An Authentication Survey on Retail Seafood Products Sold on the Bulgarian Market Underlines the Need for Upgrading the Traceability System
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples Collection: Sampling Strategy and Products Variety
2.2. DNA Extraction, Molecular Target Selection, Amplification, and Sequencing
2.3. Sequences Analysis and Molecular Identification
2.4. Assessment of Products Labeling Compliance and Mislabeling Rate
3. Results and Discussion
3.1. Distribution of Product Variety Resulting from Sampling
3.2. Molecular Identification and Its Limitations
3.2.1. Low Target Barcode Resolution
3.2.2. Reference Sequences’ Unreliability and Absence
3.3. Assessment of Products Labeling Compliance and Mislabeling Rate
3.3.1. Labeling Compliance to Regulation (EU) No. 1379/2013
3.3.2. Mislabeling Rate and Products Origin
3.3.3. Adherence of Labeled Designation to Official Designations Accepted in the National Territory
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2022; FAO: Rome, Italy, 2022; ISBN 978–92–5–136364–5. [Google Scholar]
- European Commission. Directorate General for Maritime Affairs and Fisheries. The EU Fish Market, 2022nd ed.; EU Publications Office: Luxembourg City, Luxembourg, 2022. [Google Scholar]
- Issifu, I.; Deffor, E.W.; Deyshappriya, N.P.R.; Dahmouni, I.; Sumaila, U.R. Drivers of Seafood Consumption at Different Geographical Scales. J. Sustain. Res. 2022, 4, e220012. [Google Scholar] [CrossRef]
- MZHG. Agraren Doklad 2020. Available online: https://www.mzh.government.bg/media/filer_public/2020/12/03/agd_2020_web.pdf (accessed on 19 January 2023).
- Eurobarometer 2271/SP515 EU Consumer Habits Regarding Fishery and Aquaculture Products. Available online: https://europa.eu/eurobarometer/surveys/detail/2271 (accessed on 19 January 2023).
- Stancheva, M. A Survey on Fish Consumption in Bulgaria. In Proceedings of the Пoљoпривреда—Збoрници COBISS.SR–ID 270329868, Belgrade–Zemun, Serbia, 22 November 2018; Faculty of Agriculture: Belgrade–Zemun, Serbia. [Google Scholar]
- Cantillo, J.; Martín, J.C.; Román, C. Determinants of Fishery and Aquaculture Products Consumption at Home in the EU28. Food Qual. Prefer. 2021, 88, 104085. [Google Scholar] [CrossRef]
- Todorov, A. Fish and Seafood Market Brief—Bulgaria; US Department of Agriculture (USDA): Washington, DC, USA, 2020. [Google Scholar]
- Tinacci, L.; Stratev, D.; Zhelyazkov, G.; Kyuchukova, R.; Strateva, M.; Nucera, D.; Armani, A. Nationwide Survey of the Bulgarian Market Highlights the Need to Update the Official Seafood List Based on Trade Inputs. Food Control 2020, 112, 107131. [Google Scholar] [CrossRef]
- Everstine, K. Supply Chain Complexity and Economically Motivated Adulteration. In Food Protection and Security; Elsevier: Amsterdam, The Netherlands, 2017; pp. 1–14. ISBN 978–1–78242–251–8. [Google Scholar]
- Lawrence, S.; Elliott, C.; Huisman, W.; Dean, M.; van Ruth, S. The 11 Sins of Seafood: Assessing a Decade of Food Fraud Reports in the Global Supply Chain. Compr. Rev. Food Sci. Food Saf. 2022, 21, 3746–3769. [Google Scholar] [CrossRef]
- Giusti, A.; Malloggi, C.; Tinacci, L.; Nucera, D.; Armani, A. Mislabeling in Seafood Products Sold on the Italian Market: A Systematic Review and Meta–Analysis. Food Control 2023, 145, 109395. [Google Scholar] [CrossRef]
- Luque, G.M.; Donlan, C.J. The Characterization of Seafood Mislabeling: A Global Meta–Analysis. Biol. Conserv. 2019, 236, 556–570. [Google Scholar] [CrossRef]
- Regulation EC No. 178/2002 Regulation (EC) No 178/2002 of the European Parliament and of the Council of 28 January 2002 Laying down the General Principles and Requirements of Food Law, Establishing the European Food Safety Authority and Laying down Procedures in Matters of Food Safety. Off. J. Eur. Communities 2002, L31, 1–24.
