z.; Chen, Y. Microwave-assisted extraction of silkworm pupal oil and evaluation of its fatty acid composition, physicochemical properties and antioxidant activities. Food Chem. 2017, 231, 348–355. [Google Scholar] [CrossRef]
- Zou, Y.; Hu, T.; Shi, Y.; Liao, S.; Liu, J.; Mu, L.; Chen, C.-Y.O. Silkworm pupae oil exerts hypercholesterolemic and antioxidant effects in high-cholesterol diet-fed rats. J. Sci. Food Agric. 2017, 97, 2050–2056. [Google Scholar] [CrossRef]
- Yang, X.; Huang, L.; Hu, J.; Li, T. Effects of silkworm pupa oil on serum lipids level and platelet function in rats. J. Hyg. Res. 2002, 31, 249–251. [Google Scholar]
- Luo, Y.; Wang, L.; Lv, Y.; Wu, X.; Hou, C.; Li, J. Regulation mechanism of silkworm pupa oil PUFAs on cholesterol metabolism in hepatic cell L-02. J. Sci. Food Agric. 2020, 100, 1418–1425. [Google Scholar] [CrossRef]
- Guarente, L.; Kenyon, C. Genetic pathways that regulate ageing in model organisms. Nature 2000, 408, 255–262. [Google Scholar] [CrossRef] [PubMed]
- Lapierre, L.R.; Hansen, M. Lessons from C. elegans: Signaling pathways for longevity. Trends Endocrinol. Metab. 2012, 23, 637–644. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Govindan, S.; Amirthalingam, M.; Duraisamy, K.; Govindhan, T.; Sundararaj, N.; Palanisamy, S. Phytochemicals-induced hormesis protects Caenorhabditis elegans against α-synuclein protein aggregation and stress through modulating HSF-1 and SKN-1/Nrf2 signaling pathways. Biomed. Pharmacother. 2018, 102, 812–822. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Davies, K.J.; Forman, H.J. Oxidative stress response and Nrf2 signaling in aging. Free Radic. Biol. Med. 2015, 88, 314–336. [Google Scholar] [CrossRef] [Green Version]
- Shen, P.; Yue, Y.; Park, Y. A living model for obesity and aging research: Caenorhabditis elegans. Crit. Rev. Food Sci. Nutr. 2018, 58, 741–754. [Google Scholar] [CrossRef]
- Ishita, Y.; Chihara, T.; Okumura, M. Serotonergic modulation of feeding behavior in Caenorhabditis elegans and other related nematodes. Neurosci. Res. 2020, 154, 9–19. [Google Scholar] [CrossRef]
- Lin, C.; Lin, Y.; Chen, Y.; Xu, J.; Li, J.; Cao, Y.; Su, Z.; Chen, Y. Effects of Momordica saponin extract on alleviating fat accumulation in Caenorhabditis elegans. Food Funct. 2019, 10, 3237–3251. [Google Scholar] [CrossRef]
- Ahmad, T.; Suzuki, Y.J. Juglone in Oxidative Stress and Cell Signaling. Antioxidants 2019, 8, 91. [Google Scholar] [CrossRef] [Green Version]
- D’Autréaux, B.; Toledano, M.B. ROS as signalling molecules: Mechanisms that generate specificity in ROS homeostasis. Nat. Rev. Mol. Cell Biol. 2007, 8, 813–824. [Google Scholar] [CrossRef]
- Zhao, S.; Cheng, Q.; Peng, Q.; Yu, X.; Yin, X.; Liang, M.; Ma, C.W.; Huang, Z.; Jia, W. Antioxidant peptides derived from the hydrolyzate of purple sea urchin (Strongylocentrotus nudus) gonad alleviate oxidative stress in Caenorhabditis elegans. J. Funct. Foods 2018, 48, 594–604. [Google Scholar] [CrossRef]
- Reigada, I.; Moliner, C.; Valero, M.S.; Weinkove, D.; Langa, E.; Rincón, C.G. Antioxidant and Antiaging Effects of Licorice on the Caenorhabditis elegans Model. J. Med. Food 2020, 23, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Schlotterer, A.; Kukudov, G.; Bozorgmehr, F.; Hutter, H.; Du, X.; Oikonomou, D.; Ibrahim, Y.; Pfisterer, F.; Rabbani, N.; Thornalley, P.; et al. C. elegans as Model for the Study of High Glucose– Mediated Life Span Reduction. Diabetes 2009, 58, 2450–2456. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Escorcia, W.; Ruter, D.L.; Nhan, J.; Curran, S.P. Quantification of Lipid Abundance and Evaluation of Lipid Distribution in Caenorhabditis elegans by Nile Red and Oil Red O Staining. J. Vis. Exp. 2018, 133, e57352. [Google Scholar] [CrossRef]
