Next Article in Journal
The Crick-Eatery: A Novel Approach to Evaluate Cricket (Acheta domesticus) Powder Replacement in Food Products through Product Eating Experience and Emotional Response
Next Article in Special Issue
Scheme of Effective Epidemiological Investigations in Trichinella Outbreaks on Pig Farms
Previous Article in Journal
Functional Fermented Milk with Fruit Pulp Modulates the In Vitro Intestinal Microbiota
Previous Article in Special Issue
Application of Quantitative Microbiology and Challenge Tests to Reach a Suggested Food Safety Objective in a Middle Eastern-Style Ready-to-Cook Chicken Product
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 11
Issue 24
10.3390/foods11244114
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prevalence and Virulence Determinants of Staphylococcus aureus in Wholesale and Retail Pork in Wuhan, Central China

by
Zhihao Zhu
1,†,
Xiaoying Liu
1,†,
Xingyu Chen
1,
Geng Zou
1,
Qi Huang
1,
Xianrong Meng
1,
Xiaoying Pei
2,
Zhou Chen
2,
Rui Zhou
1,
Dongliang Hu
3,*,
Mei Liu
1 and
Shaowen Li
1,*
1
Key Laboratory of Preventive Veterinary Medicine in Hubei Province, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China
2
Wuhan Agricultural Comprehensive Law Enforcement Inspector Corps, Wuhan 430010, China
3
Department of Zoonoses, Kitasato University School of Veterinary Medicine, Towada 034-8628, Japan
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Foods 2022, 11(24), 4114; https://doi.org/10.3390/foods11244114
Submission received: 14 November 2022 / Revised: 11 December 2022 / Accepted: 16 December 2022 / Published: 19 December 2022
(This article belongs to the Special Issue Food-Borne Disease Prevention and Risk Assessment 2.0 Edition)
Browse Figures
Versions Notes

Abstract

:
Staphylococcus aureus is one of the major foodborne pathogens and can cause serious foodborne illness in humans by foods contaminated with S. aureus enterotoxins. In recent years, livestock-associated S. aureus has been a major public health concern for humans and has emerged in various countries globally. China is one of the largest producers of pigs and pork in the world. However, there are few studies on the detailed genotypic and pathogenic characterization of pork-associated S. aureus in China. In this study, the prevalence, antimicrobial resistance, and genotypic characteristics of S. aureus in raw pork in Wuhan, China, were investigated through multilocus sequence typing (MLST), staphylococcal protein A gene (spa) typing, and whole-genome sequencing analysis. A total of 518 S. aureus isolates (16.9%) were isolated from 3067 retail and wholesale pork samples. The prevalence of S. aureus in retail pork (22.7%) was significantly higher than in wholesale pork (15.1%), while the proportion of multidrug-resistant (MDR) isolates in wholesale pork (12.9%) was significantly higher than in retail pork (6.2%). Among the isolates, 10.8% were resistant to three or more antibiotics, with higher rates of resistance to penicillin (88.8%) and erythromycin (58.1%). A total of 28 sequence types (STs) were identified in the 518 isolates, and the predominant type was ST7 (57.5%), followed by ST5 (9.1%). In addition, based on the whole-genome sequences of 39 representative strains, 17 spa types were identified among the isolates, of which t899, t091, and t437 were the most common. Furthermore, 19 staphylococcal enterotoxin (SE) and SE-like (SEl) toxin genes were detected in the isolates, of which selw was the most common type (100%), followed by sei, sem, seo, seu, and selv (46.2%); sey (35.9%); and sea, seg, and sen (33.3%). This study found for the first time that ST7-t091-selw and ST9-t899-SCCmecXII-selw were the predominant genotypes of S. aureus in pork in China, which indicated the spreading of S. aureus with multiple virulence factors, especially with new SE/SEl types in pigs and pork, is a serious new challenge for food safety. Good hygiene and good production practices to prevent interspecies transmission and cross-contamination of S. aureus in the pig–pork chain are of great significance to public health.

1. Introduction

Staphylococcus aureus (S. aureus) is a major commensal pathogen, which induces various infections in animals and humans [1,2]. S. aureus-induced infectious diseases in humans are mainly caused by the strains with capacity to produce multiple virulence factors, such as leukocidins, exfoliative toxins, hemolysins, fibronectin-binding proteins, clumping factors, collagen-binding protein, staphylococcal enterotoxins (SEs), and SE-like toxins [3,4]. In recent years, the frequent use of antimicrobials and high feeding densities on pig farms have facilitated the emergence and spread of S. aureus and livestock-associated methicillin-resistant S. aureus (LA-MRSA). Antimicrobial-resistant S. aureus has been isolated from pigs in farms, slaughterhouses, and markets in many countries [1,2]. The increasing amount of methicillin-resistant S. aureus (MRSA) has brought enormous difficulties and serious challenges to medical care and public health. In addition, SE and/or SEl-producing S. aureus is also one of the world’s leading causes of food consumption-related disease outbreaks, causing food poisoning worldwide [5,6]. To date, 29 types of SEs and SE-like toxins (SEls) have been identified, including the classic types of SEs (SEA-SEE) and novel SE/SEls (SEG-SElZ, SEl01, and SEl02) [4,7]. Certain new SEs/SEls have been reported as potential causes of foodborne disease outbreaks [8,9]. The genes of SEs and SEls are typically located on mobile genetic elements (MGEs) [4,10,11]. SEs/SE1s and antimicrobial resistance genes can be transferred among S. aureus strains by the horizontal transfer of MGEs, which accelerate the evolution of pathogenic S. aureus strains among animals and humans, as well as increase the risk of infection and food poisoning in humans [4,12,13]. Investigating and elucidating the epidemiological and genotypic characteristics of S. aureus in animals and their products are important for controlling bacterial transmission and disease occurrence in animals and humans.
Epidemiological studies showed that S. aureus has often been isolated from pigs, which are a key host for S. aureus, especially for LA-MRSA [14,15]. LA-MRSA can be transmitted to humans through occupational contact with pigs, pork, and their products [16,17]. Previous studies have revealed that LA-MRSA strains have different genetic backgrounds and different antibacterial resistance and carry different types of SCCmec and virulence factors [18,19]. The most prominent LA-MRSA strains in Europe and the United States belong to sequence type 398 (ST398) [20,21,22], which has also been identified in Australia [23] and New Zealand [24]. In most Asian countries, however, the most prominent genotype belongs to ST9 [19,25,26]. Recently, methicillin-susceptible S. aureus (MSSA) ST398 has been recovered from pigs, retail meat, and humans in Germany, France, the Unite States, and China [15,21,27,28,29]. The infections caused by MSSA ST398 have been described in human diseases [20,30]. These studies demonstrate that livestock-associated S. aureus isolates, both of MRSA and MSSA, are significant food safety hazards. Handling food-producing animals, especially pigs, and eating pork contaminated with S. aureus are potential sources of zoonotic transmission in humans.
China is one of the largest producers of pigs and pork in the world [31,32]. In this study, we investigated the prevalence, antimicrobial resistance, virulence genes, and genotypic characteristics of S. aureus including MSSA and MRSA in raw pork in Wuhan, a city of central China. Our study found for the first time that ST7-t091-selw was the predominant genotype of MSSA, and ST5-t899-SCCmecXII-selw was a common genotype of MRSA in pork, suggesting that these two main genotypes of S. aureus may have been involved in spread along the pork processing chains.

