Next Article in Journal
Effects of Chlorich®EnergyBoost on Enhancing Physical Performance and Anti-Fatigue Properties in Mice
Previous Article in Journal
Mass Spectrometry Characterization of Honeydew Honey: A Critical Review
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Foods
Volume 13
Issue 14
10.3390/foods13142231
foods-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest

by
Yutong Li
,
Siyue Liu
,
Huiyu Kuang
,
Junyi Zhang
,
Bei Wang
and
Shaojia Wang
*
Beijing Advanced Innovation Center for Food Nutrition and Human Health (BTBU), School of Food and Health, Beijing Higher Institution Engineering Research Center of Food Additives and Ingredients, Beijing Technology and Business University, Beijing 100048, China
*
Author to whom correspondence should be addressed.
Foods 2024, 13(14), 2231; https://doi.org/10.3390/foods13142231
Submission received: 24 June 2024 / Revised: 11 July 2024 / Accepted: 14 July 2024 / Published: 16 July 2024
(This article belongs to the Topic Application of Liquid Chromatography-Mass Spectrometry and Related Techniques)
Browse Figures
Versions Notes

Abstract

:
The volatile compounds in strawberries play a significant role in the formation of strawberry aroma. However, these compounds undergo continual changes during storage, resulting in a decline in quality. In this study, a total of 67 volatile organic compounds (VOCs) were identified in strawberries through quantitative analysis. At the end of the storage period, the VOC content in the ultrasonic group was 119.02 µg/kg higher than that in the control group. The results demonstrated that the ultrasonic treatment increased the contents of terpenes and esters at the end of storage. Among these, linalool increased from 67.09 to 91.41 µg/kg, while ethyl cinnamate increased from 92.22 to 106.79 µg/kg. Additionally, the expression of the key metabolic genes closely related to these substances was significantly up-regulated. The expression of the FaNES gene, related to terpene metabolism, was up-regulated by 2.8 times in the second day, while the expression of the FaAAT gene, related to ester metabolism, was up-regulated by 1.5 times. In summary, this study provides a theoretical basis for exploring the mechanism of ultrasonic effect on strawberry flavor and quality after harvest.

1. Introduction

Strawberry (Fragaria × ananassa Duch) is an octaploid (2n = 56) perennial root herb of the rose family and is widely known as the “queen of fruits”. It is characterized by a bright red appearance and a distinctive fruit shape, with a sweet taste and a tender and juicy texture [1]. Strawberries are rich in amino acids, vitamins, flavonoids and other nutrients, with a high level of consumer acceptance [2]. However, strawberries are prone to damage due to their high water content and absence of a hard peel, making them softened and infested with mold and other microorganisms, leading to quality deterioration after harvest [3,4,5]. Ultrasonic treatment can extend the shelf life of fruits by inhibiting the growth of harmful microorganisms and regulating the enzyme activity of key metabolic pathways. Feng et al. demonstrated that ultrasonic treatment could enhance the antioxidant capacity of grapes and improve the quality of fruits [6]. Previous studies have also proved that ultrasonic treatment could affect the transcriptome gene expression of strawberries and alleviate fruit softening [7].
The scientific name of strawberry, ‘Fragaria’, refers to the aromatic aspect, which is one of the important characteristics of fresh strawberries [8]. Typically, aroma is produced by volatile organic compounds (VOCs) and can be used as an indicator of fruit quality deterioration [9,10]. Although the total content of the VOCs only accounts for 0.001% to 0.01% of the fresh fruit mass, they exert a significant impact on the aroma and flavor of strawberries [3]. Previous studies have identified over 350 volatile substances in strawberries, with the majority belonging to the classes of esters, ketones, alcohols, terpenes, aldehydes, and acids [11,12]. The aroma of fruit is not only influenced by the type and content of VOCs, but also by their threshold. According to the aroma activity value OAV (content/threshold), VOCs can be classified into characteristic aroma components or non-characteristic aroma components [13]. Characteristic aroma components are aroma components representing the characteristic aroma of the fruit. As for strawberries, the characteristic aroma components include terpenoids, aldehydes, esters, and furanones. Terpenes are important secondary metabolites in plants and serve as the primary components affecting the floral flavor of many flowering plants. Of them, linalool and nerolidol have a greater effect on the aroma of strawberries and are responsible for the production of floral and citrus fragrances [14]. Aldehydes impart herbal aromas, with hexanal and hexenal being the most common in fruits [15,16].
The content of ester compounds in ripe strawberry fruits accounts for 25% to 90% of the total VOCs, which is an important part of the characteristic aromatic substances of strawberries [17,18]. The ester substances in strawberries mainly include methyl esters and ethyl esters. Among these, methyl butyrate, ethyl butyrate, methyl caproate, and ethyl caproate have been identified as the principal aromatic compounds of strawberry fruit, imparting a sweet, fruity aroma to the fruit [19]. Although the content of furanone in strawberries is relatively low, 4-Hydroxy-2,5-dimethyfuran-3(2H)-one (DMHF) and 4-Methoxy-2,5-dimethyfuran-3(2H)-one (DMMF) are referred as the most significant aromatic components. These components exert a significant impact on the aroma of strawberries, imparting caramel, fruit, and burnt pineapple aromas [20,21].
During storage, strawberries continue to metabolize, followed by the synthesis and metabolism of aroma compounds [15]. Previous studies have shown that both the type and content of the esters in strawberries increase during storage [3], especially ethyl acetate, imparting a distinctive fruity flavor. This is mainly related to the metabolism of fatty acids and amino acids in strawberry species [22,23,24]. Furthermore, some studies have found that storage can lead to a decrease in the alcohol content, but some specific alcohols, such as 1-propanol and 3-octanol, induce quality deterioration with their increased content during storage [22,25]. The consumption of other substances such as sugar [26], leading to the continued synthesis and increased contents of furanone metabolites [27,28]. In addition to the influence of storage time on aroma, many preservation treatments such as chilling, irradiation, different types of packaging, etc., have also been reported to have a significant influence on fruit aroma [29,30].
Ultrasonic treatment is an efficient method for maintaining the freshness of fruits. Additionally, it has been reported to alleviate the quality deterioration of fruits during storage [31,32]. Ultrasonic technology differs from other preservation technologies and is often used in auxiliary processing [33,34,35]. Previous studies have shown the effects of ultrasound on processing [36], cleaning [37], and sterilization [38]. Nevertheless, reports on the impact of ultrasound on the aroma of fruits, particularly strawberries, are scarce. Meanwhile, there are few studies on the influence of ultrasound on the transcriptome of fruits during storage. Consequently, this study analyzed the changes in transcriptomics and VOCs to investigate the impact of ultrasonic waves on the aroma metabolism of strawberries during storage. Overall, the experimental findings will provide a theoretical and experimental basis for future studies on the aroma changes of fruits and vegetables during storage and offer insights for the practical application of ultrasonic wave preservation.

2. Materials and Methods

2.1. Experimental Material

The octaploid “Red face” strawberry (Fragaria × ananassa Duch. cv. “Benihoppe”) from Da Zi Ran farm (39.54° N, 116.23° E, Beijing, China) was selected as the experimental material. Strawberry plants were grown in a greenhouse containing a mixture of nutrient soil, vermiculite, and organic fertilizer (7:2:1, v/v/v). The seedlings were spaced 0.2 m within each row column and grown in a controlled environment with the following conditions: 25 °C:18 °C (day:night), 60% humidity, 12 h photoperiod. The samples were obtained by organic planting methods, and organic fertilizer made of fish protein was used. And insect infestations were prevented by physical techniques such as insect nets. Fresh strawberry fruits of similar ripening quality were transported to the laboratory immediately after picking. Strawberry fruits with similar size, color, maturity, and no obvious surface damage were pre-cooled at 5 °C for 24 h for use. The strawberries were randomly divided into a control group (CK) and an ultrasonic group (U) for treatment. Ultrasonic group (U): the strawberries were completely immersed in an ultrasonic tank filled with deionized water for ultrasonic treatment. The ultrasonic conditions were the same as in the previous study [7]: ultrasonic frequency was 28 kHz, ultrasonic power was 0.15 W/cm2, and ultrasonic time was 3 min (to maintain a constant water temperature in the ultrasonic tank, the ultrasonic equipment (Beijing Jinxing Ultrasonic Equipment Technology Co., Ltd., Beijing, China) was connected to a low-temperature constant water bath, and the temperature was set at 15 °C). Control group (CK): the strawberries were completely immersed in deionized water for the same time as the ultrasonic group. After being treated, the surface water of the strawberries was removed with absorbent paper and then they were stored in a refrigerator at 5 °C and a humidity of 75–85%.

2.2. Determination of Volatile Compounds

Volatile compounds were collected by headspace solid-phase microextraction [39,40]. The strawberry samples from the ultrasonic group and the control group were randomly selected at 0 h, 3 h, 6 h, 9 h, 12 h, 1 d, 2 d, 3 d, 6 d, 9 d, 12 d, and 15 d during storage. After removing the leaf stalks, the strawberries were cut into parts weighing 5 g each and mixed with 5 mL saturated NaCl (>99%) solution. Then, 3 g of fruit pulp was placed in a 15 mL headspace bottle and the internal standard 2-methyl-3-heptanone (>99%) (0.816 mg/mL, 1 μL) was added. After the sealed headspace bottle was temperated in a water bath at 25 °C for 20 min, the SPME arrow extraction head was inserted into the headspace bottle and the extracted fiber was pushed out. After 30 min of headspace adsorption, the extracted fiber was retracted and the extraction head was pulled out. Each group was treated in triplicate per time point.
The volatile compounds were determined by gas chromatography–mass spectrometry (Agilent Technologies, Santa Clara, CA, USA) following the previously reported method with some modifications [41]. GC condition: DB-WAX column, 60 m × 0.25 mm × 0.25 μm, the carrier gas was helium at a flow rate of 1.2 mL/min. The temperature procedure of the column was as follows: the initial temperature of the column was 40 °C, then temperature increased to 75 °C at 7 °C/min; it was heated up to 150 °C at 2 °C/min; and the temperature was raised to 230 °C at 5 °C/min for 2 min. The diversion mode was adopted. MS conditions: electron ionization source, electron energy 70 eV, the inlet temperature was 250 °C, the ion source temperature was 230 °C, the quadrupole temperature was 150 °C, full scanning mode, and the quality scanning range was m/z 35~350.