- Regulation EU No. 1169/2011 Regulation (EU) No 1169/2011 of the European Parliament and of the Council of 25 October 2011 on the Provision of Food Information to Consumers, Amending Regulations (EC) No 1924/2006 and (EC) No 1925/2006 of the European Parliament and of the Council, and Repealing Commission Directive 87/250/EEC, Council Directive 90/496/EEC, Commission Directive 1999/10/EC, Directive 2000/13/EC of the European Parliament and of the Council, Commission Directives 2002/67/EC and 2008/5/EC and Commission Regulation (EC) No 608/2004 Text with EEA Relevance. Off. J. Eur. Union 2011, L304, 18–63.
- Regulation EU No. 1379/2013 Regulation (EU) No 1379/2013 of the European Parliament and of the Council of 11 December 2013 on the Common Organisation of the Markets in Fishery and Aquaculture Products, Amending Council Regulations (EC) No 1184/2006 and (EC) No 1224/2009 and Repealing Council Regulation (EC) No 104/2000. Off. J. Eur. Union 2013, L354, 1–21.
- Regulation (EU) 2017/625 Regulation (EU) 2017/625 of the European Parliament and of the Council of 15 March 2017 on Official Controls and Other Official Activities Performed to Ensure the Application of Food and Feed Law, Rules on Animal Health and Welfare, Plant Health and Plant Protection Products. Off. J. Eur. Union 2017, L 95, 1–142.
- Fernandes, T.J.R.; Amaral, J.S.; Mafra, I. DNA Barcode Markers Applied to Seafood Authentication: An Updated Review. Crit. Rev. Food Sci. Nutr. 2021, 61, 3904–3935. [Google Scholar] [CrossRef]
- Silva, A.J.; Hellberg, R.S.; Hanner, R.H. Seafood Fraud. In Food Fraud; Elsevier: Amsterdam, The Netherlands, 2021; pp. 109–137. ISBN 978–0–12–817242–1. [Google Scholar]
- Silva, A.J.; Hellberg, R.S. DNA–Based Techniques for Seafood Species Authentication. In Advances in Food and Nutrition Research; Elsevier: Amsterdam, The Netherlands, 2021; Volume 95, pp. 207–255. ISBN 978–0–12–821520–3. [Google Scholar]
- Giusti, A.; Malloggi, C.; Tosi, F.; Boldini, P.; Larraín Barth, M.A.; Araneda, C.; Arcangeli, G.; Armani, A. Mislabeling Assessment and Species Identification by PCR–RFLP of Mussel–Based Products (Mytilus Spp.) Sold on the Italian Market. Food Control 2022, 134, 108692. [Google Scholar] [CrossRef]
- Tinacci, L.; Stratev, D.; Vashin, I.; Chiavaccini, I.; Susini, F.; Guidi, A.; Armani, A. Seafood Labelling Compliance with European Legislation and Species Identification by DNA Barcoding: A First Survey on the Bulgarian Market. Food Control 2018, 90, 180–188. [Google Scholar] [CrossRef]
- Tinacci, L.; Stratev, D.; Strateva, M.; Zhelyazkov, G.; Kyuchukova, R.; Armani, A. New Official Bulgarian List of Seafood Trade Names: Coping with EU Labelling Requirements and Market Trends to Enhance Consumers’ Informed Choice. J. Consum. Prot. Food Saf. 2022, 17, 395–406. [Google Scholar] [CrossRef]
- Bréchon, A.L.; Hanner, R.; Mariani, S. A Systematic Analysis across North Atlantic Countries Unveils Subtleties in Cod Product Labelling. Mar. Policy 2016, 69, 124–133. [Google Scholar] [CrossRef]
- Helyar, S.J.; Lloyd, H.D.; de Bruyn, M.; Leake, J.; Bennett, N.; Carvalho, G.R. Fish Product Mislabelling: Failings of Traceability in the Production Chain and Implications for Illegal, Unreported and Unregulated (IUU) Fishing. PLoS ONE 2014, 9, e98691. [Google Scholar] [CrossRef]
- Miller, D.; Jessel, A.; Mariani, S. Seafood Mislabelling: Comparisons of Two Western European Case Studies Assist in Defining Influencing Factors, Mechanisms and Motives: Cod Fraud: Mechanisms and Motives. Fish Fish. 2012, 13, 345–358. [Google Scholar] [CrossRef]
- Shehata, H.R.; Bourque, D.; Steinke, D.; Chen, S.; Hanner, R. Survey of Mislabelling across Finfish Supply Chain Reveals Mislabelling Both Outside and within Canada. Food Res. Int. 2019, 121, 723–729. [Google Scholar] [CrossRef]
- Janssen, R.; Knudsen, S.; Todorova, V.; Hoşgör, A.G. Managing Rapana in the Black Sea: Stakeholder Workshops on Both Sides. Ocean Coast. Manag. 2014, 87, 75–87. [Google Scholar] [CrossRef]
- Regulation EC 852/2004 Regulation (EC) No 852/2004 of the European Parliament and of the Council of 29 April 2004 on the Hygiene of Foodstuffs. Off. J. Eur. Union 2004, L139, 1–54.