2. Materials and Methods

2.1. Bacterial Isolation and Identification from Raw Pork

A total of 3067 pork samples were collected from raw pork markets in Wuhan city, during 2016–2017. Of these, 2353 samples were from different stalls in three wholesale markets, and 714 samples were from nine retail markets. The sampling covered 38 abattoirs supplying raw pork for Wuhan city. About 20 g of meat was taken from each sample and stored in a refrigerator. Isolation of S. aureus was performed according to the Chinese National Standard GB4789 (https://www.chinesestandard.net/PDF/English.aspx/GB4789.10-2010 (accessed on 20 January 2016)) with some modifications. The presence of S. aureus in suspected positive broths was confirmed using polymerase chain reactions (PCR) to identify the femB gene with the primers (femB-F, CATGGTTACGAGCATCATGG, and femB-R, AACGCCAGAAGCAAGGTTTA) [33,34]. A loopful from the incubated tubes was streaked onto a Baird-Parker agar plate that was supplemented with 5% egg yolk and tellurite and incubated at 37 °C for 40–48 h. The presumptive S. aureus colonies were further identified by using an automated microbiological identification system (BD Phoenix TMPMIC/ID-55).

2.2. Antimicrobial Resistance Testing

The antimicrobial resistance of S. aureus isolates was tested by determining the minimal inhibitory concentrations (MICs) using an automated antibiotic susceptibility analysis system (BD Phoenix TMPMIC/ID-55), and break points from the Clinical and Laboratory Standards Institute (CLSI) were used for MIC interpretation [34] (Table S1). Eight antimicrobial agents of four classes were used in this study, including beta-lactams (penicillin (PEN), oxacillin (OXA), and amoxicillin/clavulanate (AMC)), macrolide-lincosamide-streptogramines (erythromycin (ERY), clindamycin (CLI), and quinupristin/dalfopristin (SYN)), aminoglycosides (gentamicin (GEN)), and folate pathway antagonists (trimethoprim/sulfamethoxazole (SXT)). Antimicrobial resistance (AMR) was defined as resistant to at least one antimicrobial, whereas multidrug resistance (MDR) was defined as resistant to three or more classes of antimicrobials in this study. MRSA was defined as the oxacillin-resistant isolate harboring the mecA or mecC gene [33,34,35]. S. aureus ATCC29213 was used as the quality control strain.

2.3. Detection of Methicillin Resistance Genes

The presence of the mecA and mecC genes in the genomic DNA of S. aureus isolates from the pork samples was detected by PCR using primers (mecA-F, TGGTATGTGGAAGTTAGATTGGGAT; mecA-R, CTAATCTCATATGTGTTCCT GTATTGGC; mecC-F, CATTAAAATCAGAGCGAGGC; and mecC-R, TGGCTGAA CCCATTTTTGAT) and the conditions as previously reported [33,35,36].

2.4. Multilocus Sequence Typing (MLST)

The isolates from pork were recovered in lysogen broth (LB) at 37 °C for 12 h with shaking, and the genomic DNA template was extracted using a heat boiling method. MLST was performed following the protocol described elsewhere [37]. Seven housekeeping genes—carbamate kinase (arcC), shikimate dehydrogenase (aroE), glycerol kinase (glpF), guanylate kinase (gmk), phosphate acetyltransferase (pta), triosephosphate isomerase (tpi), and acetyl coenzyme A acetyltransferase (yqiL)—were amplified by PCR. The alleles and sequence types (STs) were identified using the scheme published on the multilocus sequence typing databases (https://pubmlst.org/organisms/staphylococcus-aureus (accessed on 24 September 2018)).

2.5. Whole-Genome Sequencing and Data Analysis

Thirty-nine representative S. aureus strains were selected for whole-genome sequencing (WGS), including 19 MRSA strains and 20 MSSA strains; 27 strains were from the wholesale markets, and 12 strains were from the retail markets. Library preparing and de novo bacterial sequencing was performed using the Illumina platforms with NovaSeq 6000 Sequencing System (Illumina, San Diego, CA, USA) in Annoroad Gene Technology Co., Ltd, Beijing [38]. The data volume for each bacterial sample was 2 GB, with a sequencing depth of 300×. After quality control and data filter, the clean reads were assembled using SPAdes (v3.14.1) with the “isolate” option, and the default K-mers were 21, 33, 55, and 77. Quast was used to evaluate the quantity of the assembled contigs. The obtained genome contigs were used for subsequent analysis, including screening of resistance and virulence genes using abricate (v1.0.0) (Seemann, Abricate, Github, https://github.com/tseemann/abricate (accessed on 3 January 2021)) with the appropriate database, the comprehensive antibiotic resistance database (CARD, http://arpcard.mcmaster.ca (accessed on 8 November 2021)), and the virulence factor database (VFDB, http://www.mgc.ac.cn/VFs/ (accessed on 8 November 2021)), and the plasmid types were determined using PlasmidFinder software (https://cge.food.dtu.dk/services/PlasmidFinder/ (accessed on 8 November 2021)). The genes recorded in the CARD and VFDB databases were compared as reference genes, and the compared genes were determined to be the genes carried by the strain. The resistance genes (e.g., arlR, arlS, mgrA, mepA, mepR, tetK, tetL, blaZ, ANT, aph, aad, lnuA, ermB, ermC, fusB, and dfrG), virulence genes (icaA, isdA, lio, ssp, hlb, hld, sak, scn, chp, clfA, clfB, fnbA, fnbB, lukF-PV, lukS-PV, spa, and tst), and enterotoxin genes (sea, seb, sec, sed, see, seg, sei, selj, sek, sem, sen, seo, selu, selv, selw, and sey) were identified [39,40]. For the spliced genomic contigs, the core SNP tree was extracted and constructed using Snippy software (v3.2), and the recombination sequences were detected and eliminated using gubbins software (Seemann, Snippy, https://github.com/tseemann/snippy (accessed on 13 July 2021)). The maximum likelihood tree of core SNPs was constructed using RaxML (v8.0) software with the reference genome S. aureus NCTC8325 (txid: 93061) and 1000 bootstrap support, and the tree was visualized and annotated in iTOL version 4 [41]. The S. aureus isolates were also investigated by spa typing using the publicly available Ridom SpaServer (www.spaserver.ridom.de (accessed on 15 July 2021)). The SCCmec typing of MRSA was performed by SCCmecFinder (https://cge.food.dtu.dk/services/SCCmecFinder/ (accessed on 17 July 2021)).

2.6. Statistical Analysis

Data analyses were performed using SPSS software, ver. 26.0 (SPSS Inc., Chicago, IL, USA). The 95% confidence interval (CI) was calculated using the method described by Ross [42]. The statistical significance between the percentages of different groups was compared using the Chi-squared (χ2) test. The p value of <0.05 was deemed to be significant.

3. Results

3.1. Prevalence of S. aureus and MRSA in Wholesale and Retail Pork

A total of 518 S. aureus (16.9%) isolates were isolated from 3067 pork samples, which included 356 isolates from the wholesale markets (356/2353, 15.1%) and 162 isolates from the retail markets (162/714, 22.7%). The prevalence of S. aureus in retail pork was significantly higher than that in the wholesale pork, and the prevalence of S. aureus in retail pork in winter was significantly higher than that in the other three seasons (p < 0.05) (Table 1).

3.2. Antimicrobial Resistance Profiles

The 518 S. aureus isolates were assessed for resistance to eight antimicrobial agents. Resistance to PEN was the most commonly observed resistance in the wholesale (89.0%) and retail 88.3%) pork isolates. Higher resistance rates for ERY were also noted in the isolates from wholesale (56.7%) and retail (60.5%) pork (Figure 1a; Supplementary Table S2). In addition, most isolates (92.7%) were resistant to at least one or more antimicrobial agents (Figure S1). The MDR isolates were detected in the isolates from wholesale (13.5%) and retail (5.6%) pork. Of the 518 S. aureus isolates, 499 (96.3%) were MSSA, and 19 (3.7%) were MRSA. Furthermore, the MRSA isolates showed significantly greater resistance to all eight antimicrobials tested in this study compared with the MSSA isolates (p < 0.05) (Figure 1b).

3.3. Multilocus Sequence Typing (MLST) of the S. aureus Isolates

The MLST results revealed that twenty-eight sequence types (STs) were identified in the S. aureus isolates from both wholesale and retail pork (Table 2). The predominant ST types was ST7 (57.5%), followed by ST5 (9.1%), ST3055 (4.3%), ST118 (3.7%), and ST9 (3.3%) in the isolates from wholesale and retail pork. Among them, ST7 (59.7%) was the most frequent genotype for the MSSA isolates (298/499), while ST9 (42.1%) was the most frequent genotype for the MRSA isolates (8/19). However, there was no significant difference in the rates of ST types between the wholesale and retail pork groups (data not shown).

3.4. Genotypic Characteristics of the S. aureus Isolates

We analyzed staphylococcal protein A gene (spa) profiles of the 39 representative S. aureus isolates from wholesale and retail pork based on the whole-genome sequences. The most commonly detected spa type in the MRSA isolates was t899, followed by t437, and the most detected SCCmec type was XII(9C2), followed by IVa(2B) (Table 3). In contrast, the most commonly detected spa type in the MSSA isolates was t091, followed by t6497. A total of 19 SEs and SEls genes were detected in the isolates, all of which carried selw (100.0%), followed by sei, sem, seo, seu, and selv (46.2%); sey (35.9%); and sea, seg, and sen (33.3%) (Figure 2). The gene spectrum of SE and SEl was relatively similar between the MRSA and MSSA strains (Table 3).

3.5. Whole-Genome Sequencing Analysis of S. aureus

After mapping with the reference genome (NCTC8325), a total of 151,721 variant sites were found in all 39 isolates, of which 92,265 core SNPs were extracted for the phylogenetic tree. The whole-genome assembly results showed that N50 was 101 to 694 kb, the number of contigs was 24 to 446, and the gene numbers were 2480 to 2872 Table S3. Based on the WGS, we further constructed the core genome SNP phylogeny of the 39 S. aureus isolates from wholesale and retail pork, as well as STs, Spa types, SCCmec types, antimicrobial resistance genes, virulence factor genes, and plasmids (Figure 3). The core SNP phylogenetic tree showed that ST9-t899-XII (9C2)-selw was the most frequent sequence type in MRSA (42.1%), while ST7-t091-selw (40.0%) was the most common type in MSSA. Isolates from different sources shared the same lineage with no significant differences in sampling time and market types. Multiple genes for different types of antimicrobials were analyzed, and the resistance genes for fluoroquinolone, tetracycline, aminoglycosides, and lincosamide were the most commonly detected; MRSA strains usually carried more resistance genes, such as lsaE, tet(L), AAC(6’)-Ie-APH(2’’)-Ia, ANT(6)-Ia, fexA, fosB, and dfrG, suggesting a greater resistance level than that of MSSA. Twenty-five virulence genes were detected, and all isolates carried icaA, isdA, lip, ssp, esxA, geh, and hld (n = 39), followed by adsA (n = 38), ebp (n = 38), and aur (n = 37). A total of 12 plasmid types were detected, of which rep22 (59.0%) had the highest carrying rate, followed by rep10 (48.7%), rep5a (41.0%), rep7a (35.9%), rep16 (35.9%), rep20 (28.2%), repUS22 (23.1%), rep19 (18.0%), rep21 (10.3%), rep7c (5.1%), rep13 (5.1%), and repUS5c (5.1%). The proportion of strains carrying more than two plasmids was 87.2% (34/39). These results indicated that the isolates from wholesale and retail pork in central China carried multiple antimicrobial resistance and virulence genes that cause food poisoning and infectious diseases.

4. Discussion

In this study, we carried out PCR, MLST, and WGS to investigate the prevalence, antimicrobial resistance, SE and SEl, and genotypic characterization of S. aureus isolated from wholesale and retail pork in Wuhan, China. We provided comprehensive and detailed genotyping of multiple virulence factors, as well as publicly available data on S. aureus isolates from pork in China, including MRSA and MSSA. Our results showed that the prevalence (16.9%) of S. aureus in wholesale and retail pork was lower than that in previous studies, such as in Fujian and Guangdong (23.4%), Shanghai (28.1%), and other regions (47.7%) in China [19,32,43] and in North Dakota (49.3%) in the United States [44], but the prevalence was similar to that in Europe countries (15.0%) [22,45] and Iowa in the United States (18.2%) [46]. These results indicate that both wholesale and retail pork may serve as reservoirs of S. aureus, which may originate from S. aureus-positive animals, the surrounding environment, humans, and other sources during food processing and commercialization in meat counters at supermarkets and retail stores.
The prevalence of drug-resistant bacteria is increasing due to the excessive use of antibiotics. In this study, the prevalence (3.7%) of MRSA isolated from the wholesale and retail pork was similar to those in Europe countries (1.8–15.8%) [47], North American countries (1.9–9.6%) [48,49], and south China (6.3%) [32]. Notably, 92.3% of the S. aureus isolates from the pork revealed resistance to at least one tested antimicrobial, and 74.5% of the isolates exhibited an AMR pattern of ERY-PEN or PEN. We observed higher resistance rates to penicillin (88.8%) and erythromycin (58.1%) (Figure 1a), which have commonly been reported in S. aureus isolated from meat samples [29,44,48]. The higher rates of resistance may be related to the use of the antimicrobials to treat diseases and as feed additives or growth promoters in livestock [29]. The rate of MDR in MRSA isolates (63.2%) from wholesale and retail pork was significantly higher than that in MSSA isolates (9.0%; Figure 1b). Wholesale and retail pork contaminated with MDR S. aureus are potentially hazardous, and the food chain may be a key site for the transmission of resistance among livestock, the environment, and humans [29].
ST398 was first identified in pigs and swine workers but has since been found in other animals including cattle, poultry, and dogs as well as humans [15,16,17,18,39,45]. ST398 was the most dominant clone disseminating worldwide, especially in Europe, Asia, and North and South America (EFSA Panel on Animal Health and Welfare, 2022). In several countries, different human-adapted ST398 has been shown to circulate in the community and cause clinical MSSA infection in humans [21,27,50]. ST5, ST9, and ST15 were predominantly obtained from pigs and cattle in China and other Asian countries, indicating ST9 and ST398 might be endemic in animal-derived food production [14,29,32,51]. These results indicate that indirect transmission of S. aureus from livestock has resulted in clinical human infection, although the route of transmission in such cases has not been determined. In the present study, a total of 28 STs were identified in the 518 isolates from different pork sources. Of them, ST7 was the most predominant type in the isolates from wholesale and retail pork in China, which are different from the results of previous studies [16,29]. Notably, our results showed that ST7 was the most frequent type in MSSA isolates, while ST9 was the most common in MRSA isolates but not in MSSA. Recently, several studies have reported that ST9 is currently the most prevalent sequence type of LA-MRSA and a major endemic MRSA clone circulating in pigs in Asia countries [19,32,51]. These results indicate that pigs and pork could become important reservoirs for MRSA and increase the potential risk of human infections caused by LA-MRSA.
In the present study, a variety of virulence factors were detected from strains isolated from pork, which are important toxins causing food poisoning and infection in humans and animals. A total of 19 SEs and SEls genes were detected in the isolates from the pork, and selw (100.0%), a newly reported SE-like toxin, was the most common toxin type, followed by sei, sem, seo, seu, and selv (46.2%); sey (35.9%); and sea, seg, and sen (33.3%). These results are significantly different from previous reports of pork from other regions of China [14,28,29,32]. Combined with the genotypes detected in this study, ST7-t091-selw was the most common genotype profile (40.0%) among MSSA isolates from wholesale and retail pork, which was the first report that MSSA ST7-t091-selw is the main lineage in pork in China. On the other hand, for MRSA isolated from the wholesale and retail pork, ST9-t899-XII (9C2)-selw was the predominant genotype profile (42.1%), which was similar to previous studies [17,52]. Importantly, the S. aureus isolated from pork carried multiple antimicrobial resistance and virulence genes, especially many types of SE and SEI toxin genes, which are the important causative toxins inducing food poisoning and infectious diseases in humans [53,54]. These results demonstrate that strains isolated from pork may have interspecies transmission of adaptability and virulence in different hosts and foods [3,52].
In conclusion, our findings indicated that the examined wholesale and retail pork were generally contaminated with S. aureus. ST7-t091-selw was the most predominant genotype profile in MSSA isolates, while ST9-t899-XII(9C2)-selw was the most common genotype profile in MRSA isolates from pork in Wuhan, China. In addition, the isolates exhibited multiple antimicrobial resistances and possessed many types of virulence factors, including classic SE types and newly reported SE and SEl types. Our data indicate that multiple virulence genes detected in the S. aureus isolates, especially the newly reported SE and SEl genes, reveal new lurking threats to food safety and public health from wholesale and retail pork. These results demonstrate that good hygiene and good production practices to prevent interspecies transmission and cross-contamination of S. aureus in the pig–pork chain are of great significance to public health.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/foods11244114/s1, Figure S1: Correlation between high/low MIC values and AMR gene profiles, Table S1: MIC breakpoints of S. aureus in this study, Table S2: All MICs values of 518 isolates from wholesale and rerail pork in Wuhan, central Chiana, Table S3: The whole genome assembly results.

Author Contributions

Conceptualization, S.L.; methodology, Z.Z. and X.L.; formal analysis, Z.Z., X.L. and G.Z.; investigation, Z.Z., X.L. and X.C.; resources, X.P. and Z.C.; writing—original draft, Z.Z. and X.L.; writing—review and editing, Q.H., D.H., M.L. and S.L.; supervision, X.M., R.Z., D.H., M.L. and S.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was financially supported by the National Key Research and Development Program of China (Grant Nos. 2022YFD1800400 and 2018YFD0500500) and the Joint Funds of the National Natural Science Foundation of China (NSFC) (Grant No. 8161101134).

Data Availability Statement

Data is contained within the article or Supplementary Material.

