Detection of Extended Spectrum ß-Lactamase-Producing Escherichia coli with Biofilm Formation from Chicken Meat in Istanbul
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Isolation and Identification of E. coli by Conventional Methods
2.3. Verification of E. coli Isolates by PCR
2.3.1. DNA Extraction
2.3.2. Confirmation of E. coli Isolates by PCR (16S rRNA)
2.4. Antibiotic Susceptibility Tests in E. coli Strains
2.4.1. Phenotypic Determination for Antibiotic Susceptibility in E. coli Strains
Screening for Antibiotic Susceptibility using Disc Diffusion Tests
Detection of ESBLs Using Double Disc Synergy Test
2.4.2. Genotypic Determination of Antibiotic Resistance Genes in E. coli Strains
Determination of ESBL Genes in E. coli Strains
Amplicon | Primer Sequence (5′→3′) | Band Size | Reference |
---|---|---|---|
blaSHV | 5′-CTTTATCGGCCCTCACTCAA-3′ 5′-AGGTGCTCATCATGGGAAAG-3′ | 237 | Fang et al. [25] |
blaTEM | 5′-CGCCGCATACACTATTCTCAGAATGA-3′ 5′-ACGCTCACCGGCTCCAGATTTAT-3′ | 445 | Monstein et al. [26] |
blaCTX-M | 5′-ATGTGCAGYACCAGTAARGTKATGGC-3′ 5′-TGGGTRAARTARGTSACCAGAAYCAGCGG-3′ | 593 | Boyd et al. [27] |
blaOXA | 5′-ACACAATACATATCAACTTCGC-3′ 5′-AGTGTGTTTAGAATGGTGATC-3′ | 813 | Quellette et al. [28] |
Detection of Carbapenem Resistance Genes in E. coli Strains
Detection of mcr Genes in E. coli Strains
2.5. Biofilm Formation Capability in E. coli Strains
3. Results and Discussion
3.1. Detection of E. coli in Chicken Meat Samples in Istanbul
3.2. Phenotypic Determination for Antibiotic Susceptibility in E. coli Strains
3.3. Genotypic Determination of Antibiotic Resistance Genes in E. coli Strains
3.4. Distribution of MDR in E. coli Strains
3.5. Biofilm Formation of E. coli and ESBL-Producing E. coli Strains
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Anjum, M.F.; Schmitt, H.; Börjesson, S.; Berendonk, T.U.; Donner, E.; Stehling, E.G.; Boerlin, P.; Topp, E.; Jardine, C.; Li, X.; et al. The Potential of Using E. coli as an Indicator for the Surveillance of Antimicrobial Resistance (AMR) in the Environment. Curr. Opin. Microbiol. 2021, 64, 152–158. [Google Scholar] [CrossRef]
- Peng, Z.; Hu, Z.; Li, Z.; Zhang, X.; Jia, C.; Li, T.; Dai, M.; Tan, C.; Xu, Z.; Wu, B. Antimicrobial Resistance and Population Genomics of Multidrug-Resistant Escherichia coli in Pig Farms in Mainland China. Nat. Commun. 2022, 13, 1116. [Google Scholar] [CrossRef] [PubMed]
- Baran, A.; Adıgüzel, M.; Yüksel, M. Prevalence of Antibiotic-Resistant and Extended-Spectrum Beta-Lactamase-Producing Escherichia coli in Chicken Meat from Eastern Turkey. Pak. Vet. J. 2020, 40, 355–359. [Google Scholar]
- Guven, G.; Kizil, S. Investigation of Antimicrobial Resistance of ESßL, Amp-C, and Carbapenemaseproducing E. coli Strains in Retail Poultry Meats. Turk. J. Vet. Anim. Sci. 2022, 46, 788–794. [Google Scholar] [CrossRef]
- WHO (World Health Organization). Global Action Plan on Antimicrobial Resistance. Available online: https://iris.who.int/bitstream/handle/10665/193736/9789241509763_eng.pdf?sequence=1 (accessed on 26 September 2022).
- Wibawati, P.A.; Hartadi, E.B.; Kartikasari, A.M.; Wardhana, D.K.; Abdramanov, A. Prevalence and Profile of Antimicrobial Resistance in Escherichia coli Isolated from Broiler Meat in East Java, Indonesia. Int. J. One Health 2023, 9, 27–31. [Google Scholar] [CrossRef]
- de Been, M.; Lanza, V.F.; de Toro, M.; Scharringa, J.; Dohmen, W.; Du, Y.; Hu, J.; Lei, Y.; Li, N.; Tooming-Klunderud, A. Dissemination of Cephalosporin Resistance Genes between Escherichia coli Strains from Farm Animals and Humans by Specific Plasmid Lineages. PLoS Genet. 2014, 10, e1004776. [Google Scholar] [CrossRef] [PubMed]
- Anaya, J.; Sánchez, R.M. 4—Four-Membered Ring Systems. In Progress in Heterocyclic Chemistry; Gribble, G.W., Joule, J.A., Eds.; Elsevier: Amsterdam, The Netherlands, 2021; Volume 33, pp. 53–91. [Google Scholar] [CrossRef]
- Rottier, W.C.; Ammerlaan, H.S.; Bonten, M.J. Effects of Confounders and Intermediates on the Association of Bacteraemia Caused by Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae and Patient Outcome: A Meta-Analysis. J. Antimicrob. Chemother. 2012, 67, 1311–1320. [Google Scholar] [CrossRef] [PubMed]
- Carattoli, A. Animal Reservoirs for Extended Spectrum β-Lactamase Producers. Clin. Microbiol. Infect. 2008, 14, 117–123. [Google Scholar] [CrossRef] [PubMed]
- Hussain, A.; Shaik, S.; Ranjan, A.; Nandanwar, N.; Tiwari, S.K.; Majid, M.; Baddam, R.; Qureshi, I.A.; Semmler, T.; Wieler, L.H. Risk of Transmission of Antimicrobial Resistant Escherichia coli from Commercial Broiler and Free-Range Retail Chicken in India. Front. Microbiol. 2017, 8, 2120. [Google Scholar] [CrossRef] [PubMed]
- Langkabel, N.; Burgard, J.; Freter, S.; Fries, R.; Meemken, D.; Ellerbroek, L. Detection of Extended-Spectrum β-Lactamase (ESBL) E. coli at Different Processing Stages in Three Broiler Abattoirs. Microorganisms 2023, 11, 2541. [Google Scholar] [CrossRef] [PubMed]
- Borges, C.A.; Tarlton, N.J.; Riley, L.W. Escherichia coli from Commercial Broiler and Backyard Chickens Share Sequence Types, Antimicrobial Resistance Profiles, and Resistance Genes with Human Extraintestinal Pathogenic Escherichia coli. Foodborne Pathog. Dis. 2019, 16, 813–822. [Google Scholar] [CrossRef] [PubMed]
- Kaesbohrer, A.; Bakran-Lebl, K.; Irrgang, A.; Fischer, J.; Kämpf, P.; Schiffmann, A.; Werckenthin, C.; Busch, M.; Kreienbrock, L.; Hille, K. Diversity in Prevalence and Characteristics of ESBL/pAmpC Producing E. coli in Food in Germany. Vet. Microbiol. 2019, 233, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Sudagidan, M.; Aydin, A. Screening virulence properties of staphylococci isolated from meat and meat products. Wien. Tieraerztl. Monatschr. 2008, 95, 128–134. [Google Scholar] [CrossRef]
- Plusa, T. The Importance of Biofilm in the Context of Increasing Bacterial Resistance to Antibiotics. Pol. Merkur. Lek. Organ Pol. Tow. Lek. 2019, 47, 197–202. [Google Scholar]
- Ciofu, O.; Beveridge, T.J.; Kadurugamuwa, J.; Walther-Rasmussen, J.; Høiby, N. Chromosomal β-Lactamase is Packaged into Membrane Vesicles and Secreted from Pseudomonas aeruginosa. J. Antimicrob. Chemother. 2000, 45, 9–13. [Google Scholar] [CrossRef] [PubMed]
- ISO 16649-2, 2001; Microbiology of the Food and Animal Feeding Stuffs—Horizontal Method for the Enumeration of Beta-Glucuronidase-Positive Escherichia coli—Part 2: Colony-Count Technique at 44 °C Using 5-bromo-4-chloro-3-ındolyl Beta-D-glucuronide. International Standardization Organization (ISO): Geneva, Switzerland, 2001.
