Prevalence of Foodborne Viruses in Berries Harvested in Canada
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Sample Processing Control
2.3. Virus Concentration and Nucleic Acid Extraction
2.4. Real-Time Reverse-Transcriptase PCR
2.5. Extraction Efficiency
2.6. Confirmation of the Presence of Virus
2.6.1. Propidium Monoazide
2.6.2. Endpoint PCR and Sequencing
2.7. Statistical Analysis
3. Results
3.1. Prevalence of HuNoV Genotypes I and II and HAV in Cranberries
3.2. HuNoV GI Sequence Analysis and Genotyping
3.3. Prevalence of HEV in Blueberries
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Government of Canada. Yearly food-borne illness estimates for Canada. 2016. Available online: https://www.canada.ca/en/public-health/services/food-borne-illness-canada/yearly-food-borne-illness-estimates-canada.html (accessed on 5 July 2016).
- Cook, N.; Knight, A.; Richards, G.P. Persistence and Elimination of Human Norovirus in Food and on Food Contact Surfaces: A Critical Review. J. Food Prot. 2016, 79, 1273–1294. [Google Scholar] [CrossRef]
- Kauppinen, A.; Miettinen, I.T. Persistence of Norovirus GII Genome in Drinking Water and Wastewater at Different Temperatures. Pathogens 2017, 6, 48. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, S.M.; Hall, A.J.; Robinson, A.E.; Verhoef, L.; Premkumar, P.; Parashar, U.D.; Koopmans, M.; Lopman, B.A. Global prevalence of norovirus in cases of gastroenteritis: A systematic review and meta-analysis. Lancet Infect. Dis. 2014, 14, 725–730. [Google Scholar] [CrossRef]
- Villabruna, N.; Lara, R.W.I.; Szarvas, J.; Koopmans, M.P.G.; De Graaf, M. Phylogenetic Investigation of Norovirus Transmission between Humans and Animals. Viruses 2020, 12, 1287. [Google Scholar] [CrossRef]
- Pintó, R.M.; Pérez-Rodríguez, F.-J.; Costafreda, M.-I.; Chavarria-Miró, G.; Guix, S.; Ribes, E.; Bosch, A. Pathogenicity and virulence of hepatitis A virus. Virulence 2021, 12, 1174–1185. [Google Scholar] [CrossRef] [PubMed]
- Hazards, E.P.o.B. Scientific Opinion on an update on the present knowledge on the occurrence and control of foodborne viruses. EFSA J. 2011, 9, 2190. [Google Scholar] [CrossRef]
- Agriculture and Agri-Food Canada. Crop Profile for Cranberry in Canada, 2019; Agriculture and Agri-Food Canada: Ottawa, ON, Canada, 2021. [Google Scholar]
- APCQ. Growing Cranberries. 2022. Available online: http://www.notrecanneberge.com/Content/SubPage/Cranberries/Growing-Cranberries/Seasonal-Work (accessed on 28 October 2022).
- Fruit d’Or. Everything You Need to Know About Organic Cranberry Cultivation. n.d. Available online: https://fruitdor.ca/en/blog/cranberry-cultivation/ (accessed on 16 November 2022).
- Fruit d’Or. The Cranberry Harvest Process in Quebec. n.d. Available online: https://fruitdor.ca/en/blog/cranberry-harvest/ (accessed on 16 November 2022).