- Armani, A.; Tinacci, L.; Xiong, X.; Titarenko, E.; Guidi, A.; Castigliego, L. Development of a Simple and Cost–Effective Bead–Milling Method for DNA Extraction from Fish Muscles. Food Anal. Methods 2014, 7, 946–955. [Google Scholar] [CrossRef]
- Tinacci, L.; Guidi, A.; Toto, A.; Guardone, L.; Giusti, A.; D’Amico, P.; Armani, A. DNA Barcoding for the Verification of Supplier’s Compliance in the Seafood Chain: How the Lab Can Support Companies in Ensuring Traceability. Ital. J. Food Saf. 2018, 7, 6894. [Google Scholar] [CrossRef]
- Handy, S.M.; Deeds, J.R.; Ivanova, N.V.; Hebert, P.D.N.; Hanner, R.H.; Ormos, A.; Weigt, L.A.; Moore, M.M.; Yancy, H.F. A Single–Laboratory Validated Method for the Generation of DNA Barcodes for the Identification of Fish for Regulatory Compliance. J. AOAC Int. 2011, 94, 201–210. [Google Scholar] [CrossRef]
- Mikkelsen, P.M.; Bieler, R.; Kappner, I.; Rawlings, T.A. Phylogeny of Veneroidea (Mollusca: Bivalvia) Based on Morphology and Molecules. Zool. J. Linn. Soc. 2006, 148, 439–521. [Google Scholar] [CrossRef]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
- Sevilla, R.G.; Diez, A.; Norén, M.; Mouchel, O.; Jérôme, M.; Verrez–Bagnis, V.; Van Pelt, H.; Favre–Krey, L.; Krey, G.; Consortium, T.F.; et al. Primers and Polymerase Chain Reaction Conditions for DNA Barcoding Teleost Fish Based on the Mitochondrial Cytochrome b and Nuclear Rhodopsin Genes. Mol. Ecol. Notes 2007, 7, 730–734. [Google Scholar] [CrossRef]
- Palumbi, S. Nucleic Acids II: The Polymerase Chain Reaction. In Molecular Systematics; Sinauer Associates, Inc.: Sunderland, MA, USA, 1996; pp. 205–247. ISBN 978–0–87893–282–5. [Google Scholar]
- Tsang, L.M.; Ma, K.Y.; Ahyong, S.T.; Chan, T.–Y.; Chu, K.H. Phylogeny of Decapoda Using Two Nuclear Protein–Coding Genes: Origin and Evolution of the Reptantia. Mol. Phylogenet. Evol. 2008, 48, 359–368. [Google Scholar] [CrossRef]
- Hall, T. BioEdit: A User–Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Pardo, M.Á.; Jiménez, E.; Viðarsson, J.R.; Ólafsson, K.; Ólafsdóttir, G.; Daníelsdóttir, A.K.; Pérez–Villareal, B. DNA Barcoding Revealing Mislabeling of Seafood in European Mass Caterings. Food Control 2018, 92, 7–16. [Google Scholar] [CrossRef]
- Armani, A.; Tinacci, L.; Xiong, X.; Castigliego, L.; Gianfaldoni, D.; Guidi, A. Fish Species Identification in Canned Pet Food by BLAST and Forensically Informative Nucleotide Sequencing (FINS) Analysis of Short Fragments of the Mitochondrial 16s Ribosomal RNA Gene (16S RRNA). Food Control 2015, 50, 821–830. [Google Scholar] [CrossRef]
- Armani, A.; Tinacci, L.; Lorenzetti, R.; Benvenuti, A.; Susini, F.; Gasperetti, L.; Ricci, E.; Guarducci, M.; Guidi, A. Is Raw Better? A Multiple DNA Barcoding Approach (Full and Mini) Based on Mitochondrial and Nuclear Markers Reveals Low Rates of Misdescription in Sushi Products Sold on the Italian Market. Food Control 2017, 79, 126–133. [Google Scholar] [CrossRef]
- Saitou, N.; Nei, M. The Neighbor–Joining Method: A New Method for Reconstructing Phylogenetic Trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
- Kimura, M. A Simple Method for Estimating Evolutionary Rates of Base Substitutions through Comparative Studies of Nucleotide Sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Ordinance No. 4 of 13.01.2006 Regulation no. 4 of January 13, 2006 on the conditions and procedures for the first sale of fish and other aquatic organisms. Off. SG 2006, 73–80.