2.3. Transcriptome Sequencing

The strawberry samples from the ultrasonic group and the control group were randomly selected at 0 h, 3 h, 6 h, 9 h, 12 h, 1 d, 2 d, 3 d, 6 d, and 9 d during storage. The strawberries were immediately beaten and mixed (5 s) after the leaf stem was removed and divided. About 10 g of strawberry pulp was weighed and packed in a 10 mL centrifuge tube, frozen with liquid nitrogen, and then refrigerated at −80 °C. For transcriptome sequencing, each treatment group was set up with 3 biological replicates per time point. The sequencing of strawberry samples, including total RNA extraction and quality inspection, cDNA library construction, transcriptome sequencing, and preliminary bioinformatics analysis, was performed by the Shanghai Meiji Biomedical Technology Co., Ltd. (Shanghai, China). The gene differential expression analysis was conducted using DESeg2 1.24.0 software [42]. The screening criteria for differential expression genes were |log2FC| > 1 (difference multiple > 2) and p-adjust < 0.05.
All genes were functionally annotated in the GO, KEGG, COG, NR, Swiss-Prot, and Pfam databases. The gene function enrichment analysis mainly includes KEGG enrichment analysis to identify the genes involved in the metabolic pathways. The KEGG enrichment analysis was performed by Goatools 0.6.5 software, and the p-value was corrected by default. The KEGG pathway with p-adjust < 0.05 was significantly enriched in gene concentration.

2.4. Real-Time Fluorescence Quantitative PCR

The key genes related to the signal pathway of strawberry active aroma substances were selected and the cDNA samples of the ultrasonic group and the control group were used for real-time fluorescence quantitative PCR (qPCR) to verify the reliability of the transcriptome sequencing results. The octoploid strawberry Actin gene was used as the internal reference gene. The selected gene coding region used Primer Premier 5.0 software design primers through the Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast (accessed on 15 January 2022)) for their early specific validation. The specificity of the primers was confirmed by the dissolution curve. The internal reference Actin primer was F: 5′-GGTGACGAGGCTCAATCCAA-3′, R: 5′-GGGCAACACGAAGCTCATTG-3′, and the primer sequence of the target gene is shown in Table 1.
After the total RNA was qualified, cDNA with a concentration of 50 ng/uL was synthesized by reverse transcription and freeze-dried at −20 °C for further use. Later, the sample was diluted 10 times for use. The gene-specific primers were synthesized by Suzhou Hongxun Biotechnology Co., Ltd. (Suzhou, China), and real-time fluorescent quantitative PCR experiments were performed using the SuperReal Premix Plus (SYBR Green) kit (Tiangen Biochemical Technology Co., Ltd. Beijing, China). Real-time fluorescence quantitative PCR reaction system and the procedures were as follows: a 10 μL real-time fluorescence quantitative PCR reaction system: 2 × SuperReal Premix Plus (SYBR Green) 5 μL; Template cDNA 5 ng; 5 μM Primer F, 0.3 μL; 5 μM Primer R, 0.3 μL; ddH2O was added to 10 μL. After adding a 10 μL real-time fluorescence quantitative PCR reaction system, the real-time fluorescence quantitative PCR reaction was performed using the CFX96 real-time fluorescence quantitative PCR instrument (BioRad, Hercules, CA, USA). The 10 μL real-time fluorescent quantitative PCR reaction procedure was as follows: predeformation stage 95 °C, 15 min; cycle reaction stage 95 °C 10 s, 55 °C 20 s, 72 °C 20 s, a total of 40 cycles; dissolution curve stage 65 °C 5 s, 95 °C 15 s.
Based on the expression level of each gene in the CK-0H samples, 2−ΔΔCT was used to calculate the relative expression level of the target genes [43]. Each gene in each sample was performed with 3 duplicate holes, and template-free amplification was used as a negative control.

2.5. Data Processing

The data significance and correlation analyses were performed using IBM SPSS Statistics 27. The data were analyzed and mapped using Excel 2021 and Origin 2022 software. Transcriptome-related data were analyzed and mapped using various online data processing and mapping tools provided by the Meggie Biocloud platform (http://www.majorbio.com/ (accessed on 19 January 2024)).

3. Results and Discussion

3.1. Analysis of Volatile Organic Compound Types of Strawberry during Storage

The types of volatile compounds in strawberries during storage mainly include esters, terpenes, alcohols, and aldehydes. As shown in Figure 1 and Table A1, ultrasonic treatment alleviated the reduction of VOC types during the storage period. A total of 67 volatile compounds were detected in strawberries by gas chromatography–mass spectrometry (attached table). Among them, esters accounted for the largest number (13 types), followed by terpenes (10 types), aldehydes (7 types), alcohols (11 types), acids (7 types), ketones (5 types), and other substances (14 types). A total of 53 aroma substances were identified in the ultrasonic group, including 10 terpenes, 10 alcohols, nine esters, four ketones, six aldehydes, five acids, and nine other substances. A total of 64 aroma substances were identified in the control group, including 10 terpenes, 11 alcohols, 12 esters, four ketones, six aldehydes, seven acids, and 14 other substances. This result was consistent with the findings of Ana et al. and Ulrich et al., reporting that strawberry aroma is mainly composed of esters, terpenes, and alcohols [40,44].
As shown in Figure 1, a total of 48 and 38 volatile compounds were detected in the control and ultrasonic groups at the beginning of the storage period. This might be because the initial abiotic stress, such as ultrasound, inhibits the metabolism of VOCs [45]. Strawberries have a reduced range of volatiles during storage, similar to some fruits stored in cold stores [46]. Compared with the sample at 0 h, the types of volatile compounds in both groups decreased at 15 d, and the types of volatile compounds in the ultrasonic group were more than three compared to those in the control group at 15 d. These results indicated that ultrasound inhibited the reduction in volatile species during storage. Cai et al. and Caleb et al. found that preservation treatments such as heat treatment and air conditioning could also mitigate this trend [45,47].
Among the volatile compounds, there were more types of terpenoids and alcohols, and the number of alcohols in the control group decreased with the extension of storage time. The number of aldehydes was relatively stable during the storage period but increased after 1 d. Xu et al. also found that the number of aldehydes increased after 1 d storage [29]. During the period, the types of esters and other substances decreased with the extension of storage time. Compared to the decrease in species composition observed in the control group, the ultrasound group showed an increase in the abundance of terpenes and alcohols, which play a key role in species composition.

3.2. Volatile Organic Compounds Analysis of Strawberries during Storage

As shown in Figure 2 and Table A1, ultrasonic treatment increased the VOC contents during storage. The volatile compounds in the control group had little change after storage for 15 d compared that of storage for 0 h, which was consistent with the findings of Liu et al. [30]. The volatile compounds in the ultrasonic group showed a greater change, increasing from 356.79 μg/kg to 639.40 μg/kg. The total content of volatile compounds in the control group was higher after 9 h of storage, and the contents of VOCs in the ultrasonic group were higher than that in the control group at 12 h and the time points after 3 d. The total contents of VOCs were decreased by ultrasound at 0 h of storage, and increased by ultrasound at 12 h and after 3 d of storage. Similar to the results of hot water dipping treatment, it was found that the stress initially inhibits the metabolism and reduces the content of some substances. However, in this study, the metabolism was activated with increased storage time, increasing the content of VOCs in the treatment group [45].
For various compounds, terpenoids accounted for a relatively high proportion of the total volatile compounds in the first 12 h of storage, among which the linalool content was the highest, reaching peaks around 12 h, followed by menthol and alpinene contents. Among the alcohols, hexanol and other C6 alcohols had higher contents. A similar content relationship was also found by Zhang et al. [20] and Xu et al. [48]. The contents of esters and aldehydes in both groups increased with the extension of storage time, which was consistent with the findings of Macario et al. [49]. Esters and aldehydes in the two groups increased with the extension of storage time. Joseana et al. and Liu et al. proved that UV-C irradiation and IPL treatment could increase the content of esters and aldehydes during storage [30,50]. Ethyl cinnamate, ethyl caproate, and methyl caproate accounted for most of the esters, and the levels of hexanal, 2-hexenal, and nonanaldehyde were higher among the aldehydes. Previous studies have shown that esters could enhance the fruity flavor of fresh strawberries, and esters and aldehydes contribute to the freshness of strawberries [3]. The higher levels of esters and aldehydes in the ultrasonic group at the end of 15 days of storage might be attributed to the fact that ultrasonic treatment could maintain the freshness of strawberries [21].
Therefore, it was speculated that ultrasonic treatment inhibited the metabolism of VOCs, and the content of VOCs was reduced under ultrasonic stress. However, after 12 h, ultrasonic treatment promoted the metabolism of esters and terpenoids, increased the contents of total volatile compounds, followed by an increase in the contents of linalool, hexanol, ethyl ester, hexaldehyde, terpenoids, alcohols, esters, and aldehydes.

3.3. Analysis of Key Volatile Compounds in Strawberry

Additionally, ultrasonic treatment increased the content of key aroma compounds and improved the fruity aroma of strawberries after 1 d of storage. The aroma activity value OAV (concentration/threshold value) can roughly represent the degree of influence of volatile compounds on the overall aroma of the sample. Compounds with OAV value greater than 1 contribute more to the aroma of the sample. In this study, eight key substances with OAV values greater than 1 were screened (Figure 3 and Table 2), including 1-hexanol, ethyl cinnamate, ethyl caproate, hexanal, nonanaldehyde, linalool, nerolidol, and 4-methoxy-2,5-dimethyl furanone. These compounds were identified as the key contributors to the aroma of the sample, implying that these substances play a pivotal role in the aroma of strawberries [51].
Among the key aroma substances, 4-methoxy-2,5-dimethylfuranone could affect the specific flavor of strawberries [52]. Strawberries continue to synthesize furanones even after the plant reaches full maturity, and the content of furanones increases after harvest [53]. A similar trend was observed in this study. In addition to their significant floral properties [54], terpenoids such as linalool have a series of physiological functions, especially their involvement in plant stress resistance [55]. It is reported that two key ester compounds, ethyl caproate and ethyl cinnamate, which increase with storage time, can impart a fruity and wine-like flavor [28,56]. Aldehydes are associated with the improvement of plant flavor, while hexanal has a grassy flavor. Du et al. also proved that hexanal is one of the characteristic aroma substances of strawberries [21]. Additionally, it is reported that hexanal has the potential to suppress postharvest diseases [57]. Li et al. showed that octanal and nonanal have the antifungal properties [58].
Compared with the control group, the content of 4-methoxy-2,5-dimethylfuranone in the ultrasonic group was lower than that in the control group at 0 h, and the concentration of 4-methoxy-2,5-dimethylfuranone was significantly increased at 12 h and 1 d after ultrasonic treatment. The levels of linalool and nerolidol were higher in the ultrasonic group at most times. The contents of key terpenoids increased gradually after 6 h, with the largest increase at 12 h, 1 d, 12 d, and 15 d. The ultrasonic group showed higher levels of these compounds at 12 h, 1 d, and 15 d. As shown in the accompanying table, ultrasonic treatment significantly increased the hexanol content at 1 d and 3 d. Similar to other substance treatments, ultrasonic treatment increased the contents of aldehydes, especially hexanal and nonanal in the two groups at 12 h, 1 d, 12 d, and 15 d.
These results showed that the contents of ethyl caproate, ethyl cinnamate, and 4-methoxy-2,5-dimethylfuranone were increased at 12 h, 1 d, 12 d, and 15 d compared with those at 0 h, indicating that the fruity flavor of strawberries was more intense after 12 h of storage. Similar to the results of other preservation treatments such as nano-selenium and high-CO2 atmosphere [59,60], ultrasonic treatment increased the content of most key flavor compounds at 12 h, 1 d, 12 d, and 15 d.