- Wang, B.; Meng, X.-J. Hepatitis E virus: Host tropism and zoonotic infection. Curr. Opin. Microbiol. 2021, 59, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Maunula, L.; Kaupke, A.; Vasickova, P.; Söderberg, K.; Kozyra, I.; Lazic, S.; van der Poel, W.H.; Bouwknegt, M.; Rutjes, S.; Willems, K.A.; et al. Tracing enteric viruses in the European berry fruit supply chain. Int. J. Food Microbiol. 2013, 167, 177–185. [Google Scholar] [CrossRef] [PubMed]
- Terio, V.; Bottaro, M.; Pavoni, E.; Losio, M.; Serraino, A.; Giacometti, F.; Martella, V.; Mottola, A.; Di Pinto, A.; Tantillo, G. Occurrence of hepatitis A and E and norovirus GI and GII in ready-to-eat vegetables in Italy. Int. J. Food Microbiol. 2017, 249, 61–65. [Google Scholar] [CrossRef]
- Weger, S.; Elkin, B.; Lindsay, R.; Bollinger, T.; Crichton, V.; Andonov, A. Hepatitis E Virus Seroprevalence in Free-Ranging Deer in Canada. Transbound. Emerg. Dis. 2017, 64, 1008–1011. [Google Scholar] [CrossRef]
- Kokkinos, P.; Kozyra, I.; Lazic, S.; Bouwknegt, M.; Rutjes, S.; Willems, K.A.; Moloney, R.; Husman, A.M.D.R.; Kaupke, A.; Legaki, E.; et al. Harmonised Investigation of the Occurrence of Human Enteric Viruses in the Leafy Green Vegetable Supply Chain in Three European Countries. Food Environ. Virol. 2012, 4, 179–191. [Google Scholar] [CrossRef] [PubMed]
- Laidler, M.R.; Tourdjman, M.; Buser, G.L.; Hostetler, T.; Repp, K.K.; Leman, R.; Samadpour, M.; Keene, W.E. Escherichia coli O157:H7 Infections Associated With Consumption of Locally Grown Strawberries Contaminated by Deer. Clin. Infect. Dis. 2013, 57, 1129–1134. [Google Scholar] [CrossRef] [PubMed]
- Steele, M.; Lambert, D.; Bissonnette, R.; Yamamoto, E.; Hardie, K.; Locas, A. Norovirus GI and GII and hepatitis a virus in berries and pomegranate arils in Canada. Int. J. Food Microbiol. 2022, 379, 109840. [Google Scholar] [CrossRef] [PubMed]
- Baert, L.; Mattison, K.; Loisy-Hamon, F.; Harlow, J.; Martyres, A.; Lebeau, B.; Stals, A.; Van Coillie, E.; Herman, L.; Uyttendaele, M. Review: Norovirus prevalence in Belgian, Canadian and French fresh produce: A threat to human health? Int. J. Food Microbiol. 2011, 151, 261–269. [Google Scholar] [CrossRef]
- ISO 15216-1: 2017; Anonymous, Microbiology of the food chain—Horizontal method for determination of hepatitis A virus and norovirus using real-time RT-PCR—Part 1: Method for quantification. International Organization for Standardization: Geneva, Switzerland, 2017.
- MAPAQ, Sector Profile of the Horticultural Industry in Quebec. 2022. Available online: https://statistique.quebec.ca/fr/document/profil-sectoriel-de-lindustrie-horticole-au-quebec (accessed on 13 January 2023).
- Biomérieux. Ceeramtools Mengovirus Kit. 2023. Available online: https://biomerieuxdirect.com/industry/c/ceeramtools-mengovirus-kit/p/kmg (accessed on 17 January 2023).
- Trudel-Ferland, M.; Jubinville, E.; Jean, J. Persistence of Hepatitis A Virus RNA in Water, on Non-porous Surfaces, and on Blueberries. Front. Microbiol. 2021, 12, 618352. [Google Scholar] [CrossRef]
- Martin-Latil, S.; Hennechart-Collette, C.; Delannoy, S.; Guillier, L.; Fach, P.; Perelle, S. Quantification of Hepatitis E Virus in Naturally-Contaminated Pig Liver Products. Front. Microbiol. 2016, 7, 1183. [Google Scholar] [CrossRef]
- Germer, J.J.; Ankoudinova, I.; Belousov, Y.S.; Mahoney, W.; Dong, C.; Meng, J.; Mandrekar, J.N.; Yao, J.D. Hepatitis E Virus (HEV) Detection and Quantification by a Real-Time Reverse Transcription-PCR Assay Calibrated to the World Health Organization Standard for HEV RNA. J. Clin. Microbiol. 2017, 55, 1478–1487. [Google Scholar] [CrossRef]
- Pintó, R.M.; Costafreda, M.I.; Bosch, A. Risk Assessment in Shellfish-Borne Outbreaks of Hepatitis A. Appl. Environ. Microbiol. 2009, 75, 7350–7355. [Google Scholar] [CrossRef]