- Liu, D.; Ainsworth, A.J.; Austin, F.W.; Lawrence, M.L. Use of PCR Primers Derived from a Putative Transcriptional Regulator Gene for Species-Specific Determination of Listeria monocytogenes. Int. J. Food Microbiol. 2004, 91, 297–304. [Google Scholar] [CrossRef] [PubMed]
- Schippa, S.; Iebba, V.; Barbato, M.; Di Nardo, G.; Totino, V.; Checchi, M.; Longhi, C.; Maiella, G.; Cucchiara, S.; Conte, M. A Distinctive “microbial Signature” in Celiac Pediatric Patients. BMC Microbiol. 2010, 10, 175. [Google Scholar] [CrossRef] [PubMed]
- EUCAST (European Committee on Antimicrobial Susceptibility Testing). Antimicrobial Susceptibility Testing EUCAST Disk Diffusion Method. Version 10.0. Available online: https://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Disk_test_documents/2022_manuals/Manual_v_10.0_EUCAST_Disk_Test_2022.pdf (accessed on 26 September 2023).
- EUCAST (European Committee on Antimicrobial Susceptibility Testing). Breakpoints Tables for Interpretation of MICs and Zone Diameters, Version 12.0. Available online: https://www.eucast.org/search (accessed on 26 September 2023).
- CLSI (Clinical and Laboratory Standards Institute). M100-Ed31 Performance Standards for Antimicrobial Susceptibility Testing, 31st ed.; Clinical and Laboratory Standards Institute: Malvern, PA, USA, 2021; ISBN 978-1-68440-105-5. [Google Scholar]
- EUCAST (European Committee on Antimicrobial Susceptibility Testing). EUCAST Guidelines for Detection of Resistance Mechanisms and Specific Resistances of Clinical and/or Epidemiological Importance, Version 2.0. Available online: http://www.eucast.org (accessed on 26 September 2023).
- Fang, H.; Lundberg, C.; Olsson-Liljequist, B.; Hedin, G.; Lindbäck, E.; Rosenberg, Å.; Struwe, J. Molecular Epidemiological Analysis of Escherichia coli Isolates Producing Extended-Spectrum β-Lactamases for Identification of Nosocomial Outbreaks in Stockholm, Sweden. J. Clin. Microbiol. 2004, 42, 5917–5920. [Google Scholar] [CrossRef] [PubMed]
- Monstein, H.-J.; Östholm-Balkhed, Å.; Nilsson, M.V.; Nilsson, M.; Dornbusch, K.; Nilsson, L.E. Multiplex PCR Amplification Assay for the Detection of blaSHV, blaTEM and blaCTX-M Genes in Enterobacteriaceae. APMIS 2007, 115, 1400–1408. [Google Scholar] [CrossRef] [PubMed]
- Boyd, D.A.; Tyler, S.; Christianson, S.; McGeer, A.; Muller, M.P.; Willey, B.M.; Bryce, E.; Gardam, M.; Nordmann, P.; Mulvey, M.R. Complete Nucleotide Sequence of a 92-Kilobase Plasmid Harboring the CTX-M-15 Extended-Spectrum Beta-Lactamase Involved in an Outbreak in Long-Term-Care Facilities in Toronto, Canada. Antimicrob. Agents Chemother. 2004, 48, 3758–3764. [Google Scholar] [CrossRef] [PubMed]
- Ouellette, M.; Bissonnette, L.; Roy, P.H. Precise Insertion of Antibiotic Resistance Determinants into Tn21-like Transposons: Nucleotide Sequence of the OXA-1 Beta-Lactamase Gene. Proc. Natl. Acad. Sci. USA 1987, 84, 7378–7382. [Google Scholar] [CrossRef] [PubMed]
- ECDC (European Centre for Disease Prevention and Control). Laboratory Manual for Carbapenem and Colistin Resistance Detection and Characterisation for the Survey of Carbapenem- and/or Colistin-Resistant Enterobacteriaceae—Version 2; European Centre for Disease Prevention and Control: Stockholm, Sweden, 2019.
- AbuOun, M.; Stubberfield, E.J.; Duggett, N.A.; Kirchner, M.; Dormer, L.; Nunez-Garcia, J.; Randall, L.P.; Lemma, F.; Crook, D.W.; Teale, C. Mcr-1 and Mcr-2 (Mcr-6.1) Variant Genes Identified in Moraxella Species Isolated from Pigs in Great Britain from 2014 to 2015. J. Antimicrob. Chemother. 2017, 72, 2745–2749. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.-Q.; Li, Y.-X.; Lei, C.-W.; Zhang, A.-Y.; Wang, H.-N. Novel Plasmid-Mediated Colistin Resistance Gene Mcr-7.1 in Klebsiella pneumoniae. J. Antimicrob. Chemother. 2018, 73, 1791–1795. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Wang, Y.; Zhou, Y.; Li, J.; Yin, W.; Wang, S.; Zhang, S.; Shen, J.; Shen, Z.; Wang, Y. Emergence of a Novel Mobile Colistin Resistance Gene, Mcr-8, in NDM-Producing Klebsiella pneumoniae. Emerg. Microbes Infect. 2018, 7, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Stepanović, S.; Djukić, V.; Djordjević, V.; Djukić, S. Influence of the Incubation Atmosphere on the Production of Biofilm by Staphylococci. Clin. Microbiol. Infect. 2003, 9, 955–958. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Gómez, P.; Trigal, E.; Alegría, Á.; Santos, J.A.; López, M.; Prieto, M.; Alvarez-Ordóñez, A. Biofilm Formation Ability and Tolerance to Food-Associated Stresses among ESBL-Producing Escherichia coli Strains from Foods of Animal Origin and Human Patients. LWT 2022, 168, 113961. [Google Scholar] [CrossRef]
- Dumen, E.; Aydin, A.; Issa, G. Prevalence, Serological Typing and PCR Sensitivity Comparison of Salmonella Typhimurium, Salmonella Enteritidis and Salmonella spp. Isolated from Raw Chicken Carcasses. Kafkas Üniv. Vet. Fakültesi Derg. 2015, 21, 653–658. [Google Scholar]
- TUIK (Turkish Statistical Institute). Poultry Animal Production 2021. Available online: https://data.tuik.gov.tr/Bulten/Index?p=Poultry-Production-December-2021-45689 (accessed on 26 November 2023).
- Önen, S.P.; Aslantaş, Ö.; Yılmaz, E.Ş.; Kürekci, C. Prevalence of β-Lactamase Producing Escherichia coli from Retail Meat in Turkey. J. Food. Sci. 2015, 80, M2023–M2029. [Google Scholar]
- İnat, G.; Sırıken, B.; Çiftci, A.; Erol, İ.; Başkan, C.; Yıldırım, T. Molecular Characterization of Extended-Spectrum β-Lactamases-Producing Enterobacteriaceae Species in Ground Beef and Chicken Meat. Int. J. Food Microbiol. 2023, 398, 110228. [Google Scholar] [CrossRef] [PubMed]
- ECDC (European Centre for Disease Prevention and Control). Antimicrobial Resistance Surveillance in Europe Annual Report of the European Antimicrobial Resistance Surveillance Network (EARS-Net); European Centre for Disease Prevention and Control: Stockholm, Sweden, 2017.
- Crecencio, R.B.; Brisola, M.C.; Bitner, D.; Frigo, A.; Rampazzo, L.; Borges, K.A.; Furian, T.Q.; Salle, C.T.; Moraes, H.L.; Faria, G.A. Antimicrobial Susceptibility, Biofilm Formation and Genetic Profiles of Escherichia coli Isolated from Retail Chicken Meat. Infect. Genet. Evol. 2020, 84, 104355. [Google Scholar] [CrossRef] [PubMed]
- Çil, G.İ.; Cengiz, G.; Arslan, B.; Şireli, U.T. Tavuk Eti Örneklerinde Genişlemiş Spektrumlu Beta-Laktamaz Üreten Escherichia coli Suşlarının Belirlenmesi (In Turkish). Eurasian J. Vet. Sci. 2020, 36, 187–192. [Google Scholar]
- Euromonitor International. Turkey. Available online: https://www.euromonitor.com/lodging-destination-in-turkey/report (accessed on 26 January 2024).
- Kola, A.; Kohler, C.; Pfeifer, Y.; Schwab, F.; Kühn, K.; Schulz, K.; Balau, V.; Breitbach, K.; Bast, A.; Witte, W. High Prevalence of Extended-Spectrum-β-Lactamase-Producing Enterobacteriaceae in Organic and Conventional Retail Chicken Meat, Germany. J. Antimicrob. Chemother. 2012, 67, 2631–2634. [Google Scholar] [CrossRef] [PubMed]
- Bilge, N.; Sezer, Ç.; Vatansever, L.; Önen, S.P. Occurrence and Molecular Characterization of Cephalosporin Resistant Escherichia coli Isolates from Chicken Meat. Kafkas Univ. Vet. Fak. Derg. 2020, 26, 463–468. [Google Scholar]
- Randall, L.P.; Horton, R.H.; Chanter, J.I.; Lemma, F.; Evans, S.J. A Decline in the Occurrence of Extended-Spectrum β-Lactamase-Producing Escherichia coli in Retail Chicken Meat in the UK between 2013 and 2018. J. Appl. Microbiol. 2021, 130, 247–257. [Google Scholar] [CrossRef]
- Süleymanoğlu, A.A.; Harun, A.; Aydin, A. Extended spectrum beta-lactamase with carbapenem and colistin resistance on Enterobacteriaceae strains. Bozok Vet. Sci. 2022, 3, 12–19. [Google Scholar]
- Kerluku, M.; Ratkova Manovska, M.; Prodanov, M.; Stojanovska-Dimzoska, B.; Hajrulai-Musliu, Z.; Jankuloski, D.; Blagoevska, K. Phenotypic and Genotypic Analysis of Antimicrobial Resistance of Commensal Escherichia coli from Dairy Cows’ Feces. Processes 2023, 11, 1929. [Google Scholar] [CrossRef]
- Ferreira, J.C.; Penha Filho, R.A.C.; Andrade, L.N.; Berchieri Junior, A.; Darini, A.L.C. Evaluation and Characterization of Plasmids Carrying CTX-M Genes in a Non-Clonal Population of Multidrug-Resistant Enterobacteriaceae Isolated from Poultry in Brazil. Diagn. Microbiol. Infect. Dis. 2016, 85, 444–448. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Primer Sequence (5′→3′) | Melting Temperature Tm (°C) | Product Size (bp) |
---|---|---|---|
blaOXA-48 | OXA_F 5′-TTGGTGGCATCGATTATCGG-3′ OXA_R 5′-GAGCACTTCTTTTGTGATGGC-3′ | 58 | 744 |
blaNDM | NDM_F 5′-TGGCAGCACACTTCCTATC-3′ NDM_R 5′-AGATTGCCGAGCGACTTG-3′ | 58 | 488 |
blaKPC | KPC_F 5′-CTGTCTTGTCTCTCATGGCC-3′ KPC_R 5′-CCTCGCTGTRCTTGTCATCC-3′ | 60 | 796 |
blaVIM | VIM_F: 5′-AGTGGTGAGTATCCGACAG-3′ VIM_R: 5′-TCAATCTCCGCGAGAAG-3′ | 52 | 212 |
Target Gene | Primer Sequence (5′→3′) | Melting Temperature Tm (°C) | Product Size (bp) |
---|---|---|---|
mcr-1 | AGTCCGTTTGTTCTTGTGGC AGATCCTTGGTCTCGGCTTG | 58 | 320 |
mcr-2 | CAAGTGTGTTGGTCGCAGTT TCTAGCCCGACAAGCATACC | 58 | 715 |
mcr-3 | AAATAAAAATTGTTCCGCTTATG AATGGAGATCCCCGTTTTT | 58 | 929 |
mcr-4 | TCACTTTCATCACTGCGTTG TTGGTCCATGACTACCAATG | 58 | 1116 |
mcr-5 | ATGCGGTTGTCTGCATTTATC TCATTGTGGTTGTCCTTTTCTG | 58 | 1644 |
Target Gene | Primer Sequence | Melting Temperature Tm (°C) | Product Size (bp) |
---|---|---|---|
mcr-6 | MCR-6F 5′-GTCCGGTCAATCCCTATCTGT-3′ MCR-6R 5′-ATCACGGGATTGACATAGCTAC-3′ | 55 | 556 |
mcr-7 | MCR-7F 5′-TGCTCAAGCCCTTCTTTTCGT-3′ MCR-7R 5′-TTCATCTGCGCCACCTCGT-3′ | 55 | 892 |
mcr-8 | MCR-8F 5′-AACCGCCAGAGCACAGAATT-3′ MCR-8R 5′-TTCCCCCAGCGATTCTCCAT-3′ | 60 | 667 |
Antibiotic Group | Name of Antibiotic | Distribution of E. coli Isolates According to CLSI [23] | Distribution of E. coli Isolates According to EUCAST [22] | ||
---|---|---|---|---|---|
R (%) | S (%) | R (%) | S (%) | ||
Aminoglycoside | Amikacin 30 µg | 0% (n = 0) | 100% (n = 101) | 6.9% (n = 7) | 93.7% (n = 94) |
Gentamicin 10 µg | 20.7% (n = 21) | 79.3% (n = 80) | 14.8% (n = 15) | 85.2% (n = 86) | |
Cephalosporins | Cefotaxime 30 µg | 35.6% (n = 36) | 74.4% (n = 65) | 17.8% (n = 18) | 82.2% (n = 83) |
Cefoxitin 30 µg | 5.9% (n = 6) | 94.1% (n = 95) | 11.8% (n = 11) | 88.2% (n = 90) | |
Ceftazidime 30 µg | 10.8% (n = 11) | 89.2% (n = 90) | 10.8% (n = 11) | 89.2% (n = 90) | |
Cefuroxime 30 µg | 19.8% (n = 20) | 80.2% (n = 81) | 26.7% (n = 27) | 73.3% (n = 74) | |
Carbapenems | Meropenem 10 µg | 34.6% (n = 35) | 65.4% (n = 66) | 33.6% (n = 34) | 66.4% (n = 67) |
Fluoroquinolones | Ciprofloxacin 5 µg | 45.5% (n = 46) | 54.5% (n = 55) | 45.5% (n = 46) | 54.5% (n = 55) |
Monobactam | Aztreonam 30 µg | 15.8% (n = 16) | 84.2% (n = 85) | 17.8% (n = 18) | 82.2% (n = 83) |
Nitrofuran | Nitrofurantoin 300 µg | 1.9% (n = 2) | 98.1% (n = 99) | 0.9% (n = 1) | 99.1% (n = 100) |
Penicillin | Ampicillin 10 µg | 78.2% (n = 79) | 21.8% (n = 22) | 78.2% (n = 79) | 21.8% (n = 22) |
Amoxicillin clavulanic acid 30 µg | 67.3% (n = 68) | 32.7% (n = 33) | 87.1% (n = 88) | 12.9% (n = 13) | |
Piperacillin-tazobactam 30 µg | 0% (n = 0) | 100% (n = 101) | 0% (n = 0) | 100% (n = 101) | |
Phenicol | Chloramphenicol 30 µg | 59.4% (n = 60) | 41.5% (n = 51) | 59.4% (n = 60) | 41.5% (n = 51) |
Sulfonamides | Trimethoprim-Sulfamethoxazole 25 µg | 52.4% (n = 53) | 47.5% (n = 48) | 52.4% (n = 53) | 47.5% (n = 48) |
Tetracyclines | Tetracycline 30 µg | 74.2% (n = 75) | 25.8% (n = 26) | * | * |
Antibiotic Group | Name of Antibiotic | Distribution of E. coli Isolates According to CLSI [23] | Distribution of E. coli Isolates According to EUCAST [22] | ||
---|---|---|---|---|---|
European Side R (%) (n = 58) | Asian Side R (%) (n = 43) | European Side R (%) (n = 58) | Asian Side R (%) (n = 43) | ||
Aminoglycoside | Amikacin 30 µg | 0% (n = 0) | 0% (n = 0) | 3.4% (n = 2) | 11.6% (n = 5) |
Gentamicin 10 µg | 18.9% (n = 11) | 23.2% (n = 10) | 12.1% (n = 7) | 18.6% (n = 8) | |
Cephalosporins | Cefotaxime 30 µg | 41.3% (n = 24) | 27.9% (n = 12) | 18.8% (n = 10) | 18.6% (n = 8) |
Cefoxitin 30 µg | 1.7% (n = 1) | 11.6% (n = 5) | 8.6% (n = 5) | 16.2% (n = 7) | |
Ceftazidime 30 µg | 5.1% (n = 3) | 18.6% (n = 8) | 5.1% (n = 3) | 18.6% (n = 8) | |
Cefuroxime 30 µg | 18.9% (n = 11) | 20.9% (n = 9) | 20.6% (n = 12) | 34.8% (n = 15) | |
Carbapenems | Meropenem 10 µg | 53.4% (n = 31) | 9.3% (n = 4) | 51.7% (n = 30) | 9.3% (n = 4) |
Fluoroquinolones | Ciprofloxacin 5 µg | 48.2% (n = 28) | 41.8% (n = 18) | 48.2% (n = 28) | 41.8% (n = 18) |
Monobactam | Aztreonam 30 µg | 13.7% (n = 8) | 18.6% (n = 8) | 13.7% (n = 8) | 18.6% (n = 10) |
Nitrofuran | Nitrofurantoin 300 µg | 0% (n = 0) | 4.6% (n = 2) | 0% (n = 0) | 2.3% (n = 1) |
Penicillin | Ampicillin 10 µg | 82.7% (n = 48) | 72.09% (n = 31) | 82.7% (n = 48) | 72.09% (n = 31) |
Amoxicillin clavulanic acid 30 µg | 62.06% (n = 36) | 74.4% (n = 32) | 79.3% (n = 46) | 97.6% (n = 42) | |
Piperacillin-tazobactam 30 µg | 0% (n = 0) | 0% (n = 0) | 0% (n = 0) | 0% (n = 0) | |
Phenicol | Chloramphenicol 30 µg | 51.7% (n = 30) | 69.7% (n = 30) | 51.7% (n = 30) | 69.7% (n = 30) |
Sulfonamid | Trimethoprim-Sulfamethoxazole 25 µg | 53.4% (n = 31) | 51.1% (n = 22) | 53.4% (n = 31) | 51.1% (n = 22) |
Tetracyclines | Tetracycline 30 µg | 74.1% (n = 43) | 74.4% (n = 32) | * | * |
E. coli Isolates Phenotypically Producing ESBL | CLSI [23] | EUCAST [22] | |||
---|---|---|---|---|---|
On Which Side of Istanbul the Sample Was Collected | E. coli Isolates Resistant to Two Antibiotics | Resistant to How Many Groups of Antibiotics? | E. coli Isolates Resistant to One Antibiotic | Resistant to How Many Groups of Antibiotics? | |
S007 | Europe | - | 6 (AMC,ATM,CTX,CAZ, SXT,TE,C,CXM,AMP) | - | 5 (AMC,ATM,CTX,CAZ,SXT, C,CXM,AMP) |
S024 | Europe | - | 3 (CTX,CIP,CXM,AMP) | - | 3 (CTX,CIP,CXM,AMP) |
S064 | Europe | - | 5 (CTX,CIP,TE,C,CXM, AMP) | - | 4 (CTX,CIP,TE,C,CXM,AMP) |
S074 | Europe | 2 (SXT, TE) | - | 1 (SXT) | - |
S081 | Europe | - | 6 (AMC,ATM,CTX,CIP,TE, C,CXM,AMP) | - | 5 (AMC,ATM CTX,CIP,TE,C, CXM,AMP) |
S086 | Europe | - | 7 (AMC,ATM,SXT,CTX, CIP, CN, C, CXM, AMP) | - | 7 (AMC,ATM,CTX,CIP,CN,C, CXM, AMP) |
S090 | Europe | - | 6 (AMP,ATM,CTX,SXT,TE,C,CXM,AMP) | - | 5 (AMP,ATM,CTX,CAZ,SXT,C,CXM,AMP) |
S092 | Europe | - | 6 (AMP,ATM,CTX,SXT,FOX,TE,C,CXM,AMP) | - | 5 (AMP,ATM,CTX,SXT,FOX,C,CXM,AMP) |
S100 | Europe | - | 7 (AMC,CTX,SXT,CN,CIP,TE,C,AMP) | - | 6 (AMC,CTX,SXT,CN,CIP,FOX,C,CXM,AMP) |
S115 | Asia | - | 8 (AMC,ATM,CTX,CAZ,SXT,CN,TE,C,CXM,AMP,MEM) | - | 7 (AMC,ATM,CTX,CAZ,SXT,CN,C,CXM,AMP,MEM) |
S116 | Asia | - | 7 (AMC,ATM,CTX,SXT,CN,TE,C,CXM,AMP) | - | 6 (AMC, ATM,CTX,SXT,CN,C,CXM,AMP) |
S118 | Asia | - | 9 (AMC,ATM,CTX,CAZ,CIP,SXT,CN,TE,C,CXM,AMP,MEM) | - | 8 (AMC,ATM,CTX,CAZ,CIP,SXT,CN,C,AK,CXM,AMP,MEM) |
S127 | Asia | - | 8 (AMC,ATM,CTX,SXT,CN,TE,C,CXM,AMP,MEM) | - | 7 (AMC, ATM,CTX,SXT,CN,C,CXM,AMP,MEM) |
S128 | Asia | - | 8 (AMC,ATM,CTX,SXT,CIP,TE,C,CXM,AMP,MEM) | - | 7 (AMC, ATM,CTX,SXT,CIP,C,CXM,AMP,MEM) |
S136 | Asia | - | 6 (AMC,ATM,CTX,TE,C,CXM,AMP,MEM) | - | 5 (AMC,ATM,CTX,C,CXM,AMP,MEM) |
S152 | Asia | - | 6 (AMC,CAZ,FOX,TE,C,CXM,AMP,MEM) | - | 5 (AMC,CAZ,FOX,C,CXM,AMP,MEM) |
S174 | Asia | - | 8 (AMC,ATM,CTX,SXT,CN,TE,C,CXM,AMP,MEM) | - | 7 (AMC,ATM,CTX,CAZ,SXT,CN,C,CXM,AMP,MEM) |
S191 | Asia | - | 9 (AMC,ATM,CAZ,CTX,CIP,SXT,CN,TE,C,CXM,AMP,MEM) | - | 8 (AMC,ATM,CAZ,CTX,CIP,SXT,CN,C,CXM,AMP,MEM) |
Medium | Number of Biofilm-Producing E. coli Isolated from Samples Collected in the European Side of Istanbul | Number of Biofilm-Producing E. coli Isolated from Samples Collected in the Asian Side of Istanbul |
---|---|---|
TSB | 17 (29.3%) | 12 (27.9%) |
BHI | 8 (13.7%) | 3 (6.9%) |
NB | 3 (5.1%) | 2 (4.6%) |
LB | 3 (5.1%) | 1 (2.3%) |
1% sucrose TSB | 32 (55.1%) | 12 (27.9%) |
0.6% yeast extract TSB | 19 (32.7%) | 12 (27.9%) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aydin, A.; Suleymanoglu, A.A.; Abdramanov, A.; Paulsen, P.; Dumen, E. Detection of Extended Spectrum ß-Lactamase-Producing Escherichia coli with Biofilm Formation from Chicken Meat in Istanbul. Foods 2024, 13, 1122. https://doi.org/10.3390/foods13071122
Aydin A, Suleymanoglu AA, Abdramanov A, Paulsen P, Dumen E. Detection of Extended Spectrum ß-Lactamase-Producing Escherichia coli with Biofilm Formation from Chicken Meat in Istanbul. Foods. 2024; 13(7):1122. https://doi.org/10.3390/foods13071122
Chicago/Turabian StyleAydin, Ali, Ali Anil Suleymanoglu, Abzal Abdramanov, Peter Paulsen, and Emek Dumen. 2024. "Detection of Extended Spectrum ß-Lactamase-Producing Escherichia coli with Biofilm Formation from Chicken Meat in Istanbul" Foods 13, no. 7: 1122. https://doi.org/10.3390/foods13071122