- Ordinance No. 13 of 30.11.2021 Ordinance № 13 of 30 November 2021 of the Ministry of Agriculture and Forestry on the terms and conditions for the first sale of fishery products. Off. SG 2021, 22. Available online: https://dv.parliament.bg/DVWeb/showMaterialDV.jsp?idMat=165789 (accessed on 20 October 2022).
- Keskin, Ç.; Ulman, A.; Zylich, K.; Raykov, V.; Daskalov, G.M.; Pauly, D.; Zeller, D. The Marine Fisheries in Bulgaria’s Exclusive Economic Zone, 1950–2013. Front. Mar. Sci. 2017, 4, 53. [Google Scholar] [CrossRef]
- Vindigni, G.; Pulvirenti, A.; Alaimo, S.; Monaco, C.; Spina, D.; Peri, I. Bioinformatics Approach to Mitigate Mislabeling in EU Seafood Market and Protect Consumer Health. Int. J. Environ. Res. Public. Health 2021, 18, 7497. [Google Scholar] [CrossRef]
- Cawthorn, D.–M.; Duncan, J.; Kastern, C.; Francis, J.; Hoffman, L.C. Fish Species Substitution and Misnaming in South Africa: An Economic, Safety and Sustainability Conundrum Revisited. Food Chem. 2015, 185, 165–181. [Google Scholar] [CrossRef]
- Haldar, C.; Nath, S. DNA Barcoding for Fish Species Identification: Current Status and Future Prospective. Int. J. Fauna Biol. Stud. 2020, 7, 72–75. [Google Scholar]
- Blanco–Fernandez, C.; Garcia–Vazquez, E.; Machado–Schiaffino, G. Seventeen Years Analysing Mislabelling from DNA Barcodes: Towards Hake Sustainability. Food Control 2021, 123, 107723. [Google Scholar] [CrossRef]
- Ramirez, J.L.; Simbine, L.; Marques, C.G.; Zelada–Mázmela, E.; Reyes–Flores, L.E.; López, A.S.; Gusmão, J.; Tavares, C.; Galetti, P.M.; Freitas, P.D. DNA Barcoding of Penaeidae (Decapoda; Crustacea): Non–Distance–Based Species Delimitation of the Most Economically Important Shrimp Family. Diversity 2021, 13, 460. [Google Scholar] [CrossRef]
- Shen, Y.; Kang, J.; Chen, W.; He, S. DNA Barcoding for the Identification of Common Economic Aquatic Products in Central China and Its Application for the Supervision of the Market Trade. Food Control 2016, 61, 79–91. [Google Scholar] [CrossRef]
- Rajkumar, G.; Saravana Bhavan, P.; Udayasuriyan, R.; Vadivalagan, C. Molecular Identification of Shrimp Species, Penaeus Semisulcatus, Metapenaeus Dobsoni, Metapenaeus Brevicornis, Fenneropenaeus Indicus, Parapenaeopsis Stylifera and Solenocera Crassicornis Inhabiting in the Coromandel Coast (Tamil Nadu, India) Using MT–COI Gene. Int. J. Fish. Aquat. Stud. 2015, 2, 96–106. [Google Scholar]
- Hurzaid, A.; Chan, T.; Mohd Nor, S.A.; Muchlisin, Z.A.; Chen, W. Molecular Phylogeny and Diversity of Penaeid Shrimps (Crustacea: Decapoda) from South-East Asian Waters. Zool. Scr. 2020, zsc.12428. [Google Scholar] [CrossRef]
- Armani, A.; Guardone, L.; Castigliego, L.; D’Amico, P.; Messina, A.; Malandra, R.; Gianfaldoni, D.; Guidi, A. DNA and Mini–DNA Barcoding for the Identification of Porgies Species (Family Sparidae) of Commercial Interest on the International Market. Food Control 2015, 50, 589–596. [Google Scholar] [CrossRef]
- Leray, M.; Knowlton, N.; Ho, S.–L.; Nguyen, B.N.; Machida, R.J. GenBank Is a Reliable Resource for 21st Century Biodiversity Research. Proc. Natl. Acad. Sci. USA 2019, 116, 22651–22656. [Google Scholar] [CrossRef]