- Da Silva, A.K.; Le Saux, J.-C.; Parnaudeau, S.; Pommepuy, M.; Elimelech, M.; Le Guyader, F.S. Evaluation of Removal of Noroviruses during Wastewater Treatment, Using Real-Time Reverse Transcription-PCR: Different Behaviors of Genogroups I and II. Appl. Environ. Microbiol. 2007, 73, 7891–7897. [Google Scholar] [CrossRef]
- Svraka, S.; Duizer, E.; Vennema, H.; de Bruin, E.; van der Veer, B.; Dorresteijn, B.; Koopmans, M. Etiological Role of Viruses in Outbreaks of Acute Gastroenteritis in The Netherlands from 1994 through 2005. J. Clin. Microbiol. 2007, 45, 1389–1394. [Google Scholar] [CrossRef] [Green Version]
- Loisy, F.; Atmar, R.; Guillon, P.; Le Cann, P.; Pommepuy, M.; Le Guyader, F. Real-time RT-PCR for norovirus screening in shellfish. J. Virol. Methods 2005, 123, 1–7. [Google Scholar] [CrossRef]
- Kageyama, T.; Kojima, S.; Shinohara, M.; Uchida, K.; Fukushi, S.; Hoshino, F.B.; Takeda, N.; Katayama, K. Broadly Reactive and Highly Sensitive Assay for Norwalk-Like Viruses Based on Real-Time Quantitative Reverse Transcription-PCR. J. Clin. Microbiol. 2003, 41, 1548–1557. [Google Scholar] [CrossRef]
- Costafreda, M.I.; Bosch, A.; Pintó, R.M. Development, Evaluation, and Standardization of a Real-Time TaqMan Reverse Transcription-PCR Assay for Quantification of Hepatitis A Virus in Clinical and Shellfish Samples. Appl. Environ. Microbiol. 2006, 72, 3846–3855. [Google Scholar] [CrossRef]
- Fongaro, G.; Hernández, M.; García-González, M.C.; Barardi, C.R.M.; Rodríguez-Lázaro, D. Propidium Monoazide Coupled with PCR Predicts Infectivity of Enteric Viruses in Swine Manure and Biofertilized Soil. Food Environ. Virol. 2016, 8, 79–85. [Google Scholar] [CrossRef]
- IBIS. Genomic Analysis Platform. 2022. Available online: https://www.ibis.ulaval.ca/en/services-2/genomic-analysis-platform/ (accessed on 28 October 2022).
- Kojima, S.; Kageyama, T.; Fukushi, S.; Hoshino, F.B.; Shinohara, M.; Uchida, K.; Natori, K.; Takeda, N.; Katayama, K. Genogroup-specific PCR primers for detection of Norwalk-like viruses. J. Virol. Methods 2002, 100, 107–114. [Google Scholar] [CrossRef] [PubMed]
- Karim, M.R.; Fout, G.S.; Johnson, C.H.; White, K.M.; Parshionikar, S.U. Propidium monoazide reverse transcriptase PCR and RT-qPCR for detecting infectious enterovirus and norovirus. J. Virol. Methods 2015, 219, 51–61. [Google Scholar] [CrossRef] [PubMed]
- Government of Canada. Use of Cholrinated Wash Water; Government of Canada: Ottawa, ON, Canada, 2018. [Google Scholar]
- Zoellner, C.; Aguayo-Acosta, A.; Wasim Siddiqui, M.; Dávila-Aviña, J.E. Chapter 2-Peracetic Acid in Disinfection of Fruits and Vegetables. In Postharvest Disinfection of Fruits and Vegetables, Siddiqui, M.W., Eds; Academic Press: Cambridge, MA, USA, 2018; pp. 53–66. [Google Scholar]
- 38. Government of Quebec. In Guidelines and Standards for the Interpretation of Analytical Results in Food Microbiology; Government of Quebec: Quebec, Canada, 2019; p. 58.
- Yeargin, T.; E Gibson, K. Key characteristics of foods with an elevated risk for viral enteropathogen contamination. J. Appl. Microbiol. 2019, 126, 996–1010. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control and Prevention. National Outbreak Reporting System (NORS). 2022. Available online: https://wwwn.cdc.gov/norsdashboard/ (accessed on 2 April 2022).
- Bozkurt, H.; Phan-Thien, K.-Y.; Van Ogtrop, F.; Bell, T.; McConchie, R. Outbreaks, occurrence, and control of norovirus and hepatitis a virus contamination in berries: A review. Crit. Rev. Food Sci. Nutr. 2021, 61, 116–138. [Google Scholar] [CrossRef]
- FDA. Microbiological Surveillance Sampling: FY 19-22 Frozen Berries (Strawberries, Raspberries and Blackberries). 2022. Available online: https://www.fda.gov/food/sampling-protect-food-supply/microbiological-surveillance-sampling-fy-19-22-frozen-berries-strawberries-raspberries-and (accessed on 16 November 2022).
