A Droplet Digital PCR-Based Approach for Quantitative Analysis of the Adulteration of Atlantic Salmon with Rainbow Trout
Abstract
:1. Introduction
2. Materials and Methods
2.1. Test Material Preparation
2.2. DNA Extraction
2.3. Primer and Probe Design
2.4. ddPCR Procedure
2.5. Specificity
2.6. Establishment of Quantitative Formula
2.7. Dynamic Range, Limit of Detection (LOD), and Limit of Quantification (LOQ)
2.8. Repeatability and Reproducibility
2.9. Evaluation of the Impact of Treatment Temperatures
2.10. Evaluation of the Impact of Different Food Additives
2.11. Testing of Commercially Available Products
2.12. qPCR Assays
2.13. Statistical Analysis
3. Results and Discussion
3.1. Specificity
3.2. Establishment of Quantitative Formula
3.3. Dynamic Range, LOD, and LOQ
3.4. Repeatability and Reproducibility
3.5. Impact of Treatment Temperatures on Quantification
3.6. Impact of Food Additives on Quantification
3.7. Comparsion of the ddPCR and qPCR Assays
3.8. Quantitative Testing of Commercially Available Products
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Landry, J.D.; Blanch, E.W.; Torley, P.J. Chemical indicators of atlantic salmon quality. Food Rev. Int. 2023. [Google Scholar] [CrossRef]
- Haq, M.; Park, S.K.; Kim, M.J.; Cho, Y.J.; Chun, B.S. Modifications of Atlantic salmon by-product oil for obtaining different w-3 polyunsaturated fatty acids concentrates: An approach to comparative analysis. Food Drug Anal. 2018, 26, 545–556. [Google Scholar] [CrossRef] [PubMed]
- Ceppa, F.; Faccenda, F.; De Filippo, C.; Albanese, D.; Pindo, M.; Martelli, R.; Marconi, P.; Lunelli, F.; Fava, F.; Parisi, G. Influence of essential oils in diet and life-stage on gut microbiota and fillet quality of rainbow trout (Oncorhynchus mykiss). Int. J. Food Sci. Nutr. 2018, 69, 318–333. [Google Scholar] [CrossRef]
- Cawthorn, D.M.; Steinman, H.A.; Wittthuhn, R.C. DNA barcoding reveals a high incidence of fish species misrepresentation and substitution on the South African market. Food Res. Int. 2012, 46, 30–40. [Google Scholar] [CrossRef]
- Horreo, J.L.; Fitze, P.S.; Jimenez-Valverde, A.; Noriega, J.A.; Pelaez, M.L. Amplification of 16S rDNA reveals important fish mislabeling in Madrid restaurants. Food Control 2019, 96, 146–150. [Google Scholar] [CrossRef]
- Gizaw, Z. Public health risks related to food safety issues in the food market: A systematic literature review. Environ. Health Prev. Med. 2019, 24, 68. [Google Scholar] [CrossRef] [PubMed]
- Sousa, N.; Moreira, M.J.; Saraiva, C.; De Almeida, J.M.M.M. Applying fourier transform mid infrared spectroscopy to detect the adulteration of Salmo salar with Oncorhynchus mykiss. Foods 2018, 7, 55. [Google Scholar] [CrossRef]
- Chai, Z.; Wang, C.; Bi, H. Rapid identification between two fish species using UV-Vis spectroscopy for substitution detection. Molecules 2021, 26, 6529. [Google Scholar] [CrossRef]
- Chen, Z.; Wu, T.; Xiang, C.; Xu, X.; Tian, X. Rapid identification of rainbow trout adulteration in Atlantic salmon by Raman spectroscopy combined with machine learning. Molecules 2019, 24, 2851. [Google Scholar] [CrossRef]