- Meiklejohn, K.A.; Damaso, N.; Robertson, J.M. Assessment of BOLD and GenBank—Their Accuracy and Reliability for the Identification of Biological Materials. PLoS ONE 2019, 14, e0217084. [Google Scholar] [CrossRef]
- Carlini, D.B.; Kunkle, L.K.; Vecchione, M. A Molecular Systematic Evaluation of the Squid Genus Illex (Cephalopoda: Ommastrephidae) in the North Atlantic Ocean and Mediterranean Sea. Mol. Phylogenet. Evol. 2006, 41, 496–502. [Google Scholar] [CrossRef]
- Kim, D.–W.; Yoo, W.G.; Park, H.C.; Yoo, H.S.; Kang, D.W.; Jin, S.D.; Min, H.K.; Paek, W.K.; Lim, J. DNA Barcoding of Fish, Insects, and Shellfish in Korea. Genomics Inform. 2012, 10, 206. [Google Scholar] [CrossRef]
- Claremont, M.; Vermeij, G.J.; Williams, S.T.; Reid, D.G. Global Phylogeny and New Classification of the Rapaninae (Gastropoda: Muricidae), Dominant Molluscan Predators on Tropical Rocky Seashores. Mol. Phylogenet. Evol. 2013, 66, 91–102. [Google Scholar] [CrossRef]
- Weigand, H.; Beermann, A.J.; Čiampor, F.; Costa, F.O.; Csabai, Z.; Duarte, S.; Geiger, M.F.; Grabowski, M.; Rimet, F.; Rulik, B.; et al. DNA Barcode Reference Libraries for the Monitoring of Aquatic Biota in Europe: Gap–Analysis and Recommendations for Future Work. Sci. Total Environ. 2019, 678, 499–524. [Google Scholar] [CrossRef]
- European Parliament Resolution No. 2016/2532 European Parliament Resolution of 12 May 2016 on Traceability of Fishery and Aquaculture Products in Restaurants and Retail (2016/2532(RSP)). Off. J. Eur. Union 2018, C76, 1–3.
- Fernandes, T.J.R.; Costa, J.; Oliveira, M.B.P.P.; Mafra, I. DNA Barcoding Coupled to HRM Analysis as a New and Simple Tool for the Authentication of Gadidae Fish Species. Food Chem. 2017, 230, 49–57. [Google Scholar] [CrossRef]
- Tinacci, L.; Guardone, L.; Castro–Palomino Rubio, J.; Riina, M.V.; Stratev, D.; Guidi, A.; Armani, A. Labelling Compliance and Species Identification of Herring Products Sold at Large Scale Retail Level within the Italian Market. Food Control 2019, 106, 106707. [Google Scholar] [CrossRef]
- Giusti, A.; Tinacci, L.; Sotelo, C.G.; Acutis, P.L.; Ielasi, N.; Armani, A. Authentication of Ready–to–Eat Anchovy Products Sold on the Italian Market by BLAST Analysis of a Highly Informative Cytochrome b Gene Fragment. Food Control 2019, 97, 50–57. [Google Scholar] [CrossRef]
- Mottola, A.; Piredda, R.; Catanese, G.; Lorusso, L.; Ciccarese, G.; Di Pinto, A. Species Authentication of Canned Mackerel: Challenges in Molecular Identification and Potential Drivers of Mislabelling. Food Control 2022, 137, 108880. [Google Scholar] [CrossRef]
- Minoudi, S.; Karaiskou, N.; Avgeris, M.; Gkagkavouzis, K.; Tarantili, P.; Triantafyllidou, D.; Palilis, L.; Avramopoulou, V.; Tsikliras, A.; Barmperis, K.; et al. Seafood Mislabeling in Greek Market Using DNA Barcoding. Food Control 2020, 113, 107213. [Google Scholar] [CrossRef]
- European Commission Fish Substitution. 2015. Available online: https://food.ec.europa.eu/safety/eu–agri–food–fraud–network/eu–coordinated–actions/fish–substitution_en (accessed on 19 January 2023).