Acknowledgments

We thank the official veterinarians at Wuhan Agricultural Comprehensive Law Enforcement Inspector Corps for the help in sampling.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pollitt, E.J.G.; Szkuta, P.T.; Burns, N.; Foster, S.J. Staphylococcus aureus infection dynamics. PLoS Pathog. 2018, 14, e1007112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Kittl, S.; Brodard, I.; Heim, D.; Andina-Pfister, P.; Overesch, G. Methicillin-resistant Staphylococcus aureus strains in swiss pigs and their relation to isolates from farmers and veterinarians. Appl. Environ. Microbiol. 2020, 86, e01865-19. [Google Scholar] [CrossRef] [PubMed]
  3. Cheung, G.Y.C.; Bae, J.S.; Otto, M. Pathogenicity and virulence of Staphylococcus aureus. Virulence 2021, 12, 547–569. [Google Scholar] [CrossRef] [PubMed]
  4. Hu, D.L.; Li, S.; Fang, R.; Ono, H.K. Update on molecular diversity and multipathogenicity of staphylococcal superantigen toxins. Anim. Dis. 2021, 1, 69–83. [Google Scholar] [CrossRef]
  5. Zeleny, R.; Emteborg, H.; Charoud-Got, J.; Schimmel, H.; Nia, Y.; Mutel, I.; Ostyn, A.; Herbin, S.; Hennekinne, J.A. Development of a reference material for Staphylococcus aureus enterotoxin A in cheese: Feasibility study, processing, homogeneity and stability assessment. Food Chem. 2015, 168, 241–246. [Google Scholar] [CrossRef]
  6. Hu, D.L.; Nakane, A. Mechanisms of staphylococcal enterotoxin-induced emesis. Eur. J. Pharmacol. 2014, 722, 95–107. [Google Scholar] [CrossRef]
  7. Suzuki, Y.; Ono, H.K.; Shimojima, Y.; Kubota, H.; Kato, R.; Kakuda, T.; Hirose, S.; Hu, D.L.; Nakane, A.; Takai, S.; et al. A novel staphylococcal enterotoxin SE02 involved in a staphylococcal food poisoning outbreak that occurred in Tokyo in 2004. Food Microbiol. 2020, 92, 103588. [Google Scholar] [CrossRef]
  8. Umeda, K.; Ono, H.K.; Wada, T.; Motooka, D.; Nakamura, S.; Nakamura, H.; Hu, D.L. High production of egc2-related staphylococcal enterotoxins caused a food poisoning outbreak. Int. J. Food Microbiol. 2021, 357, 109366. [Google Scholar] [CrossRef]
  9. Ono, H.K.; Hirose, S.; Naito, I.; Sato’o, Y.; Asano, K.; Hu, D.L.; Omoe, K.; Nakane, A. The emetic activity of staphylococcal enterotoxins, SEK, SEL, SEM, SEN and SEO in a small emetic animal model, the house musk shrew. Microbiol. Immunol. 2017, 61, 12–16. [Google Scholar] [CrossRef] [Green Version]
  10. Sato’o, Y.; Omoe, K.; Naito, I.; Ono, H.K.; Nakane, A.; Sugai, M.; Yamagishi, N.; Hu, D.L. Molecular epidemiology and identification of a Staphylococcus aureus clone causing food poisoning outbreaks in Japan. J. Clin. Microbiol. 2014, 52, 2637–2640. [Google Scholar] [CrossRef]
  11. Hu, D.L.; Omoe, K.; Inoue, F.; Kasai, T.; Yasujima, M.; Shinagawa, K.; Nakane, A. Comparative prevalence of superantigenic toxin genes in meticillin-resistant and meticillin-susceptible Staphylococcus aureus isolates. J. Med. Microbiol. 2008, 57, 1106–1112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Uhlemann, A.C.; Porcella, S.F.; Trivedi, S.; Sullivan, S.B.; Hafer, C.; Kennedy, A.D.; Barbian, K.D.; McCarthy, A.J.; Street, C.; Hirschberg, D.L.; et al. Identification of a highly transmissible animal-independent Staphylococcus aureus ST398 clone with distinct genomic and cell adhesion properties. mBio 2012, 3, e00027-12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Hu, D.L.; Maina, E.K.; Omoe, K.; Inoue, F.; Yasujima, M.; Nakane, A. Superantigenic toxin genes coexist with specific staphylococcal cassette chromosome mec genes in methicillin-resistant Staphylococcus aureus. Tohoku J. Exp. Med. 2011, 225, 161–169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Li, J.; Jiang, N.; Ke, Y.; Fessler, A.T.; Wang, Y.; Schwarz, S.; Wu, C. Characterization of pig-associated methicillin-resistant Staphylococcus aureus. Vet. Microbiol. 2017, 201, 183–187. [Google Scholar] [CrossRef]
  15. Huang, Y.C.; Chen, C.J. Detection and phylogeny of Staphylococcus aureus sequence type 398 in Taiwan. J. Biomed. Sci. 2020, 27, 15. [Google Scholar] [CrossRef] [Green Version]
  16. Li, G.; Wu, C.; Wang, X.; Meng, J. Prevalence and characterization of methicillin susceptible Staphylococcus aureus ST398 isolates from retail foods. Int. J. Food Microbiol. 2015, 196, 94–97. [Google Scholar] [CrossRef]
  17. Aires-de-Sousa, M. Methicillin-resistant Staphylococcus aureus among animals: Current overview. Clin. Microbiol. Infect. 2017, 23, 373–380. [Google Scholar] [CrossRef] [Green Version]
  18. Foster, T.J. Antibiotic resistance in Staphylococcus aureus. Current status and future prospects. FEMS Microbiol. Rev. 2017, 41, 430–449. [Google Scholar] [CrossRef]
  19. Chuang, Y.Y.; Huang, Y.C. Livestock-associated meticillin-resistant Staphylococcus aureus in Asia: An emerging issue? Int. J. Antimicrob. Agents 2015, 45, 334–340. [Google Scholar] [CrossRef]
  20. David, M.Z.; Siegel, J.; Lowy, F.D.; Zychowski, D.; Taylor, A.; Lee, C.J.; Boyle-Vavra, S.; Daum, R.S. Asymptomatic carriage of sequence type 398, spa type t571 methicillin-susceptible Staphylococcus aureus in an urban jail: A newly emerging, transmissible pathogenic strain. J. Clin. Microbiol. 2013, 51, 2443–2447. [Google Scholar] [CrossRef]
  21. Waters, A.E.; Contente-Cuomo, T.; Buchhagen, J.; Liu, C.M.; Watson, L.; Pearce, K.; Foster, J.T.; Bowers, J.; Driebe, E.M.; Engelthaler, D.M.; et al. Multidrug-resistant Staphylococcus aureus in US meat and poultry. Clin. Infect. Dis. 2011, 52, 1227–1230. [Google Scholar] [CrossRef] [PubMed]