- Li, Q.; Xue, H.; Fei, Y.; Cao, M.; Xiong, X.; Xiong, X.; Yang, Y.; Wang, L. Visual detection of rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar) simultaneously by duplex loop-mediated isothermal amplification. Food Chem. 2022, 4, 100107. [Google Scholar] [CrossRef]
- Gorini, T.; Mezzasalma, V.; Deligia, M.; De Mattia, F.; Campone, L.; Labra, M.; Frigerio, J. Check your shopping cart: DNA barcoding and mini-barcoding for food authentication. Foods 2023, 12, 2392. [Google Scholar] [CrossRef]
- Chen, C.; Ding, Y.; Wang, Y.; Jiang, Q.; Wang, F.; Lu, C.; Zhang, L.; Zhu, C. High-resolution melting analysis of COI sequences distinguishes pufferfish species (Takifugu spp.) in China. J. Agric. Food. Chem. 2021, 69, 794–804. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.M.; Lee, S.; Kim, H.Y. A multiplex PCR assay combined with capillary electrophoresis for the simultaneous identification of Atlantic cod, Pacific cod, blue whiting, haddock, and Alaska pollock. Foods 2021, 10, 2631. [Google Scholar] [CrossRef] [PubMed]
- Yao, L.; Xin, H.; Qu, M.; Jiang, Y.; Guo, Y.; Li, F.; Li, N.; Tan, Z.; Wang, L. Development of duplex real-time polymerase chain reaction for simultaneous detection of oilfish- and escolar-derived components. J. Sci. Food Agric. 2021, 101, 1792–1799. [Google Scholar] [CrossRef]
- Silva, A.J.; Hellberg, R.S. DNA-based techniques for seafood species authentication. Adv. Food Nutr. Res. 2021, 95, 207–255. [Google Scholar]
- Hird, H.J.; Chisholm, J.; Kaye, J.; Colyer, A.; Hold, G.; Conyers, C.M.; Núñez, J.I.; Macarthur, R. Development of real-time PCR assays for the detection of Atlantic cod (Gadus morhua), Atlantic salmon (Salmo salar) and European plaice (Pleuronectes platessa) in complex food samples. Eur. Food Res. Technol. 2012, 234, 127–136. [Google Scholar] [CrossRef]
- Bojolly, D.; Doyen, P.; Le Fur, B.; Christaki, U.; Verrez-Bagnis, V.; Grard, T. Development of a qPCR method for the identification and quantification of two closely related tuna species, bigeye tuna (Thunnus obesus) and yellowfin tuna (Thunnus albacares), in canned tuna. J. Agric. Food Chem. 2017, 65, 913–920. [Google Scholar] [CrossRef] [PubMed]
- Kang, T.S.; Tanaka, T. Comparison of quantitative methods based on SYBR Green real-time qPCR to estimate pork meat adulteration in processed beef products. Food Chem. 2018, 269, 549–558. [Google Scholar] [CrossRef]
- Pinheiro, L.B.; Coleman, V.A.; Hindson, C.M.; Herrmann, J.; Hindson, B.J.; Bhat, S.; Emslie, K.R. Evaluation of a droplet digital polymerase chain reaction format for DNA copy number quantification. Anal. Chem. 2012, 84, 1003–1101. [Google Scholar] [CrossRef]
- Kanagal-Shamanna, R. Digital PCR: Principles and applications. Methods Mol. Biol. 2016, 1392, 43–50. [Google Scholar]
- Ampaporn, K.; Phasuk, Y.; Duangjinda, M. Droplet digital polymerase chain reaction assay for identifying and quantifying pork products. Anim. Sci. J. 2021, 92, e13595. [Google Scholar] [CrossRef] [PubMed]
- Shehata, H.R.; Li, J.; Chen, S.; Redda, H.; Cheng, S.; Tabujara, N.; Li, H.; Warriner, K.; Hanner, R. Droplet digital polymerase chain reaction (ddPCR) assays integrated with an internal control for quantification of bovine, porcine, chicken and turkey species in food and feed. PLoS ONE 2017, 12, e0182872. [Google Scholar] [CrossRef] [PubMed]
- Cao, W.; Li, Y.; Chen, X.; Chang, Y.; Li, L.; Shi, L.; Bai, W.; Ye, L. Species identification and quantification of silver pomfret using the droplet digital PCR assay. Food Chem. 2020, 302, 125331. [Google Scholar] [CrossRef]
- Köppel, R.; Ganeshan, A.; Weber, S.; Pietsch, K.; Graf, C.; Hochegger, R.; Griffiths, K.; Burkhardt, S. Duplex digital PCR for the determination of meat proportions of sausages containing meat from chicken, turkey, horse, cow, pig and sheep. Eur. Food Res. Technol. 2019, 245, 853–862. [Google Scholar] [CrossRef]
- Floren, C.; Wiedemann, I.; Brenig, B.; Schütz, E.; Beck, J. Species identification and quantification in meat and meat products using droplet digital PCR (ddPCR). Food Chem. 2015, 173, 1054–1058. [Google Scholar] [CrossRef]
- Wang, Q.; Cai, Y.C.; He, Y.P.; Yang, L.T.; Li, J.; Pan, L.W. Droplet digital PCR (ddPCR) method for the detection and quantification of goat and sheep derivatives in commercial meat products. Eur. Food Res. Technol. 2018, 244, 767–774. [Google Scholar] [CrossRef]
- Ren, J.N.; Deng, T.T.; Huang, W.S.; Chen, Y.; Ge, Y.Q. A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food. PLoS ONE 2017, 12, e0173567. [Google Scholar] [CrossRef]
- Huggett, J.F.; Foy, C.A.; Benes, V.; Emslie, K.; Garson, J.A.; Haynes, R.; Hellemans, J.; Kubista, M.; Mueller, R.D.; Nolan, T.; et al. The digital MIQE guidelines: Minimum information for publication of quantitative digital PCR experiments. Clin. Chem. 2013, 59, 892–902. [Google Scholar] [CrossRef]
- Tang, Q.Y.; Zhang, C.X. Data processing system (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research. Insect Sci. 2013, 20, 254–260. [Google Scholar] [CrossRef]
- Deconinck, D.; Hostens, K.; Taverniers, I.; Volckaert, F.A.M.; Robbens, J.; Derycke, S. Identification and semi-quantification of Atlantic salmon in processed and mixed seafood products using droplet digital PCR (ddPCR). Food Chem. Toxicol. 2021, 154, 112329. [Google Scholar] [CrossRef]
- Xu, H.L.; Ma, X.Y.; Ye, Z.H.; Yu, X.P.; Liu, G.F.; Wang, Z.L. A Droplet digital PCR based approach for identification and quantification of porcine and chicken derivatives in beef. Foods 2022, 11, 3265. [Google Scholar] [CrossRef] [PubMed]
- Xiang, W.J.; Shang, Y.; Wang, Q.; Xu, Y.C.; Zhu, P.Y.; Huang, K.L.; Xu, W.T. Identification of a chicken (Gallus gallus) endogenous reference gene (Actb) and its application in meat adulteration. Food Chem. 2017, 234, 472–478. [Google Scholar] [CrossRef]
- Cai, Y.C.; He, Y.P.; Lv, R.; Chen, H.C.; Wang, Q.; Pan, L.W. Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR. PLoS ONE 2017, 12, e0181949. [Google Scholar] [CrossRef] [PubMed]
- Noh, E.S.; Park, Y.J.; Kim, E.M.; Park, J.Y.; Shim, K.B.; Choi, T.J.; Kim, K.H.; Kang, J.H. Quantitative analysis of Alaska pollock in seafood products by droplet digital PCR. Food Chem. 2019, 275, 638–643. [Google Scholar] [CrossRef] [PubMed]
- Yu, N.; Ren, J.N.; Huang, W.S.; Xing, R.R.; Deng, T.T.; Chen, Y. An effective analytical droplet digital PCR approach for identification and quantification of fur-bearing animal meat in raw and processed food. Food Chem. 2021, 355, 129525. [Google Scholar] [CrossRef] [PubMed]
- Codex Committee on Methods of Analysis and Sampling. Guidelines on Performance Criteria and Validation of Methods for Detection, Identification and Quantification of Specific DNA Sequences and Specific Proteins in Foods; Codex Alimentarius-FAO: Rome, Italy, 2010. [Google Scholar]
- Deng, X.; Huang, H.Z.; Huang, S.J.; Yang, M.; Wu, J.; Ci, Z.M.; He, Y.A.; Wu, Z.F.; Han, L.; Zhang, D.K. Insight into the incredible effects of microwave heating: Driving changes in the structure, properties and functions of macromolecular nutrients in novel food. Front. Nutr. 2022, 9, 941527. [Google Scholar] [CrossRef] [PubMed]
- Ling, B.; Cheng, T.; Wang, S. Recent developments in applications of radio frequency heating for improving safety and quality of food grains and their products: A review. Crit. Rev. Food Sci. Nutr. 2020, 60, 2622–2642. [Google Scholar] [CrossRef]
- Teuteberg, V.; Kluth, I.K.; Ploetz, M.; Krischek, C. Effects of duration and temperature of frozen storage on the quality and food safety characteristics of pork after thawing and after storage under modified atmosphere. Meat Sci. 2021, 174, 108419. [Google Scholar] [CrossRef]
- Hird, H.; Chisholm, J.; Sanchez, A.; Hernandez, M.; Goodier, R.; Schneede, K.; Boltz, C.; Popping, B. Effect of heat and pressure processing on DNA fragmentation and implications for the detection of meat using a real-time polymerase chain reaction. Food Addit. Contam. 2006, 23, 645–650. [Google Scholar] [CrossRef]
- Wu, L.; Zhang, C.; Long, Y.; Chen, Q.; Zhang, W.; Liu, G. Food additives: From functions to analytical methods. Crit. Rev. Food Sci. Nutr. 2022, 62, 8497–8517. [Google Scholar] [CrossRef]
- Novais, C.; Molina, A.K.; Abreu, R.M.V.; Santo-Buelga, C.; Ferreira, I.C.F.R.; Pereira, C.; Barros, L. Natural food colorants and preservatives: A review, a demand, and a challenge. J. Agric. Food Chem. 2022, 70, 2789–2805. [Google Scholar] [CrossRef] [PubMed]
Species | Target Gene | GenBank Accession Number | Primer/Probe | Sequences (5′-3′) | Amplicon Length |
---|---|---|---|---|---|
Atlantic salmon | myoglobin | NM_001140642 | SS-F | GAGAGGTCACAGGGATAGGA | 93 bp |
SS-R | CAAACCAGCACTTAGAATTTAC | ||||
SS-P | HEX-AACTGGAAACTTACATTTGAAGCAG-BHQ1 | ||||
Rainbow trout | myoglobin | NM_001171862 | OM-F | TTGCTTGTGACTTCCAGA | 141 bp |
OM-R | AGAGGAACAACGCACATT | ||||
OM-P | FAM-ACTGGAAAAGTGTATGAGGCAAAGC-BHQ1 |
Mass Proportion, % | Rainbow Trout Test (n = 6), Copies/μL | Atlantic Salmon Test (n = 6), Copies/μL | K Value | K Mean | RSD a, % |
---|---|---|---|---|---|
10 | 94.00 ± 0.89 | 376.5 ± 2.88 | 0.44 | 0.43 | 3.02 |
30 | 101.23 ± 4.87 | 97.79 ± 1.68 | 0.41 | ||
50 | 121.30 ± 2.87 | 51.57 ± 1.51 | 0.43 | ||
70 | 183.50 ± 1.87 | 34.78 ± 0.86 | 0.44 | ||
90 | 226.50 ± 2.74 | 11.13 ± 0.77 | 0.44 |
Actual Value, % | Measured Value, % | RSD a, % | Deviation b, % | |||
---|---|---|---|---|---|---|
ddPCR | qPCR | ddPCR | qPCR | ddPCR | qPCR | |
20 | 20.79 ± 0.48 | 17.76 ± 1.75 | 2.29 | 9.85 | 3.96 | −11.18 |
40 | 41.32 ± 0.36 | 45.11 ± 3.10 | 0.87 | 6.88 | 3.30 | 12.77 |
60 | 58.65 ± 0.33 | 53.73 ± 2.73 | 0.56 | 5.08 | −2.25 | −10.46 |
80 | 79.52 ± 0.44 | 73.58 ± 3.28 | 0.55 | 4.46 | −0.60 | −8.02 |
Actual Value, % | Measured Value a, % | RSD b, % | Detection Rate c, % | Deviation d, % |
---|---|---|---|---|
0.05 | 0 | - | 0 | 100 |
0.1 | 0.15 ± 0.12 | 81.28 | 75.00 | 51.71 |
0.2 | 0.36 ± 0.08 | 22.78 | 100 | 81.89 |
0.5 | 0.37 ± 0.03 | 8.85 | 100 | −25.52 |
0.8 | 0.76 ± 0.06 | 6.36 | 100 | −4.52 |
1 | 1.15 ± 0.05 | 4.46 | 100 | 15.28 |
5 | 5.51 ± 0.31 | 5.71 | 100 | 10.10 |
Additives | Actual Value, % | Measured Value a, % | RSD b, % | Deviation c, % |
---|---|---|---|---|
Sodium glutamate | 70 | 68.23 ± 0.62 | 0.91 | −2.52 |
β-carotene | 70 | 71.34 ± 0.88 | 1.23 | 1.92 |
Carrageenan | 70 | 69.91 ± 0.23 | 0.34 | −2.99 |
Fish powder flavor | 70 | 69.04 ± 0.58 | 0.83 | −1.37 |
Sample | Processing Type | Declared Value of Rainbow Trout, % | Measured Value of Rainbow Trout, % | |
---|---|---|---|---|
ddPCR | qPCR | |||
Instant salmon_1 | Steamed | 0 | 0 | 0 |
Instant salmon_2 | Steamed | 0 | 0 | 0 |
Instant salmon_3 | Steamed | 0 | 0 | 0 |
Salmon sashimi_1 | Smoked | 0 | 0 | 0 |
Salmon sashimi_2 | Smoked | 0 | 0 | 0 |
Salmon sashimi_3 | Smoked | 0 | 0 | 0 |
Salmon sashimi_4 | Raw | 0 | 0 | 0 |
Salmon sashimi_5 | Raw | 0 | 100 | 100 |
Salmon fish ball_1 | Frozen | 0 | 0 | 0 |
Salmon fish ball_2 | Frozen | 0 | 62.50 ± 0.86 | 56.71 ± 2.00 |
Smoked salmon_1 | Smoked | 0 | 0 | 0 |
Smoked salmon_2 | Smoked | 0 | 0 | 0 |
Salmon fish sausage | Steamed | 0 | 0 | 0 |
Grilled salmon | Grilled | 0 | 0 | 0 |
Salmon fish floss | Steamed and dried | 0 | 89.14 ± 1.74 | 82.84 ± 6.47 |
Canned salmon | Canned | 0 | 0 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, X.-Y.; Shao, Z.-L.; Yu, X.-P.; Wang, Z.-L. A Droplet Digital PCR-Based Approach for Quantitative Analysis of the Adulteration of Atlantic Salmon with Rainbow Trout. Foods 2023, 12, 4309. https://doi.org/10.3390/foods12234309
Ma X-Y, Shao Z-L, Yu X-P, Wang Z-L. A Droplet Digital PCR-Based Approach for Quantitative Analysis of the Adulteration of Atlantic Salmon with Rainbow Trout. Foods. 2023; 12(23):4309. https://doi.org/10.3390/foods12234309
Chicago/Turabian StyleMa, Xiao-Yu, Zhu-Long Shao, Xiao-Ping Yu, and Zheng-Liang Wang. 2023. "A Droplet Digital PCR-Based Approach for Quantitative Analysis of the Adulteration of Atlantic Salmon with Rainbow Trout" Foods 12, no. 23: 4309. https://doi.org/10.3390/foods12234309