Dietary Supplementation of Auricularia auricula-judae Polysaccharides Alleviate Nutritional Obesity in Mice via Regulating Inflammatory Response and Lipid Metabolism
Abstract
:1. Introduction
2. Materials and Methods
2.1. Samples Preparation
2.2. Experimental Design
2.3. Assessments
2.3.1. Body Weight, Food Intake, Fluid Intake Measurement
2.3.2. Intraperitoneal Glucose Tolerance Test and the Homeostasis Model Assessment of Insulin Resistance Index
2.3.3. Blood Sample Collection and Tissue Weight Measurement
2.3.4. Lipid Analysis
2.3.5. HE Staining of Liver Tissue
2.3.6. Gene Expressions Analysis
2.3.7. Statistical Analysis
3. Results
3.1. Dietary Supplementation of AAP Reduced the Food Efficiency Ratio and Slowed Down the Bodyweight Gain of Obese Mice Fed by HFFD
3.2. Dietary AAP Supplementation Improved Glucose Tolerance and Insulin Resistance in Obese Mice Induced by HFFD
3.3. Dietary Supplement of AAP Regulated Serum Lipid Levels in HFFD-Induced Obese Mice
3.4. Dietary AAP Supplementation Reduced Mice Liver Weight Gain and Alleviated Liver Histomorphology Changes Induced by HFFD
3.5. Dietary Supplement of AAP Inhibited Liver Inflammatory Response in HFFD-Fed Mice
3.6. AAP Down-Regulated the Pro-Lipid Accumulation Genes Expressions, Up-Regulated Pro-Lipolysis Genes and Mitochondrial Active Genes Expressions, Improving Liver Lipid Metabolism
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bluher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [PubMed]
- Chen, Y.; Peng, Q.; Yang, Y.; Zheng, S.; Wang, Y.; Lu, W. The prevalence and increasing trends of overweight, general obesity, and abdominal obesity among Chinese adults: A repeated cross-sectional study. BMC Public Health 2019, 19, 1293. [Google Scholar]
- Hwalla, N.; Jaafar, Z. Dietary Management of Obesity: A Review of the Evidence. Diagnostics 2020, 11, 24. [Google Scholar]
- Van der Zande, H.J.P.; Lambooij, J.M.; Chavanelle, V.; Zawistowska-Deniziak, A.; Otero, Y.; Otto, F.; Lantier, L.; McGuinness, O.P.; Le Joubioux, F.; Giera, M.; et al. Effects of a novel polyphenol-rich plant extract on body composition, inflammation, insulin sensitivity, and glucose homeostasis in obese mice. Int. J. Obes. 2021, 45, 2016–2027. [Google Scholar]
- Liu, E.; Ji, Y.; Zhang, F.; Liu, B.; Meng, X. Review on Auricularia auricula-judae as a Functional Food: Growth, Chemical Composition, and Biological Activities. J. Agr. Food Chem. 2021, 69, 1739–1750. [Google Scholar]
- Tahidul, I.; Kumar, G.; Baojun, X. Insights into health-promoting effects of Jew’s ear (Auricularia auricula-judae). Trends Food Sci. Tech. 2021, 114, 552–569. [Google Scholar]
- Chen, N.; Zhang, H.; Zong, X.; Li, S.; Wang, J.; Wang, Y.; Jin, M. Polysaccharides from Auricularia auricula: Preparation, structural features and biological activities. Carbohydr. Polym. 2020, 247, 116750. [Google Scholar] [PubMed]
- Miao, J.; Regenstein, J.M.; Qiu, J.; Zhang, J.; Zhang, X.; Li, H.; Zhang, H.; Wang, Z. Isolation, structural characterization and bioactivities of polysaccharides and its derivatives from Auricularia-A review. Int. J. Biol. Macromol. 2020, 150, 102–113. [Google Scholar]
- Chen, G.; Luo, Y.C.; Li, B.P.; Li, B.; Guo, Y.; Li, Y.; Su, W.; Xiao, Z.L. Effect of polysaccharide from Auricularia auricula on blood lipid metabolism and lipoprotein lipase activity of ICR mice fed a cholesterol-enriched diet. J. Food Sci. 2008, 73, H103–H108. [Google Scholar]
- Chen, G.; Luo, Y.C.; Ji, B.P.; Li, B.; Su, W.; Xiao, Z.L.; Zhang, G.Z. Hypocholesterolemic effects of Auricularia auricula ethanol extract in ICR mice fed a cholesterol-enriched diet. J. Food Sci. Technol. 2011, 48, 692–698. [Google Scholar] [PubMed] [Green Version]
- Zhang, T.T.; Zhao, W.Y.; Xie, B.Z.; Liu, H. Effects of Auricularia auricula and its polysaccharide on diet-induced hyperlipidemia rats by modulating gut microbiota. J. Funct. Foods 2020, 72, 104038. [Google Scholar]
- Hancock, C.R.; Han, D.H.; Chen, M.; Terada, S.; Yasuda, T.; Wright, D.C.; Holloszy, J.O. High-fat diets cause insulin resistance despite an increase in muscle mitochondria. Proc. Natl. Acad. Sci. USA 2008, 105, 7815–7820. [Google Scholar] [PubMed] [Green Version]
- Fabbrini, E.; Sullivan, S.; Klein, S. Obesity and nonalcoholic fatty liver disease: Biochemical, metabolic, and clinical implications. Hepatology 2010, 51, 679–689. [Google Scholar] [PubMed]
- Stefan, N.; Häring, H.-U.; Cusi, K. Non-alcoholic fatty liver disease: Causes, diagnosis, cardiometabolic consequences, and treatment strategies. Lancet Diabetes Endo. 2019, 7, 313–324. [Google Scholar]
- Rathore, H.; Prasad, S.; Kapri, M.; Tiwari, A.; Sharma, S. Medicinal importance of mushroom mycelium: Mechanisms and applications. J. Funct. Foods 2019, 56, 182–193. [Google Scholar]
- Sun, Y.; Zhang, M.; Fang, Z. Efficient physical extraction of active constituents from edible fungi and their potential bioactivities: A review. Trends Food Sci. Tech. 2020, 105, 468–482. [Google Scholar]
- Amwoga, A.P. Potential of Mushroom Compounds as Immunomodulators in Cancer Immunotherapy: A Review. Evid.-Based Compl. Alt. eCAM 2018, 2018, 7271509. [Google Scholar]
- Ahmad, M.F. Ganoderma lucidum: Persuasive biologically active constituents and their health endorsement. Biomed. Pharmacother. 2018, 107, 507–519. [Google Scholar]
- Jingjing, L.; Meina, Z.; Xingnan, W.; Yichen, R.; Tianli, Y.; Zhouli, W.; Zhenpeng, G. Edible fungal polysaccharides, the gut microbiota, and host health. Carbohyd. Polym. 2021, 273, 118558. [Google Scholar]
- Leong, Y.K.; Yang, F.-C.; Chang, J.-S. Extraction of polysaccharides from edible mushrooms: Emerging technologies and recent advances. Carbohyd. Polym. 2021, 251, 117006. [Google Scholar]
- Crovetto, M.; Valladares, M.; Espinoza, V.; Mena, F.; Onate, G.; Fernandez, M.; Duran-Aguero, S. Effect of healthy and unhealthy habits on obesity: A multicentric study. Nutrition 2018, 54, 7–11. [Google Scholar] [PubMed]
- Tappy, L.; Le, K.A. Metabolic effects of fructose and the worldwide increase in obesity. Physiol. Rev. 2010, 90, 23–46. [Google Scholar] [PubMed] [Green Version]
- Kanarek, R.B.; Orthen-Gambill, N. Differential effects of sucrose, fructose and glucose on carbohydrate-induced obesity in rats. J. Nutr. 1982, 112, 1546–1554. [Google Scholar] [PubMed] [Green Version]
- Helsley, R.N.; Moreau, F.; Gupta, M.K.; Radulescu, A.; DeBosch, B.; Softic, S. Tissue-Specific Fructose Metabolism in Obesity and Diabetes. Curr. Diabetes Rep. 2020, 20, 1–16. [Google Scholar]
- Hernandez-Diazcouder, A.; Romero-Nava, R.; Carbo, R.; Sanchez-Lozada, L.G.; Sanchez-Munoz, F. High Fructose Intake and Adipogenesis. Int. J. Mol. Sci. 2019, 20, 2787. [Google Scholar]
- Mortera, R.R.; Bains, Y.; Gugliucci, A. Fructose at the crossroads of the metabolic syndrome and obesity epidemics. Front. Biosci.-Landmrk 2019, 24, 186–211. [Google Scholar]
- King, C.; Lanaspa, M.A.; Jensen, T.; Tolan, D.R.; Sanchez-Lozada, L.G.; Johnson, R.J. Uric Acid as a Cause of the Metabolic Syndrome. Contrib. Nephrol. 2018, 192, 88–102. [Google Scholar] [PubMed]
- Li, L.; Su, Y.; Feng, Y.; Hong, R. A comparison study on digestion, anti-inflammatory and functional properties of polysaccharides from four Auricularia species. Int. J. Biol. Macromol. 2020, 154, 1074–1081. [Google Scholar]
- Hu, X.; Liu, C.; Wang, X.; Jia, D.; Lu, W.; Sun, X.; Liu, Y.; Yuan, L. Hpyerglycemic and anti-diabetic nephritis activities of polysaccharides separated from Auricularia auricular in diet-streptozotocin-induced diabetic rats. Exp. Ther. Med. 2017, 13, 352–358. [Google Scholar]
- Wu, Q.; Wang, Q.; Fu, J.; Ren, R. Polysaccharides derived from natural sources regulate triglyceride and cholesterol metabolism: A review of the mechanisms. Food Funct. 2019, 10, 2330–2339. [Google Scholar]
- Wu, T.; Guo, Y.; Liu, R.; Wang, K.; Zhang, M. Black tea polyphenols and polysaccharides improve body composition, increase fecal fatty acid, and regulate fat metabolism in high-fat diet-induced obese rats. Food Funct. 2016, 7, 2469–2478. [Google Scholar] [PubMed]
- Yang, Z.W.; Ouyang, K.H.; Zhao, J.; Chen, H.; Xiong, L.; Wang, W.J. Structural characterization and hypolipidemic effect of Cyclocarya paliurus polysaccharide in rat. Int. J. Biol. Macromol. 2016, 91, 1073–1080. [Google Scholar] [PubMed]
- Wang, C.M.; Yuan, R.S.; Zhuang, W.Y.; Sun, J.H.; Wu, J.Y.; Li, H.; Chen, J.G. Schisandra polysaccharide inhibits hepatic lipid accumulation by downregulating expression of SREBPs in NAFLD mice. Lipids Health Dis. 2016, 15, 195. [Google Scholar] [PubMed] [Green Version]
- Xu, Y.; Zhang, M.; Wu, T.; Dai, S.; Xu, J.; Zhou, Z. The anti-obesity effect of green tea polysaccharides, polyphenols and caffeine in rats fed with a high-fat diet. Food Funct. 2015, 6, 297–304. [Google Scholar]
- Chen, G.; Xie, M.; Wan, P.; Chen, D.; Dai, Z.; Ye, H.; Hu, B.; Zeng, X.; Liu, Z. Fuzhuan brick tea polysaccharides attenuate metabolic syndrome in high-fat diet induced mice in association with modulation in the gut microbiota. J. Agr. Food Chem. 2018, 66, 2783–2795. [Google Scholar]
- Lehman, J.J.; Boudina, S.; Banke, N.H.; Sambandam, N.; Han, X.; Young, D.M.; Leone, T.C.; Gross, R.W.; Lewandowski, E.D.; Abel, E.D.; et al. The transcriptional coactivator PGC-1alpha is essential for maximal and efficient cardiac mitochondrial fatty acid oxidation and lipid homeostasis. Am. J. Physiol. Am. J. Physiol.-Heart C. 2008, 295, H185–H196. [Google Scholar]
- Artemniak-Wojtowicz, D.; Kucharska, A.M.; Pyrżak, B. Obesity and chronic inflammation crosslinking. Cent. Eur. J. Immunol. 2020, 45, 461. [Google Scholar]
- Nakarai, H.; Yamashita, A.; Nagayasu, S.; Iwashita, M.; Kumamoto, S.; Ohyama, H.; Hata, M.; Soga, Y.; Kushiyama, A.; Asano, T.; et al. Adipocyte-macrophage interaction may mediate LPS-induced low-grade inflammation: Potential link with metabolic complications. Innate Immun.-London 2012, 18, 164–170. [Google Scholar]
- Grisouard, J.; Bouillet, E.; Timper, K.; Radimerski, T.; Dembinski, K.; Frey, D.M.; Peterli, R.; Zulewski, H.; Keller, U.; Muller, B.; et al. Both inflammatory and classical lipolytic pathways are involved in lipopolysaccharide-induced lipolysis in human adipocytes. Innate Immun.-London 2012, 18, 25–34. [Google Scholar]
- Rogero, M.; Calder, P. Obesity, Inflammation, Toll-Like Receptor 4 and Fatty Acids. Nutrients 2018, 10, 432. [Google Scholar]
- Wu, H.; Ballantyne, C.M. Metabolic Inflammation and Insulin Resistance in Obesity. Circ. Res. 2020, 126, 1549–1564. [Google Scholar] [PubMed]
- Hou, C.Y.; Chen, L.L.; Yang, L.Z.; Ji, X.L. An insight into anti-inflammatory effects of natural polysaccharides. Int. J. Biol. Macromol. 2020, 153, 248–255. [Google Scholar] [PubMed]
- Cai, J.L.; Zhu, Y.L.; Zuo, Y.J.; Tong, Q.Z.; Zhang, Z.G.; Yang, L.; Li, X.P.; Yi, G.Q. Polygonatum sibiricum polysaccharide alleviates inflammatory cytokines and promotes glucose uptake in high-glucose- and high-insulin-induced 3T3-L1 adipocytes by promoting Nrf2 expression. Mol. Med. Rep. 2019, 20, 3951–3958. [Google Scholar] [PubMed]
- Wu, Y.S.; Ho, S.Y.; Nan, F.H.; Chen, S.N. Ganoderma lucidum beta 1,3/1,6 glucan as an immunomodulator in inflammation induced by a high-cholesterol diet. BMC Complem. Altern. Med. 2016, 16, 1–11. [Google Scholar]
- Song, Q.Q.; Wang, Y.K.; Huang, L.X.; Shen, M.Y.; Yu, Y.; Yu, Q.; Chen, Y.; Xie, J.H. Review of the relationships among polysaccharides, gut microbiota, and human health. Food Res. Int. 2021, 140, 109858. [Google Scholar]
- Zhao, R.Q.; Yang, W.J.; Pei, F.; Zhao, L.Y.; Hu, Q.H. In vitro fermentation of six kinds of edible mushrooms and its effects on fecal It microbiota composition. LWT-Food Sci. Technol. 2018, 96, 627–635. [Google Scholar]
- Sharma, V.; Smolin, J.; Nayak, J.; Ayala, J.E.; Scott, D.A.; Peterson, S.N.; Freeze, H.H. Mannose alters gut microbiome, prevents diet-induced obesity, and improves host metabolism. Cell Rep. 2018, 24, 3087–3098. [Google Scholar]
Forward Primer | Reverse Primer | |
---|---|---|
Pparg | TGCTGTTATGGGTGAAACTCTG | CTGTGTCAACCATGGTAATTTCTT |
Pgc1a | GAAAGGGCCAAACAGAGAGA | GTAAATCACACGGCGCTCTT |
Fasn | AGGTGGTGATAGCCGGTATGT | TGGGTAATCCATAGAGCCCAG |
Acaca | CCGATTCATAATTGGGTCTGTGT | CCATCCTGTAAGCCAGAGATCC |
Cpt1a | CGGTTCAAGAATGGCATCATC | TCACACCCACCACCACGATA |
Cpt2 | AGCCAGTTCAGGAAGACAGA | GACAGAGTCTCGAGCAGTTA |
LXRβ | CGACTCCAGGACAAGAAGC | TCAAGAAGACACCACCAAGG |
Srebp1c | AAGCAAATCACTGAAGGACCTGG | AAAGACAAGGGGCTACTCTGGGAG |
ME1 | AGTATCCATGACAAAGGGCAC | ATCCCATTACAGCCAAGGTC |
Acat2 | TTTGCTCTATGCCTGCTTCA | CCATGAAGAGAAAGGTCCACA |
Abcg5 | TGGCCCTGCTCAGCATCT | ATTTTTAAAGGAATGGGCATCTCTT |
Abcg8 | CCGTCGTCAGATTTCCAATGA | GGCTTCCGACCCATGAATG |
Sirt1 | TCTGTCTCCTGTGGGATTCC | GATGCTGTTGCAAAGGAACC |
Tfam | GCTTCCAGGGGGCTAAGGAT | CCCAATCCCAATGACAACTC |
COX II | GCCGACTAAATCAAGCAACA | CAATGGGCATAAAGCTATGG |
Hmgcr | ATCCAGGAGCGAACCAAGAGAG | CAGAAGCCCCAAGCACAAAC |
IL6 | TTCCATCCAGTTGCCTTCTTG | TATCCTCTGTGAAGTCTCCTCTC |
IL10 | GCTCCAAGACCAAGGTGTCTACAA | CCGTTAGCTAAGATCCCTGGATCA |
IL1β | TGACGGACCCCAAAAGATGA | TCTCCACAGCCACAATGAGT |
Tnfα | CCCTCACACTCAGATCATCTTCT | GCTACGACGTGGGCTACAG |
Gapdh | TGGAGAAACCTGCCAAGTATGA | TGGAAGAATGGGAGTTGCTGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Q.; Ma, R.; Li, S.; Fei, Y.; Lei, J.; Li, R.; Pan, Y.; Liu, S.; Wang, L. Dietary Supplementation of Auricularia auricula-judae Polysaccharides Alleviate Nutritional Obesity in Mice via Regulating Inflammatory Response and Lipid Metabolism. Foods 2022, 11, 942. https://doi.org/10.3390/foods11070942
Liu Q, Ma R, Li S, Fei Y, Lei J, Li R, Pan Y, Liu S, Wang L. Dietary Supplementation of Auricularia auricula-judae Polysaccharides Alleviate Nutritional Obesity in Mice via Regulating Inflammatory Response and Lipid Metabolism. Foods. 2022; 11(7):942. https://doi.org/10.3390/foods11070942
Chicago/Turabian StyleLiu, Qian, Ruisen Ma, Si Li, Yujie Fei, Jing Lei, Ruoyu Li, Yu Pan, Sining Liu, and Langhong Wang. 2022. "Dietary Supplementation of Auricularia auricula-judae Polysaccharides Alleviate Nutritional Obesity in Mice via Regulating Inflammatory Response and Lipid Metabolism" Foods 11, no. 7: 942. https://doi.org/10.3390/foods11070942