- Wu, B.; Liang, S.; Zhu, L.; Jiang, H.; Liu, X.; Jiang, Y. Effects of storage time and silk reeling on protein and fatty acid composition of Silkworm pupa and in aitro antioxidant activity of Silkworm pupa oil. Food Sci. 2021, 42, 49–55. [Google Scholar] [CrossRef]
- Sugawara, T.; Saraprug, D.; Sakamoto, K. Soy sauce increased the oxidative stress tolerance of nematode via p38 MAPK pathway. Biosci. Biotechnol. Biochem. 2019, 83, 709–716. [Google Scholar] [CrossRef]
- Wei, C.-C.; Yu, C.-W.; Yen, P.-L.; Lin, H.-Y.; Chang, S.-T.; Hsu, F.-L.; Liao, V.H.-C. Antioxidant Activity, Delayed Aging, and Reduced Amyloid-β Toxicity of Methanol Extracts of Tea Seed Pomace from Camellia tenuifolia. J. Agric. Food Chem. 2014, 62, 10701–10707. [Google Scholar] [CrossRef]
- Schulz, T.J.; Zarse, K.; Voigt, A.; Urban, N.; Birringer, M.; Ristow, M. Glucose Restriction Extends Caenorhabditis elegans Life Span by Inducing Mitochondrial Respiration and Increasing Oxidative Stress. Cell Metab. 2007, 6, 280–293. [Google Scholar] [CrossRef] [Green Version]
- Fang, B.; Zhang, M.; Ren, F.Z.; Zhou, X.D. Lifelong diet including common unsaturated fatty acids extends the lifespan and affects oxidation in Caenorhabditis elegans consistently with hormesis model. Eur. J. Lipid Sci. Technol. 2015, 118, 1084–1092. [Google Scholar] [CrossRef]
- de Castro, E.; de Castro, S.H.; Johnson, T.E. Isolation of long-lived mutants in Caenorhabditis elegans using selection for resistance to juglone. Free Radic. Biol. Med. 2004, 37, 139–145. [Google Scholar] [CrossRef]
- An, J.H.; Blackwell, T.K. SKN-1 links C. elegans mesendodermal specification to a conserved oxidative stress response. Genes Dev. 2003, 17, 1882–1893. [Google Scholar] [CrossRef] [PubMed]
- Qi, W.; Gutierrez, G.E.; Gao, X.; Dixon, H.; McDonough, J.A.; Marini, A.M.; Fisher, A.L. The ω-3 fatty acid α-linolenic acid extends Caenorhabditis elegans lifespan via NHR-49/PPARα and oxidation to oxylipins. Aging Cell 2017, 16, 1125–1135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Przybysz, A.J.; Choe, K.P.; Roberts, L.J.; Strange, K. Increased age reduces DAF-16 and SKN-1 signaling and the hormetic response of Caenorhabditis elegans to the xenobiotic juglone. Mech. Ageing Dev. 2009, 130, 357–369. [Google Scholar] [CrossRef] [Green Version]
- Mak, H.Y.; Nelson, L.S.; Basson, M.; Johnson, C.D.; Ruvkun, G. Polygenic control of Caenorhabditis elegans fat storage. Nat. Genet. 2006, 38, 363–368. [Google Scholar] [CrossRef]
- Srinivasan, S. Regulation of Body Fat in Caenorhabditis elegans. Annu. Rev. Physiol. 2015, 77, 161–178. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brock, T.; Browse, J.; Watts, J.L. Genetic Regulation of Unsaturated Fatty Acid Composition in C. elegans. PLOS Genet. 2006, 2, e108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goudeau, J.; Bellemin, S.; Toselli-Mollereau, E.; Shamalnasab, M.; Chen, Y.; Aguilaniu, H. Fatty Acid Desaturation Links Germ Cell Loss to Longevity Through NHR-80/HNF4 in C. elegans. PLOS Biol. 2011, 9, e1000599. [Google Scholar] [CrossRef] [Green Version]
- Nie, Y.; Littleton, B.; Kavanagh, T.; Abbate, V.; Bansal, S.S.; Richards, D.; Hylands, P.; Stürzenbaum, S.R. Proanthocyanidin trimer gallate modulates lipid deposition and fatty acid desaturation in Caenorhabditis elegans. FASEB J. 2017, 31, 4891–4902. [Google Scholar] [CrossRef] [Green Version]
- Van Gilst, M.R.; Hadjivassiliou, H.; Jolly, A.; Yamamoto, K.R. Nuclear Hormone Receptor NHR-49 Controls Fat Consumption and Fatty Acid Composition in C. elegans. PLOS Biol. 2005, 3, e53. [Google Scholar] [CrossRef] [Green Version]
- Ogg, S.; Paradis, S.; Gottlieb, S.; Patterson, G.I.; Lee, L.; Tissenbaum, H.A.; Ruvkun, G. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 1997, 389, 994–999. [Google Scholar] [CrossRef]
- Cunningham, K.A.; Hua, Z.; Srinivasan, S.; Liu, J.; Lee, B.H.; Edwards, R.H.; Ashrafi, K. AMP-Activated Kinase Links Serotonergic Signaling to Glutamate Release for Regulation of Feeding Behavior in C. elegans. Cell Metab. 2012, 16, 113–121. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.; Jeong, D.-E.; Son, H.G.; Yamaoka, Y.; Kim, H.; Seo, K.; Khan, A.A.; Roh, T.-Y.; Moon, D.W.; Lee, Y.; et al. SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat. Genes Dev. 2015, 29, 2490–2503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taubert, S.; Van Gilst, M.R.; Hansen, M.; Yamamoto, K.R. A Mediator subunit, MDT-15, integrates regulation of fatty acid metabolism by NHR-49-dependent and -independent pathways in C. elegans. Genes Dev. 2006, 20, 1137–1149. [Google Scholar] [CrossRef] [PubMed]
Polyunsaturated Fatty Acids | Relative Content % |
---|---|
Palmitic acid | 31.53 ± 1.20 |
Stearic acid | 15.31 ± 0.78 |
Oleic acid | 14.79 ± 0.51 |
Linoleic acid | 5.59 ± 0.22 |
n3 α-linolenic acid | 30.46 ± 1.18 |
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
act-1 | ACGAGGTTGCCGCTCTTGTTG | ACGAGTCCTTCTGTCCCATACCG |
ctl-2 | TGAGGTTGAACAATCCGCCTTCTG | CGTCCTTGGAGCATCTTGTCTGG |
sod-2 | GCTCTTCAGCCAGCTCTCAAGTTC | ACTCCGCCGATGGTTCTCCTC |
sod-3 | AGCATCATGCCACCTACGTGA | CACCACCATTGAATTTCAGCG |
daf-2 | CCACGACGACGAGCACATCAC | GGCGGGTTTTCCTCATAGCAGTC |
daf-16 | ATCATGGGTTGGCGAATCGGTTC | CGGCTTCGACTCCTGCTTAATCTG |
skn-1 | GGTCTCCGTTGGCGTGATGATC | CTGGTGGATGCTCGGTGAGTATTG |
fat-5 | CGGCCGCCCTCTTCCGTTAC | TGGCTGCCATCCGACCCAGT |
fat-6 | TCAACAGCGCTGCTCACTAT | TTCGACTGGGGTAATTGAGG |
fat-7 | CAACAGCGCTGCTCACTATT | CACCAACGGCTACAACTGTG |
nhr-49 | AGGCTCGTGTCAATCAAGAGATGTG | ATGCCGATGCTCCAGAATCACTTC |
acs-2 | GCAGCCTCGCTCTACACTCT | GACTCCTGCAAATGCACATGC |
mdt-15 | GAGCACCACTACCAGGTGGT | ACCAGCAATGGGTCAGCCAC |
sbp-1 | AATCTGGGTTTGGCGGTTGGC | CGAGCGACTTCTTTGTGTGAATGC |
age-1 | GCTGCTCCGTGCAGAGATTG | CACGGAGGTAAGCTTCCATC |
nhr-80 | TGAGGTTCAGGAGCCAAATAG | GAAGGAGGTGGACGATGAGA |
tph-1 | CGGTGAGCCAATTCCGCGAA | AGAAACTGCTTGCATGCGTGC |
Groups | Mean Lifespan (Day) | Maximum Lifespan (Day) |
---|---|---|
control | 15.50 ± 0.24 | 23.5 ± 1.00 |
0.05 mg/mL | 16.73 ± 0.09 * | 24.9 ± 0.82 |
0.1 mg/mL | 18.78 ± 0.09 * | 25.5 ± 1.5 |
0.5 mg/mL | 18.40 ± 0.15 * | 24.0 ± 2.16 |
Groups | Mean Lifespan (h) | % of Control |
---|---|---|
control | 3.8 ± 0.40 | - |
0.05 mg/mL | 4.15 ± 0.23 ns | 109.21% |
0.1 mg/mL | 4.49 ± 0.25 * | 118.16% |
0.5 mg/mL | 5.51 ± 0.02 * | 145.00% |
Mutant Strain | Groups | Mean Lifespan (h) | % of Control |
---|---|---|---|
daf-2 (CB1370) | Juglone | 5.13 ± 0.24 | - |
Juglone + SPO | 8.29 ± 0.03 * | 316.00% | |
sod-3 (GA186) | Juglone | 6.90 ± 0.18 | - |
Juglone + SPO | 6.61 ± 0.22 | 95.79% | |
skn-1 (EU31) | Juglone | 7.76 ± 0.23 | - |
Juglone + SPO | 3.50 ± 0.01 * | 45.10% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, L.; Wu, B.; Liang, S.; Min, D.; Jiang, H. Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans. Foods 2022, 11, 4084. https://doi.org/10.3390/foods11244084
Zhao L, Wu B, Liang S, Min D, Jiang H. Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans. Foods. 2022; 11(24):4084. https://doi.org/10.3390/foods11244084
Chicago/Turabian StyleZhao, Lina, Baoxiang Wu, Shuyun Liang, Douyong Min, and Hongrui Jiang. 2022. "Insight of Silkworm Pupa Oil Regulating Oxidative Stress and Lipid Metabolism in Caenorhabditis elegans" Foods 11, no. 24: 4084. https://doi.org/10.3390/foods11244084