  22. Tang, Y.; Larsen, J.; Kjeldgaard, J.; Andersen, P.S.; Skov, R.; Ingmer, H. Methicillin-resistant and -susceptible Staphylococcus aureus from retail meat in Denmark. Int. J. Food Microbiol. 2017, 249, 72–76. [Google Scholar] [CrossRef] [PubMed]
  23. Groves, M.D.; O’Sullivan, M.V.; Brouwers, H.J.; Chapman, T.A.; Abraham, S.; Trott, D.J.; Al Jassim, R.; Coombs, G.W.; Skov, R.L.; Jordan, D. Staphylococcus aureus ST398 detected in pigs in Australia. J. Antimicrob. Chemother. 2014, 69, 1426–1428. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Williamson, D.A.; Bakker, S.; Coombs, G.W.; Tan, H.; Monecke, S.; Heffernan, H. Emergence and molecular characterization of clonal complex 398 (CC398) methicillin-resistant Staphylococcus aureus (MRSA) in New Zealand. J. Antimicrob. Chemother. 2014, 69, 1428–1430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Neela, V.; Mohd Zafrul, A.; Mariana, N.S.; van Belkum, A.; Liew, Y.K.; Rad, E.G. Prevalence of ST9 methicillin-resistant Staphylococcus aureus among pigs and pig handlers in Malaysia. J. Clin. Microbiol. 2009, 47, 4138–4140. [Google Scholar] [CrossRef] [Green Version]
  26. Larsen, J.; Imanishi, M.; Hinjoy, S.; Tharavichitkul, P.; Duangsong, K.; Davis, M.F.; Nelson, K.E.; Larsen, A.R.; Skov, R.L. Methicillin-resistant Staphylococcus aureus ST9 in pigs in Thailand. PLoS ONE 2012, 7, e31245. [Google Scholar] [CrossRef] [Green Version]
  27. Kadlec, K.; Schwarz, S. Identification of the novel dfrK-carrying transposon Tn559 in a porcine methicillin-susceptible Staphylococcus aureus ST398 strain. Antimicrob. Agents Chemother. 2010, 54, 3475–3477. [Google Scholar] [CrossRef] [Green Version]
  28. Yan, X.; Yu, X.; Tao, X.; Zhang, J.; Zhang, B.; Dong, R.; Xue, C.; Grundmann, H.; Zhang, J. Staphylococcus aureus ST398 from slaughter pigs in northeast China. Int. J. Med. Microbiol. 2014, 304, 379–383. [Google Scholar] [CrossRef]
  29. Zhao, X.; Hu, M.; Zhao, C.; Zhang, Q.; Li, L.; Zhang, Y.; Luo, Y.; Liu, Y. Whole-genome epidemiology and characterization of methicillin-susceptible Staphylococcus aureus ST398 from retail pork and bulk tank milk in Shandong, China. Front. Microbiol. 2021, 12, 764105. [Google Scholar] [CrossRef]
  30. Mediavilla, J.R.; Chen, L.; Uhlemann, A.C.; Hanson, B.M.; Rosenthal, M.; Stanak, K.; Koll, B.; Fries, B.C.; Armellino, D.; Schilling, M.E.; et al. Methicillin-susceptible Staphylococcus aureus ST398, New York and New Jersey, USA. Emerg. Infect. Dis. 2012, 18, 700–702. [Google Scholar] [CrossRef]
  31. Zhou, L.J.; Ying, G.G.; Liu, S.; Zhang, R.Q.; Lai, H.J.; Chen, Z.F.; Pan, C.G. Excretion masses and environmental occurrence of antibiotics in typical swine and dairy cattle farms in China. Sci. Total Environ. 2013, 444, 183–195. [Google Scholar] [CrossRef] [PubMed]
  32. Zhou, Y.; Li, X.; Yan, H. Genotypic characteristics and correlation of epidemiology of Staphylococcus aureus in healthy pigs, diseased pigs, and environment. Antibiotics 2020, 9, 839. [Google Scholar] [CrossRef] [PubMed]
  33. Nakagawa, S.; Taneike, I.; Mimura, D.; Iwakura, N.; Nakayama, T.; Emura, T.; Kitatsuji, M.; Fujimoto, A.; Yamamoto, T. Gene sequences and specific detection for Panton-Valentine leukocidin. Biochem. Biophys. Res. Commun. 2005, 328, 995–1002. [Google Scholar] [CrossRef] [PubMed]
  34. Paterson, G.K.; Larsen, A.R.; Robb, A.; Edwards, G.E.; Pennycott, T.W.; Foster, G.; Mot, D.; Hermans, K.; Baert, K.; Peacock, S.J.; et al. The newly described mecA homologue, mecALGA251, is present in methicillin-resistant Staphylococcus aureus isolates from a diverse range of host species. J. Antimicrob. Chemother. 2012, 67, 2809–2813. [Google Scholar] [CrossRef]
  35. Paterson, G.K.; Harrison, E.M.; Holmes, M.A. The emergence of mecC methicillin-resistant Staphylococcus aureus. Trends Microbiol. 2014, 22, 42–47. [Google Scholar] [CrossRef] [Green Version]
  36. Kondo, Y.; Ito, T.; Ma, X.X.; Watanabe, S.; Kreiswirth, B.N.; Etienne, J.; Hiramatsu, K. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: Rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrob. Agents Chemother. 2007, 51, 264–274. [Google Scholar] [CrossRef] [Green Version]
  37. Enright, M.C.; Day, N.P.; Davies, C.E.; Peacock, S.J.; Spratt, B.G. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J. Clin. Microbiol. 2000, 38, 1008–1015. [Google Scholar] [CrossRef] [Green Version]
  38. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [Green Version]
  39. Chairat, S.; Gharsa, H.; Lozano, C.; Gomez-Sanz, E.; Gomez, P.; Zarazaga, M.; Boudabous, A.; Torres, C.; Ben Slama, K. Characterization of Staphylococcus aureus from raw meat samples in Tunisia: Detection of clonal lineage ST398 from the african continent. Foodborne Pathog. Dis. 2015, 12, 686–692. [Google Scholar] [CrossRef]
  40. Ronco, T.; Klaas, I.C.; Stegger, M.; Svennesen, L.; Astrup, L.B.; Farre, M.; Pedersen, K. Genomic investigation of Staphylococcus aureus isolates from bulk tank milk and dairy cows with clinical mastitis. Vet. Microbiol. 2018, 215, 35–42. [Google Scholar] [CrossRef]
  41. Chen, L.; Zheng, D.; Liu, B.; Yang, J.; Jin, Q. VFDB 2016: Hierarchical and refined dataset for big data analysis—10 years on. Nucleic Acids Res. 2016, 44, D694–D697. [Google Scholar] [CrossRef] [PubMed]
  42. Ross, T.D. Accurate confidence intervals for binomial proportion and Poisson rate estimation. Comput. Biol. Med. 2003, 33, 509–531. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Song, M.; Bai, Y.; Xu, J.; Carter, M.Q.; Shi, C.; Shi, X. Genetic diversity and virulence potential of Staphylococcus aureus isolates from raw and processed food commodities in Shanghai. Int. J. Food Microbiol. 2015, 195, 1–8. [Google Scholar] [CrossRef] [PubMed]
  44. Buyukcangaz, E.; Velasco, V.; Sherwood, J.S.; Stepan, R.M.; Koslofsky, R.J.; Logue, C.M. Molecular typing of Staphylococcus aureus and methicillin-resistant S. aureus (MRSA) isolated from animals and retail meat in North Dakota, United States. Foodborne Pathog. Dis. 2013, 10, 608–617. [Google Scholar] [CrossRef]
  45. Ivbule, M.; Miklasevics, E.; Cupane, L.; Berzina, L.; Balins, A.; Valdovska, A. Presence of methicillin-resistant Staphylococcus aureus in slaughterhouse environment, pigs, carcasses, and workers. J. Vet. Res. 2017, 61, 267–277. [Google Scholar] [CrossRef] [Green Version]
  46. Hanson, B.M.; Dressler, A.E.; Harper, A.L.; Scheibel, R.P.; Wardyn, S.E.; Roberts, L.K.; Kroeger, J.S.; Smith, T.C. Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) on retail meat in Iowa. J. Infect. Public Health 2011, 4, 169–174. [Google Scholar] [CrossRef] [Green Version]
  47. Lassok, B.; Tenhagen, B.A. From pig to pork: Methicillin-resistant Staphylococcus aureus in the pork production chain. J. Food Prot. 2013, 76, 1095–1108. [Google Scholar] [CrossRef]
  48. Ge, B.; Mukherjee, S.; Hsu, C.H.; Davis, J.A.; Tran, T.T.T.; Yang, Q.; Abbott, J.W.; Ayers, S.L.; Young, S.R.; Crarey, E.T.; et al. MRSA and multidrug-resistant Staphylococcus aureus in U.S. retail meats, 2010–2011. Food Microbiol. 2017, 62, 289–297. [Google Scholar] [CrossRef]
  49. Jackson, C.R.; Davis, J.A.; Barrett, J.B. Prevalence and characterization of methicillin-resistant Staphylococcus aureus isolates from retail meat and humans in Georgia. J. Clin. Microbiol. 2013, 51, 1199–1207. [Google Scholar] [CrossRef] [Green Version]
  50. Bhargava, K.; Wang, X.; Donabedian, S.; Zervos, M.; de Rocha, L.; Zhang, Y. Methicillin-resistant Staphylococcus aureus in retail meat, Detroit, Michigan, USA. Emerg. Infect. Dis. 2011, 17, 1135–1137. [Google Scholar] [CrossRef]
  51. Tanomsridachchai, W.; Changkaew, K.; Changkwanyeun, R.; Prapasawat, W.; Intarapuk, A.; Fukushima, Y.; Yamasamit, N.; Flav Kapalamula, T.; Nakajima, C.; Suthienkul, O.; et al. Antimicrobial resistance and molecular characterization of methicillin-resistant Staphylococcus aureus isolated from slaughtered pigs and pork in the central region of Thailand. Antibiotics 2021, 10, 206. [Google Scholar] [CrossRef] [PubMed]
  52. Sun, J.; Yang, M.; Sreevatsan, S.; Davies, P.R. Prevalence and characterization of Staphylococcus aureus in growing pigs in the USA. PLoS ONE 2015, 10, e0143670. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Vrieling, M.; Tuffs, S.W.; Yebra, G.; van Smoorenburg, M.Y.; Alves, J.; Pickering, A.C.; Park, J.Y.; Park, N.; Heinrichs, D.E.; Benedictus, L.; et al. Population analysis of Staphylococcus aureus reveals a cryptic, highly prevalent superantigen SElW that contributes to the pathogenesis of bacteremia. mBio 2020, 11, e02082-20. [Google Scholar] [CrossRef] [PubMed]
  54. Hu, D.L.; Ono, H.K.; Isayama, S.; Okada, R.; Okamura, M.; Lei, L.C.; Liu, Z.S.; Zhang, X.C.; Liu, M.Y.; Cui, J.C.; et al. Biological characteristics of staphylococcal enterotoxin Q and its potential risk for food poisoning. J. Appl. Microbiol. 2017, 122, 1672–1679. [Google Scholar] [CrossRef] [PubMed]
Foods 11 04114 g001a 550Foods 11 04114 g001b 550
Figure 1. Multidrug resistance patterns of S. aureus isolated from wholesale and retail pork samples (a) and different groups, MSSA and MRSA (b), in Wuhan, China. AMC, amoxicillin/clavulanate; CLI, clindamycin; ERY, erythromycin; GEN, gentamicin; OXA, oxacillin; PEN, penicillin; SXT, trimethoprim/sulfamethoxazole; SYN, quinupristin/dalfopristin. AMR, resistant to at least one antimicrobial; MDR, resistant to three or more classes of antimicrobials. * Indicates p < 0.05.
Figure 1. Multidrug resistance patterns of S. aureus isolated from wholesale and retail pork samples (a) and different groups, MSSA and MRSA (b), in Wuhan, China. AMC, amoxicillin/clavulanate; CLI, clindamycin; ERY, erythromycin; GEN, gentamicin; OXA, oxacillin; PEN, penicillin; SXT, trimethoprim/sulfamethoxazole; SYN, quinupristin/dalfopristin. AMR, resistant to at least one antimicrobial; MDR, resistant to three or more classes of antimicrobials. * Indicates p < 0.05.
Foods 11 04114 g001aFoods 11 04114 g001b
Foods 11 04114 g002 550
Figure 2. Distribution of different SE and SEl genes among the S. aureus isolates from wholesale and retail pork in Wuhan, central China.
Figure 2. Distribution of different SE and SEl genes among the S. aureus isolates from wholesale and retail pork in Wuhan, central China.
Foods 11 04114 g002
Foods 11 04114 g003 550
Figure 3. Core SNP tree of the 39 S. aureus isolates from wholesale and retail pork in Wuhan, China. All isolates came from wholesale markets (W) or retail markets (R). Different types of antimicrobial resistance genes, virulence genes, and plasmid replicators are displayed with the heat map (colored squares for positives), and the class of each gene is marked above the heat map (multiresistance: ErmB and ErmC: lincosamide, macrolide and streptogramin; mgrA: cephalosporin, fluoroquinolone, penam and peptide; tetracycline; LmrS: aminoglycoside, diaminopyrimidine, macrolide, oxazolidinone and phenicol; lsaE: lincosamide, macrolide, oxazolidinone, phenicol, pleuromutilin, streptogramin, and tetracycline). NCTC8325 was used as an S. aureus reference genome (NCBI genome: txid93061), and bootstrap values from 1000 replicates were performed but not shown on the branches.