- Manning, L.; Soon, J.M. Food Fraud Vulnerability Assessment: Reliable Data Sources and Effective Assessment Approaches. Trends Food Sci. Technol. 2019, 91, 159–168. [Google Scholar] [CrossRef]
- Robson, K.; Dean, M.; Haughey, S.; Elliott, C. A Comprehensive Review of Food Fraud Terminologies and Food Fraud Mitigation Guides. Food Control 2021, 120, 107516. [Google Scholar] [CrossRef]
- Barendse, J.; Roel, A.; Longo, C.; Andriessen, L.; Webster, L.M.I.; Ogden, R.; Neat, F. DNA Barcoding Validates Species Labelling of Certified Seafood. Curr. Biol. 2019, 29, R198–R199. [Google Scholar] [CrossRef]
- Christiansen, H.; Fournier, N.; Hellemans, B.; Volckaert, F.A.M. Seafood Substitution and Mislabeling in Brussels’ Restaurants and Canteens. Food Control 2018, 85, 66–75. [Google Scholar] [CrossRef]
- Feldmann, F.; Ardura, A.; Blanco–Fernandez, C.; Garcia–Vazquez, E. DNA Analysis Detects Different Mislabeling Trend by Country in European Cod Fillets. Foods 2021, 10, 1515. [Google Scholar] [CrossRef]
- Fox, M.; Mitchell, M.; Dean, M.; Elliott, C.; Campbell, K. The Seafood Supply Chain from a Fraudulent Perspective. Food Secur. 2018, 10, 939–963. [Google Scholar] [CrossRef]
- Fernández, S.; Rodríguez-Muñiz, L.J.; Molina, J.; Muñiz-Rodríguez, L.; Jiménez, J.; García-Vázquez, E.; Borrell, Y.J. Lab Experience with Seafood Control at the Undergraduate Level: Cephalopods as a Case Study. Biochem. Mol. Biol. Educ. 2020, 48, 236–246. [Google Scholar] [CrossRef]
- Wen, J.; Tinacci, L.; Acutis, P.L.; Riina, M.V.; Xu, Y.; Zeng, L.; Ying, X.; Chen, Z.; Guardone, L.; Chen, D.; et al. An Insight into the Chinese Traditional Seafood Market: Species Characterization of Cephalopod Products by DNA Barcoding and Phylogenetic Analysis Using COI and 16SrRNA Genes. Food Control 2017, 82, 333–342. [Google Scholar] [CrossRef]
- Espiñeira, M.; Vieites, J.M. Rapid Method for Controlling the Correct Labeling of Products Containing Common Octopus (Octopus vulgaris) and Main Substitute Species (Eledone cirrhosa and Dosidicus gigas) by Fast Real–Time PCR. Food Chem. 2012, 135, 2439–2444. [Google Scholar] [CrossRef]
- Shehata, H.R.; Naaum, A.M.; Garduño, R.A.; Hanner, R. DNA Barcoding as a Regulatory Tool for Seafood Authentication in Canada. Food Control 2018, 92, 147–153. [Google Scholar] [CrossRef]
- Fernandes, T.J.R.; Silva, C.R.; Costa, J.; Oliveira, M.B.P.P.; Mafra, I. High Resolution Melting Analysis of a COI Mini–Barcode as a New Approach for Penaeidae Shrimp Species Discrimination. Food Control 2017, 82, 8–17. [Google Scholar] [CrossRef]
- Sharma, L.; Watts, E.; Singh, P. High Resolution Real–Time PCR Melting Curve Assay for Identification of Top Five Penaeidae Shrimp Species. LWT 2020, 133, 109983. [Google Scholar] [CrossRef]
- Wilwet, L.; JeyaShakila, R.; Sivaraman, B.; Nayak, B.B.; Kumar, H.S.; Jaiswar, A.K.; Ratrey, V.P.; Jeyasekaran, G. In–House and on–Field Validation of the Multiplex PCR Assay Developed for Authentication of Three Commercially Important Shrimp Species. LWT 2021, 148, 111701. [Google Scholar] [CrossRef]
- Tinacci, L.; Giusti, A.; Guardone, L.; Luisi, E.; Armani, A. The New Italian Official List of Seafood Trade Names (Annex I of Ministerial Decree n. 19105 of September the 22nd, 2017): Strengths and Weaknesses in the Framework of the Current Complex Seafood Scenario. Food Control 2019, 96, 68–75. [Google Scholar] [CrossRef]



| Target Length | Taxonomical Class | Reference | Primer Sequences | Amplification Program |
|---|---|---|---|---|
| COI (Elective) 655–658 bp | WF | Handy et al. [32] | FISH_COILBC TCAACYAATCAYAAAGATATYGGCAC FISH_COIHBC ACTTCYGGGTGRCCRAARAATCA | 40 cycles: Denaturation 95 °C/30 s Annealing 55 °C/30 s Extension 72 °C/30 s |
| MB | Mikkelsen et al. [33] | COIF–ALT ACAAATCAYAARGAYATYGG COIR–ALT TTCAGGRTGNCCRAARAAYCA | 40 cycles: Denaturation 95 °C/30 s Annealing 47 °C/35 s Extension 72 °C/20 s | |
| MC MG C | Folmer et al. [34] | LCO1490 GGTCAACAAATCATAAAGATATTGG HC02198 TAAACTTCAGGGTGACCAAAAAATCA | 40 cycles: Denaturation 95 °C/30 s Annealing 51 °C/30 s Extension 72 °C/30 s | |
| cytb (additional) 1150 bp | WF | Sevilla et al. [35] | GLUFISH–F AACCACCGTTGTTATTCAACTACAA THR–Fish–R ACCTCCGATCTTCGGATTACAAGACC | 40 cycles: Denaturation 95 °C/30 s Annealing 57 °C/30 s Extension 72 °C/45 s |
| 16S rRNA (additional) ~550 bp | WF MB MC MG C | Palumbi [36] | 16Sar_L CGCCTGTTTATCAAAAACAT 16Sbr_H CCGGTCTGAACTCAGATCACGT | 40 cycles: Denaturation 95 °C/30 s Annealing 57 °C/15 s Extension 72 °C/15 s |
| PEPCK (additional) 595 bp | C | Tsang et al. [37] | PEPCK FOR2 GCAAGACCAACCTGGCCATGATGAC PEPCK REV3 CGGGYCTCCATGCTSAGCCARTG | 40 cycles: Denaturation 95 °C/30 s Annealing 59 °C/30 s Extension 72 °C/35 s |
| PAP RFLP protocol | MB (Mytilus sp. only) | Giusti et al. [21] | Me15m–F GTATACAAACCTGTGAAGACAAGT Me16m–R TGTTGTCTTAATAGGTTTGTAAGATG Aci–I enzymatic digestion | 40 cycles: Denaturation 95 °C/30 s Annealing 58 °C/30 s Extension 72 °C/30 s Incubation 37 °C/30 min Inactivation 65 °C/20 min |
| Taxonomical Class Substitution Rate Percentage | Test Target | Code | Product Type, Description | Declared Scientific Name (Real Distribution Area) * | Molecular Identification (Real Distribution Area) * |
|---|---|---|---|---|---|
| Whitefish (WF) N = 100 Substitution rate: 14% | Barcoding COI | WF3 | Unprocessed frozen, fillets | Gadus morhua (FAO 21–27) | Pollachius virens (FAO 21–27) |
| Barcoding COI | WF6 | Unprocessed frozen, fillets | Gadus morhua (FAO 21–27) | Pollachius virens | |
| Barcoding COI, cytb | WF15 | Unprocessed frozen, w/o head and eviscerated | Theragra chalcogramma (FAO 61–67) | Merluccius productus (FAO 67) | |
| Barcoding COI, cytb | WF16 | Unprocessed frozen, w/o head and eviscerated | Theragra chalcogramma (FAO 61–67) | Merluccius productus (FAO 67) | |
| Barcoding COI, cytb | WF17 | Unprocessed frozen, w/o head and eviscerated | Theragra chalcogramma (FAO 61–67) | Merluccius productus (FAO 67) | |
| Barcoding COI | WF19 | Unprocessed, frozen, fillets | Theragra chalcogramma (FAO 61–67) | Merluccius hubbsi (FAO 41) | |
| Barcoding COI | WF21 | Unprocessed, frozen, fillets | Theragra chalcogramma (FAO 61–67) | Merluccius hubbsi (FAO 41) | |
| Barcoding COI | WF25 | Unprocessed frozen, w/o head and eviscerated | Macruronus magellanicus (FAO 41–87) | Merluccius hubbsi (FAO 41) | |
| Barcoding COI | WF36 | Unprocessed, frozen, fillets | Gadus morhua (FAO 21–27) | Pollachius virens (FAO 21–27) | |
| Barcoding COI | WF39 | Unprocessed frozen, w/o head and eviscerated | Merluccius hubbsi (FAO 41) | Micromesistius australis (FAO 81) | |
| Barcoding COI | WF45 | Unprocessed frozen, w/o head and eviscerated | Merluccius productus (FAO 67) | Micromesistius australis (FAO 81) | |
| Barcoding COI | WF47 | Unprocessed, frozen, fillets | Theragra chalcogramma (FAO 61–67) | Merluccius hubbsi (FAO 41) | |
| Barcoding COI, cytb | WF79 | Processed frozen, breaded fillets | Theragra chalcogramma (FAO 61–67) | Merluccius gayi (FAO 87) | |
| Cephalopod Mollusks (MC) N = 40 Substitution rate: 10% | Barcoding COI | MC6 | Unprocessed frozen, whole peeled and eviscerated | Ommastrephes bartramii (Cosmopolitan) | Dosidicus gigas (FAO 77–87) |
| Barcoding COI | MC21 | Unprocessed frozen, sliced | Todarodes pacificus (FAO 61) | Dosidicus gigas (FAO 77–87) | |
| Barcoding COI | MC22 | Unprocessed frozen, whole peeled and eviscerated | Ommastrephes bartramii (Cosmopolitan) | Dosidicus gigas (FAO 77–87) | |
| Barcoding COI | MC40 | Unprocessed frozen, sliced | Nototodarus sloanii (FAO 81) | Todaropsis eblanae (cosmopolitan, no FAO 77–87) | |
| Bivalve Mollusks (MB) N = 16 Substitution rate: 12.5% | RFLP PAP | MB13 | Processed canned | Mytilus galloprovincialis (FAO 27–37–41–87) | Mytilus chilensis (FAO 41–87) |
| RFLP PAP | MB15 | Processed canned | Mytilus galloprovincialis (FAO 27–37–41–87) | Mytilus chilensis (FAO 41–87) | |
| Crustaceans (C) N = 38 Substitution rate: 7.9% | Barcoding COI, PEPCK | C10 | Unprocessed frozen, w/o head peeled | Solenocera Melantho (FAO 61–71–81) | Heterocarpus sp. (FAO51–57–61–71) |
| Barcoding COI | C31 | Processed frozen, w/o head peeled precooked | Metapenaeus sp (FAO 51–57) | Fenneropenaeus indicus (FAO 51–57) | |
| Barcoding COI | C36 | Unprocessed frozen, whole | Solenocera Melantho (FAO 61–71–81) | Plesionika quasigrandis (FAO 51–57) |
| Species Labeled | Ordinance No. 4 of 13.01.2006 | Ordinance No. 13 30.11.2021 |
|---|---|---|
| Theragra chalcogramma | no | no |
| Gadus morhua | yes | no |
| Merlangius merlangus euxinus | yes | yes |
| Pollachius virens | yes | no |
| Merluccius sp. | no | no |
| Merluccius hubbsi | no | no |
| Merluccius productus | no | no |
| Merluccius australis | no | no |
| Micromesistius australis | no | no |
| Macruronus magellanicus | no | no |
| Macruronus novaezelandiae | no | no |
| Macruronus australis | no | no |
| Alepocephalus bairdii | no | no |
| Litopenaeus vannamei | no | no |
| Penaeus monodon | no | no |
| Metapenaeus affinis | no | no |
| Metapenaeus sp. | no | no |
| Solenocera melantho | no | no |
| Pandalus borealis | yes | no |
| Nephrops norvegicus | yes | no |
| Dosidicus gigas | no | no |
| Ommastrephes bartramii | no | no |
| Illex argentinus | no | no |
| Todarodes pacificus | no | no |
| Nototodarus sloanii | no | no |
| Loligo gahi/patagonica | no | no |
| Octopus vulgaris | no | no |
| Sepia sp. | no (Sepia officinalis) | no |
| Mytilus chilensis | no | no |
| Mytilus galloprovincialis | yes | yes |
| Mytilus sp. | no | no |
| Perna canaliculus | no | no |
| Rapana venosa | no | yes |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tinacci, L.; Stratev, D.; Strateva, M.; Zhelyazkov, G.; Kyuchukova, R.; Armani, A. An Authentication Survey on Retail Seafood Products Sold on the Bulgarian Market Underlines the Need for Upgrading the Traceability System. Foods 2023, 12, 1070. https://doi.org/10.3390/foods12051070
Tinacci L, Stratev D, Strateva M, Zhelyazkov G, Kyuchukova R, Armani A. An Authentication Survey on Retail Seafood Products Sold on the Bulgarian Market Underlines the Need for Upgrading the Traceability System. Foods. 2023; 12(5):1070. https://doi.org/10.3390/foods12051070
Chicago/Turabian StyleTinacci, Lara, Deyan Stratev, Mariyana Strateva, Georgi Zhelyazkov, Ralica Kyuchukova, and Andrea Armani. 2023. "An Authentication Survey on Retail Seafood Products Sold on the Bulgarian Market Underlines the Need for Upgrading the Traceability System" Foods 12, no. 5: 1070. https://doi.org/10.3390/foods12051070
APA StyleTinacci, L., Stratev, D., Strateva, M., Zhelyazkov, G., Kyuchukova, R., & Armani, A. (2023). An Authentication Survey on Retail Seafood Products Sold on the Bulgarian Market Underlines the Need for Upgrading the Traceability System. Foods, 12(5), 1070. https://doi.org/10.3390/foods12051070