3.4. Metabolic Pathway Analysis

The metabolic pathways of aroma substances such as linoleic acid, linolenic acid, and terpenes were activated by ultrasonic treatment, which enhanced the fruity aroma of strawberries during storage. Some studies have found that acoustic signals can induce changes in gene expression [61]. Sound stimulation can help plants defend against other abiotic (drought) or biological (insect) stresses [62]. Ultrasonic treatment can induce the antioxidant system, mainly in the early treatment response expression [63], and improve the fatty acid metabolism pathway. The changes in the key metabolic pathways were analyzed using transcriptome sequencing to explore the molecular mechanism of ultrasonic influence on strawberry aroma metabolism further. The transcriptome sequencing results showed that ultrasonic treatment could significantly affect the gene expression of strawberries. A total of 1905 genes were significantly differentially expressed at different times. In different storage time points, there were more differential genes at 0 h, 6 h, and 12 h (Figure 4a). The transcriptome mainly responds to ultrasonic treatment at the early stage of storage, and the response is mainly down-regulated. Further enrichment analysis of the metabolic pathways showed that the DEGs were more significant in the metabolic pathways such as plant–pathogen interaction and hormone response.
Previous studies have found that ultrasonic treatment could affect plant softening, plant hormone signal transduction, and other metabolic pathways. At the physiological level, ultrasonic treatment can alleviate the softening of strawberry fruits during storage and improve storage quality [7].
Concurrently, differential gene enrichment was observed in the linolenic acid and linoleic acid metabolic pathway, terpenoid skeleton metabolic pathway, and other pathways which are related to ester and terpenoid metabolism of key aroma substances of strawberry [64]. The KEGG enrichment results demonstrated that differential genes were predominantly up-regulated in these pathways, which was analogous to the impact of certain preservation techniques on the transcriptome. Some studies have found that pretreatment before storage can affect the transcriptome expression of fruits; for example, low-temperature storage can enrich DEGs in nectarine in the carbohydrate and terpenoid metabolic pathways [65]. Additionally, cold plasma can regulate the transcriptome of blueberry, and the enrichment pathway is related to the secondary metabolites [63].

3.5. Analysis of Key Gene Transcript Expression

Ultrasound treatment up-regulated the transcription expression levels of genes related to aroma metabolism at some time points. Esters, aldehydes, acids, and alcohols are formed mainly through the metabolism of fatty acids, amino acids and sugars [66,67]. In the fatty acid pathway, fatty acids continuously remove the C2 unit (acetyl-CoA) by β-oxidation to form different fatty acyl-CoA and finally convert to esters (Figure 5). In the amino acid pathway, aliphatic amino acids form branched-chain ketoacids through aminotransferase and then form acyl-CoA through dehydrogenase [68]. Acetyl-coenzyme A is catalyzed to produce acetic acid ester by alkyl transferase AAT or ethanol under the catalysis of reductase and then ethyl acid. Acetyl-CoA is involved in many metabolic pathways and is a common precursor of alcohols, acids, aldehydes, and esters [69]. The activation of the secondary metabolite pathway and an increase in the AAT transcription level to promote the increase in ester aroma were also observed in some genetically mutated mangoes [70].
In the terpenoid metabolic pathway, the nerolidol synthetase (NES) gene FaNES1 is a key gene encoding the unique “flower fruit” substances of strawberry, while linalool and nerolidol can catalyze the production of linalool and nerolidol by Geranyl-PP or Farnesyl-PP [71]. In a previous study, the levels of NES transcriptional genes were regulated through pollination to regulate the content of terpenes [72]. The carbohydrate pathway mainly produces furanone compounds, representative products like 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF), and 4-methoxy-2,5-dimethyl-3(2H)-furanone (DMMF). FaQR has been shown to be involved in the final step in the synthesis of HDMF from 4-5-methyl-2-methylene-3 (2H) methanone [20]. HDMF is a methylation substrate catalyzed by OMT to produce a more stable DMMF during maturation [73].
The expression of many FaAAT transcripts in the ultrasound group was down-regulated compared with that in the control group at 9 h of storage, while some of the transcripts in the ultrasound group were up-regulated after 1 d. Some studies have found that jasmonate can induce the up-regulation of FaAAT transcripts in apples [74], and 1-MCP treatment can inhibit the expression level of FaAAT in peaches and bananas during storage [75,76], thus affecting the contents of ester substances. Compared with the control group, the expression of FaNES1 in the ultrasound group was up-regulated at 3 h and 6 h, and no significant difference was observed between the two groups at other time points during storage. The expression of some FaQR transcripts in the ultrasound group was more up-regulated than that in the control group within 9 h, then more down-regulated than that in the control group after 1 d. The expression of FaOMT transcripts in the ultrasound group was partly up-regulated and partly down-regulated compared with that in the control group at 0 h, and the expression of FaOMT transcripts in the ultrasound group was up-regulated compared with that in the control group at 1 d of storage.

3.6. Analysis of Real-Time Quantitative Fluorescence

The data obtained by real-time fluorescence quantitative PCR was used to plot a calorimetric map of strawberry aroma gene expression, as shown in Figure 6. The gene expression of aroma metabolism was down-regulated at 0 h and up-regulated at 1 d after ultrasonic treatment. In the control group, the change was significant within 6 h after storage, and the expression level of related genes decreased significantly at 3 h, increased significantly at 6 h, and then decreased significantly at 2 d and 9 d of storage. According to Zhang et al., refrigeration could induce gene expression fluctuations [77]. Compared with the control group, gene expression in the ultrasound group was significantly down-regulated at 0 h and 6 h, which was closely related to the lower substance content in the ultrasound group at 9 h before storage. Gene expression in the ultrasonic group was significantly increased at 1 d and 2 d, and the metabolism of esters, terpenes, and furanones was accelerated, leading to an increase in the volatile compound contents in the ultrasound group after 1 d. The expression of FaNES was up-regulated within 6 h–2 d, and the biosynthesis of terpenes was accelerated, which was consistent with the trend of higher content of terpenes around 1 d. After 3–15 d of storage, the expression of the FaAAT gene was down-regulated compared with that of the control group at 0 h, but the content of esters still increased with the extension of storage time, indicating that ester catabolism was inhibited. Furthermore, other genes, such as LOX and SAAT, are also involved in the metabolism of ester substances [28]. Additionally, the enzyme activity of AAT is influenced by the transcription factors, including the MYB group [78]. These factors may influence the content of ester substances, which can be investigated in subsequent experiments.

4. Conclusions

In conclusion, this study offers insights into the effects of ultrasound on VOCs and key genes during the storage of strawberries. The results of this experiment showed that the types and contents of VOCs in the ultrasound group decreased at 0 h of storage. However, the contents of total VOCs, especially esters and terpenes, were increased by ultrasonic treatment at 1 d, 12 d, and 15 d of storage. According to the OAV value, eight key aroma compounds were selected, including 1-hexanol, ethyl cinnamate, ethyl caproate, hexanal, nonanaldehyde, linalool, nerolidol, and 4-methoxy-2,5-dimethyl furanone. The content of key aroma compounds such as linalool and ethyl caproate was increased by ultrasonic treatment after 1 d. The results of the transcriptome analysis showed that the metabolic pathways of fatty acids and terpenes were activated by ultrasonic treatment, and the expression levels of FaAAT, FaNES1, FaQR, and FaOMT in the ultrasonic group were decreased at 0 h of storage and then increased at 9 h and 1 d of storage, which was consistent with the changes in aroma substances. Therefore, ultrasound could activate the aroma metabolic pathway, improve gene expression, and alleviate the reduction in volatile compound content and variety.

Author Contributions

Y.L.: writing—original draft; S.L. and J.Z.: investigation; H.K.: data curation; B.W. and S.W.: writing—review & editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Appendix A

Table A1. Volatile compounds in strawberries.
Table A1. Volatile compounds in strawberries.
CompoundsRTCASContent (μg/kg)
Storage Time0 h3 h6 h9 h12 h1 d2 d3 d6 d9 d12 d15 d
Esters
Ethyl butyrate7.545105-54-4ckNDNDNDNDNDNDNDNDNDNDNDND
uND20.22 ± 2.85NDNDNDNDNDNDNDNDNDND
Methyl hexoate11.254106-70-7ck17.25 ± 2.4219.98 ± 3.2419.21 ± 2.3534.56 ± 4.2150.47 ± 5.357.80 ± 1.8419.50 ± 2.5625.40 ± 4.219.88 ± 1.7424.45 ± 2.4527.63 ± 3.6230.22 ± 5.32
u10.86 ± 2.0128.43 ± 4.259.83 ± 2.1027.37 ± 3.4234.19 ± 2.4624.25 ± 4.7228.92 ± 3.6218.86 ± 3.2310.06 ± 1.7226.50 ± 3.3216.51 ± 2.3222.73 ± 3.26
Ethyl hexanoate12.773123-66-0ck25.63 ± 4.2321.55 ± 3.2320.96 ± 3.1229.00 ± 2.6413.94 ± 1.2465.27 ± 8.3430.53 ± 5.6315.26 ± 2.349.91 ± 1.6424.40 ± 3.5269.45 ± 7.3592.97 ± 10.52
u25.00 ± 2.6224.19 ± 2.7323.74 ± 3.2639.21 ± 5.2542.37 ± 6.7437.02 ± 4.2629.55 ± 4.7228.58 ± 3.7218.52 ± 2.4641.27 ± 6.3482.86 ± 11.46103.70 ± 12.63
Hexyl acetate14.181142-92-7ck3.98 ± 1.52NDNDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Trans-2-hexenyl acetate16.6382497-18-9ck9.09 ± 1.268.01 ± 2.01NDNDNDNDNDNDNDNDNDND
u6.13 ± 2.13NDNDNDNDNDNDNDNDNDNDND
Cyclohexyl acetate16.883622-45-7ckND2.54 ± 0.23NDNDNDNDNDNDNDNDNDND
uND2.38 ± 0.54NDNDNDNDNDNDNDNDNDND
Methyl benzoate30.81993-58-3ckNDNDND0.58 ± 0.120.30 ± 0.06NDNDNDNDNDNDND
uNDND0.87 ± 0.130.47 ± 0.10NDNDNDNDNDNDNDND
Gamma-butyrolactone31.29996-48-0ck0.55 ± 0.08NDNDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Methyl salicylate38.742119-36-8ckNDNDND0.42 ± 0.14NDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Methyl cinnamate51.771754-62-7ck0.55 ± 0.11ND0.24 ± 0.040.29 ± 0.060.50 ± 0.14ND0.30 ± 0.060.49 ± 0.10ND0.64 ± 0.13NDND
uND0.29 ± 0.05ND0.33 ± 0.040.70 ± 0.060.64 ± 0.15ND0.69 ± 0.210.47 ± 0.120.84 ± 0.25NDND
Ethyl cinnamate53.123103-36-6ck11.22 ± 2.616.90 ± 1.267.42 ± 2.736.48 ± 2.714.61 ± 1.7324.09 ± 4.7119.16 ± 3.729.91 ± 2.2610.19 ± 2.7117.39 ± 1.2839.33 ± 4.7292.22 ± 10.27
u9.72 ± 1.835.63 ± 0.835.91 ± 1.617.18 ± 2.3118.45 ± 3.7227.24 ± 3.1710.85 ± 2.7215.21 ± 2.2713.84 ± 2.2131.61 ± 5.62102.39 ± 17.36106.79 ± 10.62
Gamma-Decanolactone58.882706-14-9ckNDNDNDNDND1.62 ± 0.15NDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Diisobutyl phthalate61.85984-69-5ckNDND3.05 ± 0.26NDNDNDNDNDNDNDNDND
uNDNDNDND4.65 ± 0.45NDNDNDNDNDNDND
Alcohols
Isoamylol13.529123-51-3ck6.41 ± 1.12ND7.84 ± 0.925.19 ± 0.634.29 ± 0.633.98 ± 0.425.23 ± 0.475.26 ± 1.02NDND3.75 ± 0.51ND
uNDNDND4.85 ± 0.526.16 ± 0.72ND3.92 ± 0.423.97 ± 0.235.22 ± 0.414.80 ± 0.853.46 ± 0.45ND
Pentanol13.56271-41-0ck7.77 ± 1.934.61 ± 0.329.76 ± 0.895.00 ± 0.464.43 ± 0.524.06 ± 0.354.70 ± 0.325.80 ± 0.56ND5.02 ± 0.673.95 ± 0.365.96 ± 0.63
u3.48 ± 0.437.36 ± 1.259.38 ± 1.56ND5.82 ± 1.312.16 ± 0.233.27 ± 0.343.89 ± 0.255.43 ± 0.435.00 ± 0.463.86 ± 0.253.61 ± 0.15
Cis-2-penten-1-ol16.2441576-95-0ck3.45 ± 0.352.72 ± 0.23ND3.60 ± 0.51NDNDNDNDNDNDNDND
u2.02 ± 0.233.55 ± 0.42ND3.49 ± 0.144.12 ± 0.231.50 ± 0.06NDNDNDND2.55 ± 0.24ND
Hexan-1-ol17.703111-27-3ck10.07 ± 1.459.25 ± 0.824.22 ± 0.242.56 ± 0.344.71 ± 0.453.49 ± 0.242.35 ± 0.1512.45 ± 1.262.39 ± 0.422.85 ± 0.257.23 ± 0.922.95 ± 0.35
u4.48 ± 0.256.53 ± 0.452.66 ± 0.272.81 ± 0.293.48 ± 0.4914.68 ± 1.525.83 ± 0.5112.68 ± 1.532.06 ± 0.264.20 ± 0.424.49 ± 0.646.24 ± 0.52
Trans-2-Hexen-1-ol20.141928-95-0ck11.50 ± 1.6419.30 ± 2.645.01 ± 0.56ND7.12 ± 0.622.46 ± 0.43ND2.13 ± 0.251.78 ± 0.152.52 ± 0.266.37 ± 0.531.09 ± 0.15
u8.83 ± 1.8311.65 ± 0.92ND5.18 ± 0.635.10 ± 0.527.76 ± 0.611.49 ± 0.113.93 ± 0.461.56 ± 0.15NDND1.92 ± 0.29
Cyclohexanol20.15108-93-0ck15.98 ± 1.5119.75 ± 2.31NDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Cis-2-Hexen-1-ol20.2928-94-9ck13.24 ± 1.4212.05 ± 2.213.19 ± 0.415.27 ± 0.457.26 ± 0.642.65 ± 00.25NDNDNDNDNDND
uND12.25 ± 0.984.62 ± 0.524.79 ± 0.435.75 ± 1.062.19 ± 0.25NDNDND3.01 ± 0.322.96 ± 0.312.41 ± 0.23
Oct-1-en-3-ol22.3443391-86-4ckNDND5.15 ± 0.62NDND2.03 ± 0.439.48 ± 1.349.07 ± 0.827.30 ± 0.913.67 ± 0.434.21 ± 0.32ND
uND4.45 ± 0.32NDND7.59 ± 0.94NDND12.13 ± 1.236.70 ± 0.425.72 ± 0.623.37 ± 0.31ND
2-Ethylhexan-1-ol24.237104-76-7ck5.54 ± 0.413.68 ± 0.234.48 ± 0.452.36 ± 0.25ND4.56 ± 0.154.46 ± 0.255.01 ± 0.625.48 ± 0.566.58 ± 0.728.70 ± 1.0211.13 ± 1.93
u5.13 ± 0.532.59 ± 0.203.68 ± 0.532.32 ± 0.305.53 ± 0.533.13 ± 0.244.10 ± 0.312.80 ± 0.456.39 ± 0.538.34 ± 0.754.97 ± 0.346.34 ± 0.25
Octan-1-ol27.958111-87-5ck2.95 ± 0.361.70 ± 0.163.57 ± 0.463.45 ± 0.262.27 ± 0.744.46 ± 0.5317.03 ± 1.9316.55 ± 0.378.73 ± 0.392.95 ± 0.325.31 ± 0.528.15 ± 0.89
u2.80 ± 0.343.62 ± 0.532.15 ± 0.322.21 ± 0.226.82 ± 0.343.60 ± 0.526.59 ± 0.6317.78 ± 1.527.12 ± 0.828.67 ± 0.935.00 ± 0.5211.96 ± 1.83
2-Phenylethanol45.97260-12-8ck0.65 ± 0.12NDND0.39 ± 0.07NDNDNDNDNDNDNDND
u0.26 ± 0.12NDND0.41 ± 0.08NDNDNDND2.13 ± 0.24NDNDND
Aldehydes
Hexanal8.45266-25-1ck20.61 ± 3.1819.56 ± 2.4114.94 ± 2.1217.72 ± 2.5128.45 ± 3.5219.92 ± 1.5131.94 ± 3.2427.04 ± 2.5118.07 ± 1.7234.33 ± 4.6316.69 ± 2.5221.50 ± 2.16
u16.99 ± 1.6227.98 ± 2.3222.39 ± 1.6223.47 ± 2.6331.34 ± 2.3517.52 ± 2.1523.20 ± 3.2118.78 ± 2.6122.32 ± 2.6136.06 ± 3.1223.65 ± 3.1123.13 ± 2.62
Trans-2-hexenal12.3616728-26-3ck38.01 ± 4.6133.23 ± 3.7132.02 ± 2.4630.99 ± 2.3629.47 ± 3.7245.00 ± 5.2737.62 ± 3.6135.72 ± 4.1638.99 ± 4.2627.63 ± 3.7129.19 ± 3.7729.19 ± 2.18
u19.92 ± 2.7137.18 ± 4.1737.18 ± 4.8143.86 ± 4.1635.94 ± 3.7152.36 ± 5.1628.28 ± 3.9347.43 ± 4.1244.59 ± 4.6139.40 ± 3.3622.70 ± 2.4152.40 ± 6.27
Octanal14.249124-13-0ckNDNDNDNDND2.78 ± 0.316.70 ± 0.535.12 ± 0.664.84 ± 0.343.14 ± 0.233.30 ± 0.524.23 ± 0.33
uNDNDNDND2.53 ± 0.211.79 ± 0.432.69 ± 0.223.80 ± 0.437.15 ± 0.563.72 ± 0.254.34 ± 0.363.52 ± 0.25
Nonanal19.332124-19-6ck4.36 ± 0.47ND3.01 ± 0.315.05 ± 0.466.81 ± 0.677.60 ± 0.8339.02 ± 3.1324.47 ± 2.4138.01 ± 3.1511.04 ± 1.2317.55 ± 2.4135.26 ± 3.15
u4.40 ± 0.32NDND3.23 ± 0.1211.71 ± 2.317.43 ± 0.2521.98 ± 3.5153.40 ± 6.3226.02 ± 3.2334.65 ± 3.7110.37 ± 2.0141.62 ± 4.10
Furfural22.62898-01-1ckND0.94 ± 0.15NDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Benzaldehyde25.541100-52-7ck9.60 ± 1.207.20 ± 1.239.19 ± 0.9511.40 ± 1.219.86 ± 0.41ND10.94 ± 1.217.06 ± 0.577.22 ± 0.488.15 ± 1.027.59 ± 0.968.12 ± 0.83
u6.20 ± 0.738.62 ± 0.937.80 ± 0.9413.04 ± 1.2114.03 ± 2.569.00 ± 1.027.56 ± 0.5310.59 ± 0.9312.87 ± 2.1014.71 ± 1.4317.05 ± 1.2013.75 ± 1.56
Undecan-4-olide58.899104-67-6ckNDNDNDNDNDNDNDNDNDNDNDND
uNDNDNDND1.73 ± 0.53NDNDNDNDNDNDND
Acids
Acetic acid22.31364-19-7ck2.99 ± 0.453.02 ± 0.323.83 ± 0.431.67 ± 0.342.98 ± 0.323.79 ± 0.44ND4.82 ± 0.45ND3.02 ± 0.225.91 ± 0.674.99 ± 0.43
u3.16 ± 0.323.43 ± 0.313.82 ± 0.433.83 ± 0.333.69 ± 0.438.37 ± 0.643.03 ± 0.52ND4.98 ± 0.644.13 ± 0.366.35 ± 0.673.84 ± 0.19
2-Methylbutyric acid33.755116-53-0ckNDNDND8.61 ± 1.38NDNDNDNDNDNDNDND
uND2.51 ± 0.32NDND3.07 ± 0.71NDNDNDNDNDNDND
Pentanoic acid37.311109-52-4ckND0.25 ± 0.05NDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Hexanoic acid42.853142-62-1ck24.59 ± 3.5813.51 ± 1.4224.32 ± 2.5337.84 ± 4.2349.69 ± 5.0061.90 ± 5.1934.64 ± 3.1022.04 ± 2.8420.42 ± 2.1228.78 ± 3.8264.36 ± 8.328.95 ± 1.49
u47.00 ± 4.1943.27 ± 3.9218.60 ± 2.9440.18 ± 4.0183.01 ± 9.9156.30 ± 4.9235.83 ± 3.0146.75 ± 4.9220.98 ± 2.2760.94 ± 4.9192.70 ± 10.9343.69 ± 4.12
Octanoic acid51.332124-07-2ck3.34 ± 0.524.94 ± 0.232.36 ± 0.334.34 ± 0.412.05 ± 0.228.02 ± 0.843.38 ± 0.291.52 ± 0.191.35 ± 0.201.38 ± 0.104.81 ± 0.93ND
u2.17 ± 0.233.01 ± 0.251.81 ± 0.213.06 ± 0.414.86 ± 0.519.57 ± 1.392.74 ± 0.424.96 ± 0.501.95 ± 0.295.49 ± 0.4816.70 ± 1.942.20 ± 0.39
Nonanoic acid54.164112-05-0ck5.97 ± 0.393.10 ± 0.42NDNDNDND2.50 ± 0.281.37 ± 0.15NDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Benzoic acid60.01465-85-0ck6.64 ± 1.034.46 ± 0.842.61 ± 0.42NDND2.82 ± 0.321.61 ± 0.15NDNDNDNDND
u2.29 ± 0.323.63 ± 0.351.81 ± 0.15ND2.35 ± 0.34NDNDNDNDNDNDND
Ketones
6-Methylhept-5-en-2-one17.057110-93-0ckNDND1.62 ± 0.30NDND3.21 ± 0.323.08 ± 0.43NDNDNDNDND
uNDNDNDND1.27 ± 0.20NDNDNDNDNDNDND
4-Methoxy-2,5-dimethylfuran-3(2H)-one29.5564077-47-8ck6.51 ± 1.021.23 ± 0.297.15 ± 0.857.93 ± 0.958.13 ± 1.9215.06 ± 1.7211.10 ± 2.023.88 ± 0.835.13 ± 0.319.07 ± 1.0918.34 ± 1.8425.39 ± 3.92
u2.96 ± 0.426.77 ± 0.532.95 ± 0.322.68 ± 0.2321.14 ± 0.2122.30 ± 0.242.90 ± 0.373.78 ± 0.743.70 ± 0.467.80 ± 0.9115.94 ± 1.3818.96 ± 2.73
Acetophenone32.30598-86-2ck1.82 ± 0.311.58 ± 0.15ND1.35 ± 0.11NDND2.63 ± 0.271.37 ± 0.251.68 ± 0.151.21 ± 0.16NDND
u1.63 ± 0.20ND1.33 ± 0.15ND3.70 ± 0.34NDNDND2.75 ± 0.251.78 ± 0.14ND2.46 ± 0.24
1,5-Ditert-butyl-3,3-dimethylbicyclo[3.1.0]hexan-2-one52.2919377-95-8ckNDNDNDNDNDNDNDNDNDNDNDND
u1.03 ± 0.23NDNDNDNDNDNDNDNDNDNDND
Noroxoagarofuran61.4625986-25-4ck7.01 ± 0.91NDNDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Terpenes
Alpha-pinene10.50780-56-8ckNDNDNDNDNDNDNDNDNDNDNDND
u3.08 ± 0.21NDNDNDNDNDNDNDNDNDNDND
Limonene11.635138-86-3ck3.77 ± 0.422.74 ± 0.232.23 ± 0.242.69 ± 0.412.99 ± 0.32ND2.70 ± 0.322.82 ± 0.442.20 ± 0.231.52 ± 0.181.78 ± 0.191.85 ± 0.21
u2.32 ± 0.211.98 ± 0.212.26 ± 0.222.17 ± 0.323.63 ± 0.34ND2.80 ± 0.262.38 ± 0.272.41 ± 0.211.97 ± 0.19ND2.85 ± 0.32
Cineole11.84470-82-6ck0.94 ± 0.19NDNDNDNDNDNDNDNDNDNDND
u0.67 ± 0.09NDNDNDNDNDNDNDNDNDNDND
(Z)-linalool oxide 23.2875989-33-3ck4.78 ± 0.451.81 ± 0.192.04 ± 0.293.09 ± 0.303.25 ± 0.312.80 ± 0.252.28 ± 0.242.32 ± 0.221.59 ± 0.191.54 ± 0.231.24 ± 0.211.41 ± 0.16
u2.84 ± 0.233.11 ± 0.423.07 ± 0.632.25 ± 0.326.28 ± 1.213.02 ± 0.532.40 ± 0.251.78 ± 0.431.52 ± 0.222.02 ± 0.312.21 ± 0.342.30 ± 0.26
Linalool27.13678-70-6ck71.84 ± 8.3979.58 ± 9.1092.75 ± 8.38106.58 ± 15.28128.36 ± 10.38118.83 ± 11.3976.83 ± 9.3888.51 ± 7.2958.72 ± 6.2971.46 ± 5.2948.91 ± 5.1067.09 ± 7.29
u81.28 ± 8.3982.59 ± 8.0363.70 ± 7.0387.37 ± 9.38143.52 ± 10.3998.11 ± 9.4895.42 ± 10.3791.23 ± 9.5788.64 ± 8.9391.31 ± 10.3979.19 ± 8.9491.41 ± 9.38
Terpinine-4-ol30.014562-74-3ck24.65 ± 2.9312.68 ± 1.2920.57 ± 3.026.16 ± 1.205.98 ± 0.8419.19 ± 2.3012.12 ± 1.2014.24 ± 1.629.18 ± 0.849.48 ± 0.727.35 ± 0.8216.40 ± 1.47
u20.84 ± 2.489.23 ± 1.2910.78 ± 1.473.80 ± 0.4816.04 ± 0.946.37 ± 0.739.87 ± 0.925.58 ± 0.5612.79 ± 0.7414.47 ± 1.375.67 ± 0.4618.68 ± 2.48
Menthol32.10389-78-1ck66.39 ± 5.837.32 ± 0.7836.04 ± 5.386.78 ± 1.365.06 ± 0.6720.06 ± 2.0414.03 ± 1.3713.26 ± 0.9510.61 ± 0.937.16 ± 0.455.02 ± 0.3529.99 ± 3.47
u21.10 ± 2.027.77 ± 0.768.77 ± 1.028.56 ± 0.8412.95 ± 1.27ND11.12 ± 1.405.00 ± 0.67ND12.22 ± 1.387.24 ± 0.8515.50 ± 0.92
Terpineol35.14298-55-5ck10.56 ± 1.283.86 ± 0.457.14 ± 0.74ND2.27 ± 0.32ND3.24 ± 0.423.59 ± 0.323.08 ± 0.312.56 ± 0.302.95 ± 0.295.95 ± 0.65
u5.91 ± 0.762.76 ± 0.343.33 ± 0.32ND7.44 ± 0.673.83 ± 0.43ND2.58 ± 0.353.61 ± 0.364.30 ± 0.545.05 ± 0.584.64 ± 0.32
Piperitone36.54689-81-6ck11.06 ± 1.48ND4.20 ± 0.74NDND4.45 ± 0.43NDNDNDNDND2.81 ± 0.53
u6.14 ± 0.74NDNDND4.28 ± 0.32NDNDNDND3.30 ± 0.43ND5.34 ± 0.56
Nerolidol50.7417212-44-4ck6.69 ± 0.781.48 ± 0.32ND5.89 ± 1.023.95 ± 0.437.89 ± 0.842.94 ± 0.322.51 ± 0.322.35 ± 0.211.62 ± 0.186.69 ± 0.78ND
u1.47 ± 0.174.12 ± 0.43ND2.04 ± 0.2319.19 ± 2.0120.30 ± 2.934.73 ± 0.434.44 ± 0.324.72 ± 0.566.02 ± 0.642.29 ± 0.3214.93 ± 1.42
Others
Toluene7.575108-88-3ck13.58 ± 1.2415.54 ± 1.6417.59 ± 2.8319.46 ± 2.8322.79 ± 2.73523.04 ± 2.6511.32 ± 1.279.55 ± 0.958.23 ± 0.757.49 ± 0.7410.86 ± 0.918.26 ± 1.38
u15.85 ± 1.5215.74 ± 1.3815.84 ± 1.7316.45 ± 1.8220.57 ± 2.7318.13 ± 2.1011.73 ± 1.0216.46 ± 1.2810.77 ± 0.948.86 ± 0.83ND8.67 ± 0.93
Ethylbenzene9.949100-41-4ck2.90 ± 0.34NDNDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Styrene13.093100-42-5ckNDND1.53 ± 0.20NDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDND1.16 ± 0.23ND
M-cymene13.318535-77-3ckNDNDNDNDNDNDNDNDND1.44 ± 0.21NDND
u1.55 ± 0.18NDNDNDNDNDNDNDNDNDNDND
P-cymene14.01199-87-6ck3.44 ± 0.452.57 ± 0.322.53 ± 0.231.92 ± 0.211.37 ± 0.192.52 ± 0.282.39 ± 0.291.52 ± 0.201.88 ± 0.31NDND1.70 ± 0.19
uND2.00 ± 0.291.63 ± 0.211.03 ± 0.191.99 ± 0.171.65 ± 0.151.92 ± 0.201.63 ± 0.181.97 ± 0.321.67 ± 0.272.57 ± 0.312.07 ± 0.29
1,3-Dimethyl-5-ethylbenzene14.052934-74-7ckNDND2.08 ± 0.28NDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
2,5-Dimethylpyrazine16.858123-32-0ck1.02 ± 0.09NDNDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
2-(2-Ethoxyethoxy)ethanol31.527111-90-0ck2.42 ± 0.28NDNDNDNDNDNDNDNDNDNDND
u1.21 ± 0.17ND1.43 ± 0.180.92 ± 0.08NDNDNDNDNDNDNDND
1-Methylnaphthalene42.35390-12-0ck0.34 ± 0.04NDNDNDNDNDNDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Butylated hydroxytoluene45.532128-37-0ck1.64 ± 0.26NDNDNDND4.72 ± 0.57NDND2.54 ± 0.21NDNDND
uNDNDNDND3.28 ± 0.324.57 ± 0.65NDND2.79 ± 0.21NDNDND
Benzothiazole47.41495-16-9ck1.96 ± 0.191.10 ± 0.141.31 ± 0.150.85 ± 0.11ND1.89 ± 0.181.03 ± 0.211.37 ± 0.132.14 ± 0.251.12 ± 0.211.09 ± 0.101.74 ± 0.15
u1.33 ± 0.210.92 ± 0.090.92 ± 0.10ND2.05 ± 0.211.43 ± 0.240.89 ± 0.100.91 ± 0.082.10 ± 0.281.62 ± 0.161.39 ± 0.181.73 ± 0.13
M-Cresol49.356108-39-4ckNDNDNDNDND1.68 ± 0.19NDNDNDNDNDND
uNDNDNDNDNDNDNDNDNDNDNDND
Phenol49.396108-95-2ck1.10 ± 0.190.63 ± 0.05NDNDNDNDNDNDNDNDNDND
u0.57 ± 0.04ND0.75 ± 0.10NDNDNDNDNDNDNDNDND
2,4-Di-t-butylphenol57.1696-76-4ck4.55 ± 0.560.92 ± 0.193.88 ± 0.41ND0.34 ± 0.051.32 ± 0.211.52 ± 0.140.97 ± 0.191.43 ± 0.17NDND0.87 ± 0.11
u1.80 ± 0.210.64 ± 0.170.53 ± 0.080.42 ± 0.050.93 ± 0.091.27 ± 0.14NDND1.41 ± 0.170.51 ± 0.04NDND
Ck: Control group, U: Ultrasonic group. ND means not detected.

References

  1. Liu, L.; Ji, M.L.; Chen, M.; Sun, M.Y.; Fu, X.L.; Li, L.; Gao, D.S.; Zhu, C.Y. The flavor and nutritional characteristic of four strawberry varieties cultured in soilless system. Food Sci. Nutr. 2016, 4, 858–868. [Google Scholar] [CrossRef] [PubMed]
  2. Zuñiga, P.E.; Castañeda, Y.; Arrey-Salas, O.; Fuentes, L.; Aburto, F.; Figueroa, C.R. Methyl Jasmonate Applications From Flowering to Ripe Fruit Stages of Strawberry (Fragaria × ananassa ‘Camarosa’) Reinforce the Fruit Antioxidant Response at Post-harvest. Front. Plant Sci. 2020, 11, 538. [Google Scholar] [CrossRef] [PubMed]
  3. Yan, J.W.; Ban, Z.J.; Lu, H.Y.; Li, D.; Poverenov, E.; Luo, Z.S.; Li, L. The aroma volatile repertoire in strawberry fruit: A review. J. Sci. Food Agric. 2018, 98, 4395–4402. [Google Scholar] [CrossRef] [PubMed]
  4. Feliziani, E.; Romanazzi, G. Postharvest decay of strawberry fruit: Etiology, epidemiology, and disease management. J. Berry Res. 2016, 6, 47–63. [Google Scholar] [CrossRef]
  5. Shen, F.; Zhang, B.; Cao, C.J.; Jiang, X.S. On-line discrimination of storage shelf-life and prediction of post-harvest quality for strawberry fruit by visible and near infrared spectroscopy. J. Food Process Eng. 2018, 41, e12866. [Google Scholar] [CrossRef]
  6. Feng, Y.B.; Suo, K.; Zhang, Y.; Yang, Z.F.; Zhou, C.S.; Shi, L.Y.; Chen, W.; Wang, J.C.; Wang, C.Y.; Zheng, Y.X. Ultrasound synergistic slightly acidic electrolyzed water treatment of grapes: Impacts on microbial loads, wettability, and postharvest storage quality. Ultrason. Sonochem. 2024, 103, 106751. [Google Scholar] [CrossRef]
  7. Zhang, J.Y.; Jiang, H.; Li, Y.T.; Wang, S.J.; Wang, B.; Xiao, J.S.; Cao, Y.P. Transcriptomic and physiological analysis reveals the possible mechanism of ultrasound inhibiting strawberry (Fragaria × ananassa Duch.) postharvest softening. Front. Nutr. 2022, 9, 1066043. [Google Scholar] [CrossRef] [PubMed]
  8. Lewers, K.S.; Newell, M.J.; Park, E.; Luo, Y.G. Consumer preference and physiochemical analyses of fresh strawberries from ten cultivars. Small Fruits Rev. 2020, 20, S733–S756. [Google Scholar] [CrossRef]
  9. Vallone, S.; Sivertsen, H.; Anthon, G.E.; Barrett, D.M.; Mitcham, E.J.; Ebeler, S.E.; Zakharov, F. An integrated approach for flavour quality evaluation in muskmelon (Cucumis melo L. reticulatus group) during ripening. Food Chem. 2013, 139, 171–183. [Google Scholar] [CrossRef]
  10. Kulkarni, R.S.; Chidley, H.G.; Pujari, K.H.; Giri, A.P.; Gupta, V.S. Geographic variation in the flavour volatiles of Alphonso mango. Food Chem. 2012, 130, 58–66. [Google Scholar] [CrossRef]
  11. Vandendriessche, T.; Geerts, P.; Membrebe, B.N.; Keulemans, J.; NicolaI, B.M.; Hertog, M. Journeys through aroma space: A novel approach towards the selection of aroma-enriched strawberry cultivars in breeding programmes. Plant Breed. 2013, 132, 217–223. [Google Scholar] [CrossRef]
  12. Oh, Y.; Barbey, C.R.; Chandra, S.; Bai, J.H.; Fan, Z.; Plotto, A.; Pillet, J.; Folta, K.M.; Whitaker, V.M.; Lee, S. Genomic Characterization of the Fruity Aroma Gene, FaFAD1, Reveals a Gene Dosage Effect on γ-Decalactone Production in Strawberry (Fragaria × ananassa). Front Plant Sci. 2021, 12, 639345. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, G.X.; Zhang, Y.T.; Dong, J.; Zhong, C.F.; Chang, L.L.; Wang, L.N. Study of volatile compound contents in a progeny issued from cross between ‘Camarosa’ and ‘Benihoppe’. Acta Hortic. 2012, 926, 65–71. [Google Scholar] [CrossRef]
  14. Aubert, C.; Bruaut, M.; Chalot, G.; Cottet, V. Impact of maturity stage at harvest on the main physicochemical characteristics, the levels of vitamin C, polyphenols and volatiles and the sensory quality of Gariguette strawberry. Eur. Food Res. Technol. 2021, 247, 37–49. [Google Scholar] [CrossRef]
  15. Abouelenein, D.; Acquaticci, L.; Alessandroni, L.; Borsetta, G.; Caprioli, G.; Mannozzi, C.; Marconi, R.; Piatti, D.; Santanatoglia, A.; Sagratini, G.; et al. Volatile Profile of Strawberry Fruits and Influence of Different Drying Methods on Their Aroma and Flavor: A Review. Molecules 2023, 28, 5810. [Google Scholar] [CrossRef] [PubMed]
  16. Rey Serra, P.; Mnejja, M.; Monfort, A. Inheritance of esters and other volatile compounds responsible for the fruity aroma in strawberry. Front Plant Sci. 2022, 13, 959155. [Google Scholar] [CrossRef] [PubMed]
  17. Jetti, R.R.; Yang, E.; Kurnianta, A.; Finn, C.; Qian, M.C. Quantification of selected aroma-active compounds in strawberries by headspace solid-phase microextraction gas chromatography and correlation with sensory descriptive analysis. J. Food Sci. 2007, 72, S487–S496. [Google Scholar] [CrossRef] [PubMed]
  18. Prat, L.; Espinoza, M.I.; Agosin, E.; Silva, H. Identification of volatile compounds associated with the aroma of white strawberries (Fragaria chiloensis). J. Sci. Food Agric. 2014, 94, 752–759. [Google Scholar] [CrossRef] [PubMed]
  19. Lixia, S.; Yinan, N.; Jianwen, W.; Yue, C.; Hongsheng, G. Characteristic-Aroma-Component-Based Evaluation and Classification of Strawberry Varieties by Aroma Type. Molecules 2021, 26, 6219. [Google Scholar] [CrossRef]
  20. Zhang, Y.Y.; Yin, X.R.; Xiao, Y.W.; Zhang, Z.Y.; Li, S.J.; Liu, X.F.; Zhang, B.; Yang, X.F.; Donald, G.; Jiang, G.H.; et al. An ethylene response factor-MYB transcription complex regulates furaneol biosynthesis by activating quinone oxidoreductase expression in strawberry. Plant Physiol. 2018, 178, 189–201. [Google Scholar] [CrossRef]
  21. Du, X.F.; Anne, P.; Elizabeth, B.; Russell, R. Evaluation of volatiles from two subtropical strawberry cultivars using GC-olfactometry, GC-MS odor activity values, and sensory analysis. J. Agric. Food Chem. 2011, 59, 12569–12577. [Google Scholar] [CrossRef]
  22. Gong, D.; Bi, Y.; Zong, Y.Y.; Li, Y.C.; Sionov, E.; Prusky, D. Characterization and sources of volatile organic compounds produced by postharvest pathogenic fungi colonized fruit. Postharvest Biol. Technol. 2022, 188, 111903. [Google Scholar] [CrossRef]
  23. Hou, X.L.; Jiang, J.M.; Luo, C.Q.; Latifur, R.; Li, X.Y.; Xie, X. Advances in detecting fruit aroma compounds by combining chromatography and spectrometry. J. Sci. Food Agric. 2023, 103, 4755–4766. [Google Scholar] [CrossRef] [PubMed]
  24. Pott, D.M.; Osorio, S.; Vallarino, J.G. From Central to Specialized Metabolism: An Overview of Some Secondary Compounds Derived From the Primary Metabolism for Their Role in Conferring Nutritional and Organoleptic Characteristics to Fruit. Front Plant Sci. 2019, 10, 835. [Google Scholar] [CrossRef]
  25. Vandendriessche, T.; Keulemans, J.; Geeraerd, A.; Nicolai, B.M.; Hertog, M.L.A.T.M. Evaluation of fast volatile analysis for detection of Botrytis cinerea infections in strawberry. Food Microbiol. 2012, 32, 406–414. [Google Scholar] [CrossRef] [PubMed]
  26. Aguiló-Aguayo, I.; Oms-Oliu, G.; Soliva-Fortuny, R.; Martín-Belloso, O. Flavour retention and related enzyme activities during storage of strawberry juices processed by high-intensity pulsed electric fields or heat. Food Chem. 2009, 116, 59–65. [Google Scholar] [CrossRef]
  27. Zannou, O.; Kelebek, H.; Selli, S. Elucidation of key odorants in Beninese Roselle (Hibiscus sabdariffa L. infusions prepared by hot and cold brewing. Food Res. Int. 2020, 133, 109133. [Google Scholar] [CrossRef]
  28. Parra-Palma, C.; Úbeda, C.; Gil, M.; Ramos, P.; Castro, R.I.; Morales-Quintana, L. Comparative study of the volatile organic compounds of four strawberry cultivars and it relation to alcohol acyltransferase enzymatic activity. Sci. Hortic. 2019, 251, 65–72. [Google Scholar] [CrossRef]
  29. Xu, H.S.; Quan, Q.; Chang, X.; Ge, S.; Xu, S.Q.; Wang, R.R.; Xu, Y.Q.; Luo, Z.S.; Shan, Y.; Ding, S.H. Maintaining the balance of fungal community through active packaging film makes strawberry fruit pose pleasant flavor during storage. Postharvest Biol. Technol. 2024, 211, 112815. [Google Scholar] [CrossRef]
  30. Liu, Q.; Ding, H.Z.; Zhang, T.T.; Zhou, D.D.; Zhu, T.; Pan, L.Q.; Ma, G.X.; Lan, W.J.; Zhao, S.Q.; Hu, Q.H.; et al. Effect on lipoxygenase pathway and flavor stabilization of postharvest strawberries by intense pulsed light treatment. Postharvest Biol. Technol. 2023, 204, 112472. [Google Scholar] [CrossRef]
  31. Hou, W.F.; Ma, Y.; Zhang, C.H.; Zhao, W.T.; Zhao, S.; Wang, P.; Zhao, X.Y.; Wang, D. Investigation on the inactivation effect and mechanism of Listeria monocytogenes in fresh-cut cucumber during storage by ultrasound combined with sodium hypochlorite. Ultrason. Sonochem. 2023, 101, 106706. [Google Scholar] [CrossRef] [PubMed]
  32. Adeboyejo, F.O.; Oyesanya, O.B. Ultrasound and autoclave-deacetylated Achatina fulica shell chitosan: Characterisation and effect on tomato and cucumber fruit qualities during storage. Food Chem. 2023, 415, 135750. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, R.Y.; Xing, L.J.; Kang, D.C.; Zhou, L.; Wang, L.; Zhang, W.G. Effects of ultrasound-assisted vacuum tumbling on the oxidation and physicochemical properties of pork myofibrillar proteins. Ultrason. Sonochem. 2021, 74, 105582. [Google Scholar] [CrossRef]
  34. Da Porto, C.; Decorti, D. Ultrasound-assisted extraction coupled with under vacuum distillation of flavour compounds from spearmint (carvone-rich) plants: Comparison with conventional hydrodistillation. Ultrason. Sonochem. 2009, 16, 795–799. [Google Scholar] [CrossRef] [PubMed]
  35. Bruna-Maynou, F.J.; Castro, R.; Rodríguez-Dodero, M.C.; Barroso, C.G.; Durán-Guerrero, E. Flavored Sherry vinegar with citric notes: Characterization and effect of ultrasound in the maceration of orange peels. Food Res. Int. 2020, 133, 795–799. [Google Scholar] [CrossRef] [PubMed]
  36. Singla, M.; Sit, N. Application of Ultrasound in Combination with Other Technologies in Food Processing: A Review. Ultrason. Sonochem. 2021, 73, 105506. [Google Scholar] [CrossRef] [PubMed]
  37. Alenyorege, E.A.; Ma, H. Removal of pesticides from fresh-cut Chinese cabbage (Brassica rapa var. chinensis L.) by sequential multi-frequency ultrasound cleaning treatments. Food Humanit. 2023, 1, 958–965. [Google Scholar] [CrossRef]
  38. Khandpur, P.; Gogate, P.R. Evaluation of ultrasound based sterilization approaches in terms of shelf life and quality parameters of fruit and vegetable juices. Ultrason. Sonochem. 2016, 29, 337–353. [Google Scholar] [CrossRef] [PubMed]
  39. Li, L.; Song, J.; Kalt, W.; Forney, C.; Tsao, R.; Pinto, D.; Chisholm, K.; Campbell, L.; Fillmore, S.; Li, X.H. Quantitative proteomic investigation employing stable isotope labeling by peptide dimethylation on proteins of strawberry fruit at different ripening stages. J. Proteom. 2013, 94, 219–239. [Google Scholar] [CrossRef] [PubMed]
  40. Pastrana, A.M.; Borrero, C.; Perez, A.G.; Aviles, M. Soilborne pathogens affect strawberry fruit flavor and quality. Plant Sci. 2022, 326, 111533. [Google Scholar] [CrossRef]
  41. Wang, K.H.; Qi, J.; Jin, Y.; Li, F.; Wang, J.; Xu, H.D. Influence of fruit maturity and lactic fermentation on physicochemical properties, phenolics, volatiles, and sensory of mulberry juice. Food Biosci. 2022, 48, 101782. [Google Scholar] [CrossRef]
  42. Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 1–21. [Google Scholar] [CrossRef] [PubMed]
  43. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 2002–2007. [Google Scholar] [CrossRef] [PubMed]
  44. Ulrich, D.; Kecke, S.; Olbricht, K. What Do We Know about the Chemistry of Strawberry Aroma? J. Agric. Food Chem. 2018, 66, 3291–3301. [Google Scholar] [CrossRef] [PubMed]
  45. Caleb, O.J.; Ilte, K.; Herppich, W.B.; Geyer, M.; Mahajan, P.V. Impacts of minimal processing and hot water dipping of ‘Sonata’ strawberries on volatiles emitted during storage. Sci. Hortic. 2019, 243, 385–391. [Google Scholar] [CrossRef]
  46. Waghmode, B.; Masoodi, L.; Kushwaha, K.; Iqbal Mir, J.; Sircar, D. Volatile components are non-invasive biomarkers to track shelf-life and nutritional changes in apple cv. ‘Golden Delicious’ during low temperature postharvest storage. J. Food Compos. Anal. 2021, 102, 104075. [Google Scholar] [CrossRef]
  47. Cai, H.F.; Han, S.; Jiang, L.; Yu, M.L.; Ma, R.J.; Yu, Z.F. Exogenous nitric oxide fumigation promoted the emission of volatile organic compounds in peach fruit during shelf life after long-term cold storage. Food Res. Int. 2020, 133, 109135. [Google Scholar] [CrossRef] [PubMed]
  48. Xu, Y.Q.; Luo, Z.S.; Charles, M.T.; Rolland, D.; Roussel, D. Pre-harvest UV-C irradiation triggers VOCs accumulation with alteration of antioxidant enzymes and phytohormones in strawberry leaves. J. Plant Physiol. 2017, 218, 265–274. [Google Scholar] [CrossRef]
  49. Padilla-Jimenez, S.M.; Angoa-Perez, M.V.; Mena-Violante, H.G.; Oyoque-Salcedo, G.; Montanez-Soto, J.L.; Oregel-Zamudio, E. Identification of Organic Volatile Markers Associated with Aroma during Maturation of Strawberry Fruits. Molecules 2021, 26, 504. [Google Scholar] [CrossRef]
  50. Severo, J.; de Oliveira, I.R.; Bott, R.; Le Bourvellec, C.; Renard, C.M.G.C.; Page, D.; Chaves, F.C.; Rombaldi, C.V. Preharvest UV-C radiation impacts strawberry metabolite content and volatile organic compound production. LWT-Food Sci. Technol. 2016, 85, 390–393. [Google Scholar] [CrossRef]
  51. Yang, W.B.; Liu, J.C.; Liu, H.; Zhang, Q.; Lv, Z.Z.; Jiao, Z.G. Characterization of strawberry purees fermented by Lactobacillus spp. based on nutrition and flavor profiles using LC-TOF/MS, HS-SPME-GC/MS and E-nose. LWT-Food Sci. Technol. 2023, 189, 115457. [Google Scholar] [CrossRef]
  52. Schiefner, A.; Sinz, Q.; Neumaier, I.; Schwab, W.; Skerra, A. Structural basis for the enzymatic formation of the key strawberry flavor compound 4-hydroxy-2,5-dimethyl-3(2H)-furanone. J. Biol. Chem. 2013, 288, 16815–16826. [Google Scholar] [CrossRef] [PubMed]
  53. Li, H.; Brouwer, B.; Oud, N.; Verdonk, J.C.; Tikunov, Y.; Woltering, E.; Schouten, R.; da Silva, F.P. Sensory, GC-MS and PTR-ToF-MS profiling of strawberries varying in maturity at harvest with subsequent cold storage. Postharvest Biol. Technol. 2021, 182, 111719. [Google Scholar] [CrossRef]
  54. Knudsen, J.T.; Eriksson, R.; Gershenzon, J.; Stahl, B. Diversity and Distribution of Floral Scent. Bot. Rev. 2006, 72, 1–120. [Google Scholar] [CrossRef]
  55. Gao, L.Y.; Chen, H.M.; Chen, W.X.; Chen, W.J.; Jian, H.Y.; Zhong, Q.P.; Zhang, M. Linalool against Hafnia alvei, its antibacterial mechanism revealed by metabolomic analyses. Food Biosci. 2023, 51, 102316. [Google Scholar] [CrossRef]
  56. Do, E.; Kim, M.; Ko, D.Y.; Lee, M.; Lee, C.; Ku, K.M. Machine learning for storage duration based on volatile organic compounds emitted from ‘Jukhyang’ and ‘Merry Queen’ strawberries during post-harvest storage. Postharvest Biol. Technol. 2024, 211, 112808. [Google Scholar] [CrossRef]
  57. Öz, A.T.; Ali, A. Retaining overall quality of fresh figs by postharvest hexanal vapor treatment during cold storage. Postharvest Biol. Technol. 2023, 205, 112539. [Google Scholar] [CrossRef]
  58. Qian, L.; Xiaoman, Z.; Yanli, X.; Jingmeng, L. Antifungal properties and mechanisms of three volatile aldehydes (octanal, nonanal and decanal) on Aspergillus flavus. Grain Oil Sci. Technol. 2021, 4, 131–140. [Google Scholar]
  59. Pelayo-Zaldivar, C.; Ben Abda, J.; Ebeler, S.E.; Kader, A.A. Quality and chemical changes associated with flavor of ‘Camarosa’ strawberries in response to a CO2-enriched atmosphere. HortScience 2007, 42, 299–303. [Google Scholar] [CrossRef]
  60. Liu, Y.P.; Liu, R.; Li, F.F.; Yu, S.M.; Nie, Y.F.; Li, J.Q.; Pan, C.P.; Zhu, W.T.; Zhou, Z.Q.; Diao, J.L. Nano-selenium repaired the damage caused by fungicides on strawberry flavor quality and antioxidant capacity by regulating ABA biosynthesis and ripening-related transcription factors. Pestic. Biochem. Physiol. 2024, 198, 105753. [Google Scholar] [CrossRef]
  61. Teixeira da Silva, J.A.; Hidvegi, N.; Gulyas, A.; Toth, B.; Dobranszki, J. Transcriptomic Response of In Vitro Potato (Solanum tuberosum L.) to Piezoelectric Ultrasound. Plant Mol. Biol. Rep. 2020, 38, 404–418. [Google Scholar] [CrossRef]
  62. Mishra, R.C.; Ghosh, R.; Bae, H. Plant acoustics: In the search of a sound mechanism for sound signaling in plants. J. Exp. Bot. 2016, 67, 4483–4494. [Google Scholar] [CrossRef] [PubMed]
  63. Dobranszki, J.; Hidvegi, N.; Gulyas, A.; Toth, B.; Teixeira da Silva, J.A. Abiotic stress elements in in vitro potato (Solanum tuberosum L.) exposed to air-based and liquid-based ultrasound: A comparative transcriptomic assessment. Prog. Biophys. Mol. Biol. 2020, 158, 47–56. [Google Scholar] [CrossRef] [PubMed]
  64. Song, F.Y.; Huangfu, Z.Q.; Han, Y.R.; Li, H.M.; Wang, Z.P.; Jin, X.W.; Chen, J.L. Nitric oxide fumigation can affect the metabolism of volatile compounds derived from analyses of fatty acids and amino acids in post-harvest flat peach during cold storage. Food Control 2024, 159, 110258. [Google Scholar] [CrossRef]
  65. Wang, Y.; Sun, Y.J.; Zhou, D.D.; Zhang, Q.; Pan, L.Q.; Tu, K. Transcriptomics analysis provides insights into metabolisms of sugars and carotenoids of nectarine fruit subjected to different temperature storage. Sci. Hortic. 2022, 304, 111262. [Google Scholar] [CrossRef]
  66. Schwab, W.; Davidovich-Rikanati, R.; Lewinsohn, E. Biosynthesis of plant-derived flavor compounds. Plant J. 2008, 54, 712–732. [Google Scholar] [CrossRef] [PubMed]
  67. Magalhaes, H.C.R.; Garruti, D.d.S.; Gandra, E.A.; Purgatto, E. Effect of Postharvest Treatments on the Biosynthesis of Fruit Volatile Compounds: A Literature Review. Curr. Nutr. Food Sci. 2023, 19, 246–261. [Google Scholar] [CrossRef]
  68. Aharoni, A.; Keizer, L.C.P.; Bouwmeester, H.J.; Sun, Z.K.; Alvarez-Huerta, M.; Verhoeven, H.A.; Blaas, J.; van Houwelingen, A.M.M.L.; De Vos, R.C.H.; van der Voet, H. Identification of the SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays. Plant Cell 2000, 12, 647–661. [Google Scholar] [CrossRef] [PubMed]
  69. Saez, D.; Rodríguez-Arriaza, F.; Urra, G.; Fabi, J.P.; Hormazábal-Abarza, F.; Méndez-Yáñez, A.; Castro, E.; Bustos, D.; Ramos, P.; Morales-Quintana, L. Unraveling the Key step in the Aroma Puzzle: Insights into Alcohol Acyltransferases in Strawberries. Plant Physiol. Biochem. 2024, 28, 108668. [Google Scholar] [CrossRef] [PubMed]
  70. Wang, Z.R.; He, D.N.; Gao, W.K.; Li, M.H.; Wu, X.E.; Lv, J.H. Integrated transcriptomic and metabolomic analyses of ‘Guifei’ mango fruit flavor in an endospermic genotype and a mutated genotype without endosperm. Sci. Hortic. 2022, 303, 111189. [Google Scholar] [CrossRef]
  71. Aharoni, A.; Verstappen, F.W.; Schwab, W.; Giri, A.P.; Bouwmeester, H.J. Gain and loss of fruit flavor compounds produced by wild and cultivated strawberry species. Abstr. Pap. Am. Chem. Soc. 2004, 228, U51. [Google Scholar] [CrossRef] [PubMed]
  72. Liu, W.J.; Zhang, Y.; Wang, L.; Bilal, A.; Shi, X.X.; Ren, Y.; Liang, C.; Zhang, X.K.; Zhang, Y.X.; Du, G.Q. Integrated transcriptome and metabolome analysis unveiled the mechanisms of xenia effect and the role of different pollens on aroma formation in ‘Yali’ pear (Pyrus bretschneideri Rehd). Sci. Hortic. 2023, 307, 111503. [Google Scholar] [CrossRef]
  73. Lunkenbein, S.; Salentijn, E.M.J.; Coiner, H.A.; Boone, M.J.; Krens, F.A.; Schwab, W. Up- and down-regulation of Fragaria x ananassa O-methyltransferase: Impacts on furanone and phenylpropanoid metabolism. J. Exp. Bot. 2006, 57, 2445–2453. [Google Scholar] [CrossRef] [PubMed]
  74. Liu, X.; Feng, Y.F.; Li, S.S.; Li, D.M.; Yu, J.; Zhao, Z.Y. Jasmonate-induced MdMYC2 improves fruit aroma during storage of ‘Ruixue’ apple based on transcriptomic, metabolic and functional analyses. LWT-Food Sci. Technol. 2023, 185, 115168. [Google Scholar] [CrossRef]
  75. Cai, H.F.; Han, S.; Jiang, L.; Yu, M.L.; Ma, R.J.; Yu, Z.F. 1-MCP treatment affects peach fruit aroma metabolism as revealed by transcriptomics and metabolite analyses. Food Res. Int. 2019, 122, 573–584. [Google Scholar] [CrossRef] [PubMed]
  76. Zhu, X.Y.; Song, Z.Y.; Li, Q.M.; Li, J.; Chen, W.X.; Li, X.P. Physiological and transcriptomic analysis reveals the roles of 1-MCP in the ripening and fruit aroma quality of banana fruit (Fenjiao). Food Res. Int. 2020, 130, 108968. [Google Scholar] [CrossRef] [PubMed]
  77. Xi, W.P.; Zhang, B.; Shen, J.Y.; Sun, C.D.; Xu, C.J.; Chen, K.S. Intermittent warming alleviated the loss of peach fruit aroma-related esters by regulation of AAT during cold storage. Postharvest Biol. Technol. 2012, 74, 42–48. [Google Scholar] [CrossRef]
  78. Lu, H.Y.; Luo, Z.S.; Li, D.; Jiang, Y.H.; Li, L. FaMYB11 promotes the accumulation of volatile esters by regulating FaLOX5 during strawberry (Fragaria × ananassa) ripening. Postharvest Biol. Technol. 2021, 178, 111560. [Google Scholar] [CrossRef]
Foods 13 02231 g001
Figure 1. Number of volatile organic components in strawberry fruit during storage. (a) Control group; (b) ultrasonic group.
Figure 1. Number of volatile organic components in strawberry fruit during storage. (a) Control group; (b) ultrasonic group.
Foods 13 02231 g001
Foods 13 02231 g002
Figure 2. Content of volatile organic components in strawberry fruit during storage. (a) Control group; (b) ultrasonic group.
Figure 2. Content of volatile organic components in strawberry fruit during storage. (a) Control group; (b) ultrasonic group.
Foods 13 02231 g002
Foods 13 02231 g003
Figure 3. Heatmap of key volatile compounds of strawberry from control and ultrasonic groups. Red color represents the higher expression level of the substances in the sample compared to the sample of ck0h, and blue represents the lower expression level.
Figure 3. Heatmap of key volatile compounds of strawberry from control and ultrasonic groups. Red color represents the higher expression level of the substances in the sample compared to the sample of ck0h, and blue represents the lower expression level.
Foods 13 02231 g003
Foods 13 02231 g004
Figure 4. Enrichment analysis of differentially expressed genes of strawberry after treatments. (a) Numbers of DEGs in KEGG pathway enrichment analysis of DEGs (|log2FC| > 1, p-adjust < 0.05) in strawberry fruit after ultrasound treatment. (b) Functional enrichment analysis of up-regulated DEGs. (c) Functional enrichment analysis of down-regulated DEGs. The column color gradient indicates the significance of enrichment, where Pvalue or Padjust < 0.001 is labeled ***, Pvalue or Padjust < 0.01 is labeled **, and Pvalue or Padjust < 0.05 is labeled *.
Figure 4. Enrichment analysis of differentially expressed genes of strawberry after treatments. (a) Numbers of DEGs in KEGG pathway enrichment analysis of DEGs (|log2FC| > 1, p-adjust < 0.05) in strawberry fruit after ultrasound treatment. (b) Functional enrichment analysis of up-regulated DEGs. (c) Functional enrichment analysis of down-regulated DEGs. The column color gradient indicates the significance of enrichment, where Pvalue or Padjust < 0.001 is labeled ***, Pvalue or Padjust < 0.01 is labeled **, and Pvalue or Padjust < 0.05 is labeled *.
Foods 13 02231 g004
Foods 13 02231 g005
Figure 5. (a) Schematic diagram of the synthesis mechanism of strawberry fruit volatile compounds. (b) The relative expression of gene transcripts related to the synthesis of volatile compounds in strawberry fruit from control and ultrasonic treatment.
Figure 5. (a) Schematic diagram of the synthesis mechanism of strawberry fruit volatile compounds. (b) The relative expression of gene transcripts related to the synthesis of volatile compounds in strawberry fruit from control and ultrasonic treatment.
Foods 13 02231 g005
Foods 13 02231 g006
Figure 6. The relative expression of genes related to volatile synthesis of strawberry fruits from the control and ultrasound treatment.
Figure 6. The relative expression of genes related to volatile synthesis of strawberry fruits from the control and ultrasound treatment.
Foods 13 02231 g006
Table 1. Primers used for real-time fluorescence quantitative PCR.
Table 1. Primers used for real-time fluorescence quantitative PCR.
Gene NameSequences
FaAATFGGGAGGACATCATGGATTG
RCTAGATTCACCCACGCTTC
FaOMTFCACCAGACACTAGCCTTGCC
RGGAATCCAGAACCCTTAGCC
FaQRFAACAATAGTAGGTCCAGCAA
RACATACAAGGGAAAGGAAA
FaNESFTGGGTCGTATGTAAGGTGC
RTGAATGATGCTGGAAATGG
Table 2. OAV value of 8 key aroma substance in strawberries.
Table 2. OAV value of 8 key aroma substance in strawberries.
NameThresholdStorage Time
Control Group0 h3 h6 h9 h12 h1 d2 d3 d6 d9 d12 d15 d
Hexanal54.123.912.993.545.693.986.395.413.616.873.344.30
Ethyl hexanoate55.134.314.195.802.7913.056.113.051.984.8813.8918.59
Hexan-1-ol5.61.801.650.750.460.840.620.422.220.430.511.290.53
Nonanal80.540.000.380.630.850.954.883.064.751.382.194.41
Linalool611.9713.2615.4617.7621.3919.8112.8014.759.7911.918.1511.18
4-Methoxy-2,5-dimethyl furan-3(2H)-one160.410.080.450.500.510.940.690.240.320.571.151.59
Nerolidol100.670.150.000.590.390.790.290.250.240.160.670.00
Ethyl cinnamate170.660.410.440.380.271.421.130.580.601.022.315.42
Ultrasonic Group0 h3 h6 h9 h12 h1 d2 d3 d6 d9 d12 d15 d
Hexanal53.405.604.484.696.273.504.643.764.467.214.734.63
Ethyl hexanoate55.004.844.757.848.477.405.915.723.708.2516.5720.74
Hexan-1-ol5.60.801.170.480.500.622.621.042.270.370.750.801.11
Nonanal80.550.000.000.401.460.932.756.673.254.331.305.20
Linalool613.5513.7610.6214.5623.9216.3515.9015.2114.7715.2213.2015.23
4-Methoxy-2,5-dimethyl furan-3(2H)-one160.180.420.180.171.321.390.180.240.230.491.001.18
Nerolidol100.150.410.000.201.922.030.470.440.470.600.231.49
Ethyl cinnamate170.570.330.350.421.091.600.640.890.811.866.026.28
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, Y.; Liu, S.; Kuang, H.; Zhang, J.; Wang, B.; Wang, S. Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest. Foods 2024, 13, 2231. https://doi.org/10.3390/foods13142231

AMA Style

Li Y, Liu S, Kuang H, Zhang J, Wang B, Wang S. Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest. Foods. 2024; 13(14):2231. https://doi.org/10.3390/foods13142231

Chicago/Turabian Style

Li, Yutong, Siyue Liu, Huiyu Kuang, Junyi Zhang, Bei Wang, and Shaojia Wang. 2024. "Transcriptomic and Physiological Analysis Reveals the Possible Mechanism of Inhibiting Strawberry Aroma Changes by Ultrasound after Harvest" Foods 13, no. 14: 2231. https://doi.org/10.3390/foods13142231

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop