Aerotolerance and Multi-Locus Sequence Typing of Campylobacter jejuni Isolated from Commercial Broiler Processing Plants
Abstract
:1. Introduction
2. Materials and Methods
2.1. Campylobacter Strains and Culture Conditions
2.2. Evaluation of Aerotolerance
2.3. Multi-Locus Sequence Typing
2.3.1. DNA Extraction
2.3.2. PCR Amplification
2.3.3. MLST Allele, Sequence Type (ST), and Clonal Complex (CC) Assignment
2.3.4. Phylogenetic Relationship between C. jejuni Isolates
2.4. Effect of Refrigeration and Freezing on C. jejuni Survival on Chicken Drumsticks
2.5. Statistical Analysis
3. Results
3.1. Aerotolerance Level of C. jejuni Isolates
3.2. MLST Analysis of C. jejuni Isolates
3.3. Aerotolerance and Genetic Relatedness
3.4. Refrigeration and Freezing
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Igwaran, A.; Okoh, A.I. Human Campylobacteriosis: A Public Health Concern of Global Importance. Heliyon 2019, 5, e02814. [Google Scholar] [CrossRef] [PubMed]
- Newell, D.G.; Mughini-Gras, L.; Kalupahana, R.S.; Wagenaar, J.A. Campylobacter Epidemiology-Sources and Routes of Transmission for Human Infection; Elsevier Inc.: Amsterdam, The Netherlands, 2017. [Google Scholar] [CrossRef]
- Centers for Disease Control and Prevention (CDC). Campylobacter (Campylobacteriosis) (Final Update). Available online: https://www.cdc.gov/campylobacter/index.html (accessed on 2 June 2023).
- Nachamkin, I.; Allos, B.M.; Ho, T. Campylobacter Species and Guillain-Barre Syndrome. Clin. Microbiol. Rev. 1998, 11, 555–567. [Google Scholar] [CrossRef] [PubMed]
- Doyle, M.P.; Roman, D.J. Response of Campylobacter Jejuni to Sodium Chloride. Appl. Environ. Microbiol. 1982, 43, 561–565. [Google Scholar] [CrossRef] [PubMed]
- Berrang, M.E.; Bailey, J.S.; Altekruse, S.F.; Patel, B.; Shaw, W.K.; Meinersmann, R.J.; Fedorka-Cray, P.J. Prevalence and Numbers of Campylobacter on Broiler Carcasses Collected at Rehang and Postchill in 20 U.S. Processing Plants. J. Food Prot. 2007, 70, 1556–1560. [Google Scholar] [CrossRef]
- Zhao, S.; Young, S.; Tong, E.; Abott, J.; Womack, N.; Friedman, S.; McDermott, P.F. Antimicrobial Resistance Of Campylobacter Isolates from Retail Meat in the United States between 2002 and 2007. Appl. Environ. Microbiol. 2010, 76, 7949–7956. [Google Scholar] [CrossRef]
- Berghaus, R.D.; Thayer, S.G.; Law, B.F.; Mild, R.M.; Hofacre, C.L.; Singer, R.S. Enumeration of Salmonella and Campylobacter spp. in Environmental Farm Samples and Processing Plant Carcass Rinses from Commercial Broiler Chicken Flocks. Appl. Environ. Microbiol. 2013, 79, 4106–4114. [Google Scholar] [CrossRef]
- Xu, X.; Rothrock, M.J.; Mohan, A.; Kumar, G.D.; Mishra, A. Using Farm Management Practices to Predict Campylobacter Prevalence in Pastured Poultry Farms. Poult. Sci. 2021, 100, 101122. [Google Scholar] [CrossRef]
- Kaakoush, N.O.; Miller, W.G.; De Reuse, H.; Mendz, G.L. Oxygen Requirement and Tolerance of Campylobacter jejuni. Res. Microbiol. 2007, 158, 644–650. [Google Scholar] [CrossRef]
- Oh, E.; McMullen, L.; Jeon, B. High Prevalence of Hyper-Aerotolerant Campylobacter Jejuni in Retail Poultry with Potential Implication in Human Infection. Front. Microbiol. 2015, 6, 1–8. [Google Scholar] [CrossRef]
- Mouftah, S.F.; Cobo-Díaz, J.F.; Álvarez-Ordóñez, A.; Mousa, A.; Calland, J.K.; Pascoe, B.; Sheppard, S.K.; Elhadidy, M. Stress Resistance Associated with Multi-Host Transmission and Enhanced Biofilm Formation at 42 °C among Hyper-Aerotolerant Generalist Campylobacter Jejuni. Food Microbiol. 2021, 95, 103706. [Google Scholar] [CrossRef]
- Uzunović-Kamberović, S.; Zorman, T.; Heyndrickx, M.; Možina, S.S. Role of Poultry Meat in Sporadic Campylobacter Infections in Bosnia and Herzegovina: Laboratory-Based Study. Croat. Med. J. 2007, 48, 842–851. [Google Scholar] [CrossRef] [PubMed]
- Oh, E.; Andrews, K.J.; Jeon, B. Enhanced Biofilm Formation by Ferrous and Ferric Iron through Oxidative Stress in Campylobacter Jejuni. Front. Microbiol. 2018, 9, 1204. [Google Scholar] [CrossRef] [PubMed]
- Oh, E.; Andrews, K.J.; McMullen, L.M.; Jeon, B. Tolerance to Stress Conditions Associated with Food Safety in Campylobacter Jejuni Strains Isolated from Retail Raw Chicken. Sci. Rep. 2019, 9, 11915. [Google Scholar] [CrossRef] [PubMed]
- Wassenaar, T.M.; Newell, D.G. Genotyping of Campylobacter spp. Appl. Environ. Microbiol. 2000, 66, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Dingle, K.E.; Colles, F.M.; Wareing, D.R.A.; Ure, R.; Fox, A.J.; Bolton, F.E.; Bootsma, H.J.; Willems, R.J.L.; Urwin, R.; Maiden, M.C.J. Multilocus Sequence Typing System for Campylobacter Jejuni. J. Clin. Microbiol. 2001, 39, 14–23. [Google Scholar] [CrossRef] [PubMed]
- Geissler, A.L.; Bustos Carrillo, F.; Swanson, K.; Patrick, M.E.; Fullerton, K.E.; Bennett, C.; Barrett, K.; Mahon, B.E. Increasing Campylobacter Infections, Outbreaks, and Antimicrobial Resistance in the United States, 2004–2012. Clin. Infect. Dis. 2017, 65, 1624–1631. [Google Scholar] [CrossRef]
- Colles, F.M.; Jones, K.; Harding, R.M.; Maiden, M.C.J. Genetic Diversity of Campylobacter Jejuni Isolates from Farm Animals and the Farm Environment. Appl. Environ. Microbiol. 2003, 69, 7409–7413. [Google Scholar] [CrossRef]
- Thames, H.T.; Fancher, C.A.; Colvin, M.G.; McAnally, M.; Tucker, E.; Zhang, L.; Kiess, A.S.; Dinh, T.T.N.; Sukumaran, A.T. The Prevalence of Salmonella and Campylobacter on Broiler Meat at Different Stages of Commercial Poultry Processing. Animals 2022, 12, 2460. [Google Scholar] [CrossRef]
- Thames, H.T.; Fancher, C.A.; Colvin, M.G.; McAnally, M.; Tucker, E.; Zhang, L.; Kiess, A.S.; Dinh, T.T.N.; Sukumaran, A.T. Spoilage Bacteria Counts on Broiler Meat at Different Stages of Commercial Poultry Processing Plants That Use Peracetic Acid. Animals 2022, 12, 1439. [Google Scholar] [CrossRef]
- Jolley, K.A.; Bray, J.E.; Maiden, M.C.J. Open-Access Bacterial Population Genomics: BIGSdb Software, the PubMLST.Org Website and Their Applications. Wellcome Open Res. 2018, 3, 1–20. [Google Scholar] [CrossRef]
- Karki, A.B.; Marasini, D.; Oakey, C.K.; Mar, K.; Fakhr, M.K. Campylobacter Coli from Retail Liver and Meat Products Is More Aerotolerant than Campylobacter Jejuni. Front. Microbiol. 2018, 9, 2951. [Google Scholar] [CrossRef] [PubMed]
- Oh, E.; Chui, L.; Bae, J.; Li, V.; Ma, A.; Mutschall, S.K.; Taboada, E.N.; McMullen, L.M.; Jeon, B. Frequent Implication of Multistress-Tolerant Campylobacter Jejuni in Human Infections. Emerg. Infect. Dis. 2018, 24, 1037–1044. [Google Scholar] [CrossRef] [PubMed]
- Kiatsomphob, S.; Taniguchi, T.; Tarigan, E.; Latt, K.M.; Jeon, B.; Misawa, N. Aerotolerance and Multilocus Sequence Typing among Campylobacter Jejuni Strains Isolated from Humans, Broiler Chickens, and Cattle in Miyazaki Prefecture, Japan. J. Vet. Med. Sci. 2019, 81, 1144–1151. [Google Scholar] [CrossRef] [PubMed]
- Lévesque, S.; Frost, E.; Arbeit, R.D.; Michaud, S. Multilocus Sequence Typing of Campylobacter Jejuni Isolates from Humans, Chickens, Raw Milk, and Environmental Water in Quebec, Canada. J. Clin. Microbiol. 2008, 46, 3404–3411. [Google Scholar] [CrossRef] [PubMed]
- Noormohamed, A.; Fakhr, M.K. Molecular Typing of Campylobacter Jejuni and Campylobacter Coli Isolated from Various Retail Meats by Mlst and Pfge. Foods 2014, 3, 82–93. [Google Scholar] [CrossRef] [PubMed]
- Di Giannatale, E.; Calistri, P.; Di Donato, G.; Decastelli, L.; Goffredo, E.; Adriano, D.; Mancini, M.E.; Galleggiante, A.; Neri, D.; Antoci, S.; et al. Thermotolerant Campylobacter spp. in Chicken and Bovine Meat in Italy: Prevalence, Level of Contamination and Molecular Characterization of Isolates. PLoS ONE 2019, 14, e0225957. [Google Scholar] [CrossRef] [PubMed]
- Sails, A.D.; Swaminathan, B.; Fields, P.I. Utility of Multilocus Sequence Typing as an Epidemiological Tool for Investigation of Outbreaks of Gastroenteritis Caused by Campylobacter Jejuni. J. Clin. Microbiol. 2003, 41, 4733–4739. [Google Scholar] [CrossRef]
- Cornelius, A.J.; Gilpin, B.; Carter, P.; Nicol, C.; On, S.L.W. Comparison of PCR Binary Typing (P-BIT), a New Approach to Epidemiological Subtyping of Campylobacter Jejuni, with Serotyping, Pulsed-Field Gel Electrophoresis, and Multilocus Sequence Typing Methods. Appl. Environ. Microbiol. 2010, 76, 1533–1544. [Google Scholar] [CrossRef]
- Jorgensen, F.; Ellis-Iversen, J.; Rushton, S.; Bull, S.A.; Harris, S.A.; Bryan, S.J.; Gonzalez, A.; Humphrey, T.J. Influence of Season and Geography on Campylobacter Jejuni and C. Coli Subtypes in Housed Broiler Flocks Reared in Great Britain. Appl. Environ. Microbiol. 2011, 77, 3741–3748. [Google Scholar] [CrossRef]
- McCarthy, N.D.; Colles, F.M.; Dingle, K.E.; Bagnall, M.C.; Manning, G.; Maiden, M.C.J.; Falush, D. Host-Associated Genetic Import in Campylobacter Jejuni. Emerg. Infect. Dis. 2007, 13, 267–272. [Google Scholar] [CrossRef]
- Palumbo, S.A.; Williams, A.C. Resistance OfListeria Monocytogenes to Freezing in Foods. Food Microbiol. 1991, 8, 63–68. [Google Scholar] [CrossRef]
- Bhaduri, S.; Cottrell, B. Survival of Cold-Stressed Campylobacter Jejuni on Ground Chicken and Chicken Skin during Frozen Storage. Appl. Environ. Microbiol. 2004, 70, 7103–7109. [Google Scholar] [CrossRef]
- Oh, E.; McMullen, L.M.; Chui, L.; Jeon, B. Differential Survival of Hyper-Aerotolerant Campylobacter Jejuni under Different Gas Conditions. Front. Microbiol. 2017, 8, 954. [Google Scholar] [CrossRef] [PubMed]
- Ritz, M.; Nauta, M.J.; Teunis, P.F.M.; Van Leusden, F.; Federighi, M.; Havelaar, A.H. Modelling of Campylobacter Survival in Frozen Chicken Meat. J. Appl. Microbiol. 2007, 103, 594–600. [Google Scholar] [CrossRef] [PubMed]
Source | No. of C. jejuni Isolates |
---|---|
Mechanically separated meat (MDM) | 8 |
Post pick (PP) | 11 |
Pre-chill (PRC) | 19 |
Drumstick (DRUM) | 2 |
Gene | Primer Sequence (5’–3’) | Product Size | Reference |
---|---|---|---|
aspA | AGTACTAATGATGCTTAT CC | 941 | [17] |
ATTTCATCAATTTGTTCTTTGC | |||
glnA | TAGGAACTTGGCATCATATTACC | 1305 | [17] |
TTGGACGAGCTTCTACTGGC | |||
gltA | CCAAATAAAGTTGTCTTGGACGG | 1112 | [17] |
GGGCTTGACTTCTACAGCTAC TTG | |||
glyA | GAGTTAGAGCGTCAATGTGAAGG | 1052 | [17] |
AAACCTCTGGCAGTAAGGGC | |||
pgm | TACTAATAATATCTTAGTAGG | 1195 | [17] |
CACAACATTTTTCATTTCTTTTTC | |||
tkt | AAAGCATTGTTAATGGCTGC | 1133 | [17] |
GCAAACTCAGGACACCCAGG | |||
uncA | ATGGACTTAAGAATATTATGGC | 1259 | [17] |
ATAAATTCCATCTTCAAATTCC |
Gene | Primer Sequence (5’–3’) | Reference |
---|---|---|
aspA | AAGCGCAATATCAGCCACTC | Unpublished |
glnA | TAGGAACTTGGCATCATATTACC | Unpublished |
gltA | CCAAAGCGCACCAATACCTG | [17] |
glyA | AGGTGATTATCCGTTCCATCGC | [17] |
pgm | TCCAGAATAGCGAAATAAGG | [17] |
tkt | ACTTCTTCACCCAAAGGTGCG | [17] |
uncA | ATTCTTTGTCCACGTTCAAG | Unpublished |
Aero-Sensitive | Intermediate Aerotolerant | Hyper Aerotolerant |
---|---|---|
C–256 (CC–21) | C–153 (CC– 443) | C–785 (CC–353) |
C–273 (CC–21) | C–127 (CC–443) | C–893 (CC–353) |
C–264 (CC–21) | C–135 (CC–443) | C–777 (CC–353) |
Clonal Complex (No. of Isolates) | Sequence Type | Source | Total | |||
---|---|---|---|---|---|---|
Drumstick | MDM | PP | PRC | |||
CC–353 (27) | ST–2132 | 1 | – | 3 | 6 | 10 |
ST–10382 | – | – | 1 | – | 1 | |
ST–10578 | 1 | 4 | 6 | 4 | 15 | |
ST–12438 | – | – | – | 1 | 1 | |
CC–21(5) | ST–8 | – | 4 | – | – | 4 |
ST–12437 | – | – | – | 1 | 1 | |
CC–464(1) | ST–464 | – | – | – | 1 | 1 |
CC–443(6) | ST–51 | – | – | – | 6 | 6 |
UN (1) | ST–12439 | – | – | 1 | – | 1 |
Processing Plants | Number of Isolates | Major Clonal Complex (No. of Isolates) |
---|---|---|
Plant–1 | 12 | CC–443 (6); CC–21 (5); CC–353 (1) |
Plant–2 | 5 | CC–353 (4); CC–464 (1) |
Plant–3 | 23 | CC–353 (22); UN (1) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pokhrel, D.; Thames, H.T.; Zhang, L.; Dinh, T.; Schilling, M.W.; White, S.; Ramachandran, R.; Sukumaran, A.T. Aerotolerance and Multi-Locus Sequence Typing of Campylobacter jejuni Isolated from Commercial Broiler Processing Plants. Foods 2023, 12, 3305. https://doi.org/10.3390/foods12173305
Pokhrel D, Thames HT, Zhang L, Dinh T, Schilling MW, White S, Ramachandran R, Sukumaran AT. Aerotolerance and Multi-Locus Sequence Typing of Campylobacter jejuni Isolated from Commercial Broiler Processing Plants. Foods. 2023; 12(17):3305. https://doi.org/10.3390/foods12173305
Chicago/Turabian StylePokhrel, Diksha, Hudson T. Thames, Li Zhang, Thu Dinh, M. Wes Schilling, Shecoya White, Reshma Ramachandran, and Anuraj T. Sukumaran. 2023. "Aerotolerance and Multi-Locus Sequence Typing of Campylobacter jejuni Isolated from Commercial Broiler Processing Plants" Foods 12, no. 17: 3305. https://doi.org/10.3390/foods12173305