- Oteiza, J.M.; Prez, V.E.; Pereyra, D.; Jaureguiberry, M.V.; Sánchez, G.; Sant’Ana, A.S.; Barril, P.A. Occurrence of Norovirus, Rotavirus, Hepatitis a Virus, and Enterovirus in Berries in Argentina. Food Environ. Virol. 2022, 14, 170–177. [Google Scholar] [CrossRef]
- Purpari, G.; Macaluso, G.; Di Bella, S.; Gucciardi, F.; Mira, F.; Di Marco, P.; Lastra, A.; Petersen, E.; La Rosa, G.; Guercio, A. Molecular characterization of human enteric viruses in food, water samples, and surface swabs in Sicily. Int. J. Infect. Dis. 2019, 80, 66–72. [Google Scholar] [CrossRef] [Green Version]
- Government of Canada. 2014-2016 Viruses in Fresh Berries and Frozen Fruits. 2017. Available online: https://inspection.canada.ca/food-safety-for-industry/food-chemistry-and-microbiology/food-safety-testing-bulletin-and-reports/viruses-in-fresh-berries-and-frozen-fruits/eng/1506954705347/1506954705706 (accessed on 16 November 2022).
- Gao, X.; Wang, Z.; Wang, Y.; Liu, Z.; Guan, X.; Ma, Y.; Zhou, H.; Jiang, Y.; Cui, W.; Wang, L.; et al. Surveillance of norovirus contamination in commercial fresh/frozen berries from Heilongjiang Province, China, using a TaqMan real-time RT-PCR assay. Food Microbiol. 2019, 82, 119–126. [Google Scholar] [CrossRef] [PubMed]
- Smith, C.R.; Kershaw, T.; Johnson, K.; Meghnath, K. An outbreak of hepatitis A in Canada: The use of a control bank to conduct a case-control study. Epidemiology Infect. 2019, 147, e300. [Google Scholar] [CrossRef] [PubMed]
- Kokkinos, P.; Kozyra, I.; Lazic, S.; Söderberg, K.; Vasickova, P.; Bouwknegt, M.; Rutjes, S.; Willems, K.A.; Moloney, R.; Husman, A.M.D.R.; et al. Virological Quality of Irrigation Water in Leafy Green Vegetables and Berry Fruits Production Chains. Food Environ. Virol. 2017, 9, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Vimont, A.; Fliss, I.; Jean, J. Study of the Virucidal Potential of Organic Peroxyacids Against Norovirus on Food-Contact Surfaces. Food Environ. Virol. 2015, 7, 49–57. [Google Scholar] [CrossRef]
- Thiry, D.; Mauroy, A.; Saegerman, C.; Licoppe, A.; Fett, T.; Thomas, I.; Brochier, B.; Thiry, E.; Linden, A. Belgian Wildlife as Potential Zoonotic Reservoir of Hepatitis E Virus. Transbound. Emerg. Dis. 2017, 64, 764–773. [Google Scholar] [CrossRef]
- Palombieri, A.; Robetto, S.; Di Profio, F.; Sarchese, V.; Fruci, P.; Bona, M.C.; Ru, G.; Orusa, R.; Marsilio, F.; Martella, V.; et al. Surveillance Study of Hepatitis E Virus (HEV) in Domestic and Wild Ruminants in Northwestern Italy. Animals 2020, 10, 2351. [Google Scholar] [CrossRef]
- Government of Quebec. Culture Du Bleuet. 2022. Available online: https://www.quebec.ca/agriculture-environnement-et-ressources-naturelles/agriculture/industrie-agricole-au-quebec/productions-agricoles/culture-bleuet (accessed on 1 December 2022).
- Randazzo, W.; Vásquez-García, A.; Bracho, M.A.; Alcaraz, M.J.; Aznar, R.; Sánchez, G. Hepatitis E virus in lettuce and water samples: A method-comparison study. Int. J. Food Microbiol. 2018, 277, 34–40. [Google Scholar] [CrossRef]
- Li, P.; Ji, Y.; Li, Y.; Ma, Z.; Pan, Q. Estimating the global prevalence of hepatitis E virus in swine and pork products. One Heal. 2022, 14, 100362. [Google Scholar] [CrossRef]
- Yoo, D.; Willson, P.; Pei, Y.; Hayes, M.A.; Deckert, A.; Dewey, C.E.; Friendship, R.M.; Yoon, Y.; Gottschalk, M.; Yason, C.; et al. Prevalence of Hepatitis E Virus Antibodies in Canadian Swine Herds and Identification of a Novel Variant of Swine Hepatitis E Virus. Clin. Diagn. Lab. Immunol. 2001, 8, 1213–1219. [Google Scholar] [CrossRef]
- Bartsch, C.; Szabo, K.; Dinh-Thanh, M.; Schrader, C.; Trojnar, E.; Johne, R. Comparison and optimization of detection methods for noroviruses in frozen strawberries containing different amounts of RT-PCR inhibitors. Food Microbiol. 2016, 60, 124–130. [Google Scholar] [CrossRef] [Green Version]
- Lowther, J.; Bosch, A.; Butot, S.; Ollivier, J.; Mäde, D.; Rutjes, S.; Hardouin, G.; Lombard, B.; Veld, P.I.; Leclercq, A. Validation of EN ISO method 15216-Part 1-Quantification of hepatitis A virus and norovirus in food matrices. Int. J. Food Microbiol. 2019, 288, 82–90. [Google Scholar] [CrossRef] [PubMed]
Target | Sequence | References |
---|---|---|
Mengo Virus | ||
Forward primer | GCGGGTCCTGCCGAAAGT | [26] |
Reverse primer | GAAGTAACATATAGACAGACGCACAC | [26] |
Probe | 6FAM-ATCACATTACTGGCCGAAGC-MGBNFQ | [26] |
HuNoV GI | ||
Forward primer | CGCTGGATGCGNTTCCAT | [27] |
Reverse primer | CCTTAGACGCCATCATCATTTAC | [28] |
Probe | 6FAM-TGGACAGGAGAYCGCRATCT-TAMRA | [28] |
HuNoV GII | ||
Forward primer | ATGTTCAGRTGGATGAGRTTCTCWGA | [29] |
Reverse primer | TCGACGCCATCTTCATTCACA | [30] |
Probe | 6FAM-AGCACGTGGGAGGGCGATCG-TAMRA | [29] |
HAV | ||
Forward primer | TCACCGCCGTTTGCCTAG | [31] |
Reverse primer | GGAGAGCCCTGGAAGAAAG | [31] |
Probe | 6FAM-CCTGAACCTGCAGGAATTAA-MGBNFQ | [31] |
HEV | ||
Forward primer | CGGTGGTTTCTGGGGTGAC | [24] |
Reverse primer | AAGGGGTTGGTTGGATGAATATAG | [24] |
Probe | 6FAM-TGATTCTCAGCCCTTCG-MGBNFQ | [25] |
Total No. of Samples | Virus | No. of Positive Samples | Mengo Virus Recovery (%) | Recovery Standard Deviation (%) |
---|---|---|---|---|
234 | HuNoV GI HuNoV GI IHAV | 3 (1.28%, 95% CI 0.27–3.70%) 0 (95% CI 0.00–1.56%) 0 (95% CI 0.00–1.56%) | 28.7 | 1.2–86.9 |
Date of Harvest | Viral RNA Detected | 1st RT-qPCR | 2nd RT-qPCR | |||
---|---|---|---|---|---|---|
Undiluted | Diluted | Mengo Virus Recovery (%) | Undiluted | Diluted | ||
5 October 2021 6 October 2021 10 October 2021 | HuNoV GI HuNoV GI HuNoV GI | 3.6 * (1/2) ** (0/2) ** (0/2) ** | (0/2) ** 7.4 * (1/2) ** 5.3 * (1/2) ** | 35.2 22.3 21.3 | (0/3) ** 39.5 *** (1/3) ** 4.8 * (1/3) ** | 53.6 * (1/3) ** 39.5 *** (1/3) ** (0/3) ** |
Total No. of Samples | No. of HEV-Positive Samples | Mengo Virus Recovery (%) | Recovery Standard Deviation (%) |
---|---|---|---|
150 | 0 (95% CI 0.00–2.43%) | 35.6 | 17.0–54.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chatonnat, E.; Manseau-Ferland, K.; Jubinville, E.; Goulet-Beaulieu, V.; Jean, J. Prevalence of Foodborne Viruses in Berries Harvested in Canada. Foods 2023, 12, 723. https://doi.org/10.3390/foods12040723
Chatonnat E, Manseau-Ferland K, Jubinville E, Goulet-Beaulieu V, Jean J. Prevalence of Foodborne Viruses in Berries Harvested in Canada. Foods. 2023; 12(4):723. https://doi.org/10.3390/foods12040723
Chicago/Turabian StyleChatonnat, Eva, Kim Manseau-Ferland, Eric Jubinville, Valérie Goulet-Beaulieu, and Julie Jean. 2023. "Prevalence of Foodborne Viruses in Berries Harvested in Canada" Foods 12, no. 4: 723. https://doi.org/10.3390/foods12040723