Figure 3. Core SNP tree of the 39 S. aureus isolates from wholesale and retail pork in Wuhan, China. All isolates came from wholesale markets (W) or retail markets (R). Different types of antimicrobial resistance genes, virulence genes, and plasmid replicators are displayed with the heat map (colored squares for positives), and the class of each gene is marked above the heat map (multiresistance: ErmB and ErmC: lincosamide, macrolide and streptogramin; mgrA: cephalosporin, fluoroquinolone, penam and peptide; tetracycline; LmrS: aminoglycoside, diaminopyrimidine, macrolide, oxazolidinone and phenicol; lsaE: lincosamide, macrolide, oxazolidinone, phenicol, pleuromutilin, streptogramin, and tetracycline). NCTC8325 was used as an S. aureus reference genome (NCBI genome: txid93061), and bootstrap values from 1000 replicates were performed but not shown on the branches.
Foods 11 04114 g003
Table
Table 1. Overview of S. aureus prevalence in wholesale and retail pork in Wuhan, central China.
Table 1. Overview of S. aureus prevalence in wholesale and retail pork in Wuhan, central China.
Pork Source
(Markets)		SeasonNo. of
Samples		S. aureusMRSAMSSA
No. of
Isolates		Prevalence (%)95% CI * (%)No. of
Isolates		Prevalence (%)No. of
Isolates		Prevalence (%)
WholesaleSpring5768514.8 β,γ12.0–17.933.58296.5
Summer5947112.0 γ9.5–14.822.86997.2
Autumn66110616.0 β13.3–19.165.710094.3
Winter5229418.0 α,β14.8–21.633.29196.8
Total235335615.113.7–16.6143.934296.1
RetailSpring1533724.2 b17.6–31.812.73697.3
Summer1943116.0 b11.1–21.913.23096.8
Autumn1863217.2 b12.1–23.426.33093.8
Winter1816234.3 a27.4–41.711.66198.4
Total71416222.719.7–25.953.115796.9
Total 306751816.915.6–18.3193.749996.3
Numbers with different letters (α, β, and γ, or a and b) indicate significant difference among seasons, and numbers sharing the same letter indicate no significant difference. * CI: confidence interval.
Table
Table 2. Overview of S. aureus prevalence in wholesale and retail pork in Wuhan, central China.
Table 2. Overview of S. aureus prevalence in wholesale and retail pork in Wuhan, central China.
MLSTNo. of S. aureusNo. from MarketsNo. of MRSANo. of MSSA
Type(n = 518, %)WholesaleRetail(n = 19, %)(n = 499, %)
ST729857.520098--29859.7
ST5469.12224--469.2
ST3055224.3202--224.4
ST188193.7154--193.8
ST9173.3143842.191.8
ST15142.7113--142.8
ST25142.714---142.8
ST1101.964--102
ST6101.982--102
ST88101.910---102
ST1640101.9-10--102
ST7271.43415.361.2
ST225061.251--61.2
ST630511415.340.8
ST1281515---51
ST5940.84-210.520.4
ST39840.84---40.8
ST67230.621--30.6
ST33820.42---20.4
ST137620.411210.5--
ST192020.42---20.4
ST451320.42-210.5--
ST2210.21-15.3--
ST4510.21-15.3--
ST96810.21-15.3--
ST182110.2-1--10.2
ST192110.21---10.2
ST231510.21---10.2
Table
Table 3. ST, spa, SCCmec, and SE or SEl genes identified in the S. aureus isolates from wholesale and retail pork in Wuhan, central China.
Table 3. ST, spa, SCCmec, and SE or SEl genes identified in the S. aureus isolates from wholesale and retail pork in Wuhan, central China.
S. aureusMLSTSpaSCCmecSE or SEl Genes
MRSAST9t899XII(9C2)sea, selw
t899XII(9C2)sea, selw
t899XII(9C2)seb, sec, seg, sei, sem, sen, seo, selu, selv, selw
t899XII(9C2)seg, sei, sem, sen, seo, selu, selv, selw
t899XII(9C2)sei, sem, seo, selu, selv, selw, sey
t899XII(9C2)seb, sec, selw
t899XII(9C2)sea, sec, sek, sep, seq, selw, sey
t899XII(9C2)sea, selw
ST22t309V(5C2&5)seg, sei, sem, sen, seo, selu, selv, selw, sey
ST45t026IVa(2B)sea, selw
ST59t437IVa(2B)sei, sem, seo, selu, selv, selw
t437IVa(2B)sea, selw
ST72t664IVc(2B)sei, sem, seo, selu, selv, selw, sey
ST630t14066V(5C2)seb, sec, sek, sep, seq, selw, sey
ST968t899XII(9C2)seg, sei, sem, sen, seo, selu, selv, selw, sey
ST1376t899XII(9C2)sea, selw
t7384XII(9C2)selw
ST4513t437IVa(2B)sea, selw
t437IVa(2B)sea, selw
MSSAST5t12870-seg, sei, sem, sen, seo, selu, selv, selw
t1107-sea, see, sek, sep, seq, selw
ST6t11363-sei, sem, seo, selu, selv, selw
ST7t065-seg, sei, sem, sen, seo, selu, selv, selw
t091-sea, selw
t091-seg, sei, sem, sen, seo, selu, selv, selw, sly
t091-sea, see, selw
t091-sea, seb, sec, sed, see, seg, sei, selj, sem, sen, seo, ser, selu, selv, selw
t091-sei, sem, seo, selu, selv, selw, sey
t091-seg, sei, sem, sen, seo, selu, selv, selw
t091-selw
t091-selw
t1743-seb, sec, sek, sep, seq, selw, sey
ST9t899-sea, selw
ST88t6497-selw
t6497-seg, sei, sem, sen, seo, selu, selv, selw, sey
t6497-seg, sei, sem, sen, seo, selu, selv, selw, sey
ST188t189-seg, sei, sem, sen, seo, selu, selv, selw, sey
t8807-seg, sei, sem, sen, seo, selu, selv, selw, sey
ST3628t7030-selw
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhu, Z.; Liu, X.; Chen, X.; Zou, G.; Huang, Q.; Meng, X.; Pei, X.; Chen, Z.; Zhou, R.; Hu, D.; et al. Prevalence and Virulence Determinants of Staphylococcus aureus in Wholesale and Retail Pork in Wuhan, Central China. Foods 2022, 11, 4114. https://doi.org/10.3390/foods11244114

AMA Style

Zhu Z, Liu X, Chen X, Zou G, Huang Q, Meng X, Pei X, Chen Z, Zhou R, Hu D, et al. Prevalence and Virulence Determinants of Staphylococcus aureus in Wholesale and Retail Pork in Wuhan, Central China. Foods. 2022; 11(24):4114. https://doi.org/10.3390/foods11244114

Chicago/Turabian Style

Zhu, Zhihao, Xiaoying Liu, Xingyu Chen, Geng Zou, Qi Huang, Xianrong Meng, Xiaoying Pei, Zhou Chen, Rui Zhou, Dongliang Hu, and et al. 2022. "Prevalence and Virulence Determinants of Staphylococcus aureus in Wholesale and Retail Pork in Wuhan, Central China" Foods 11, no. 24: 4114. https://doi.org/10.3390/foods11244114

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop