Next Article in Journal
Profiling the Gut Microbiota in Obese Children with Formula Feeding in Early Life and Selecting Strains against Obesity
Previous Article in Journal
Enzymatic Hydrolysis of Salmon Frame Proteins Using a Sequential Batch Operational Strategy: An Improvement in Water-Holding Capacity
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases

1
Key Laboratory of Bio-Resource and Eco-Environment of Ministry of Education, College of Life Sciences, Sichuan University, Chengdu 610017, China
2
Animal Disease Prevention and Food Safety Key Laboratory of Sichuan Province, Chengdu 610064, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work and considered as co-first authors.
Foods 2024, 13(9), 1380; https://doi.org/10.3390/foods13091380
Submission received: 1 April 2024 / Revised: 22 April 2024 / Accepted: 26 April 2024 / Published: 29 April 2024
(This article belongs to the Section Food Microbiology)

Abstract

:
Salmonella is a common foodborne pathogen that can cause food poisoning, posing a serious threat to human health. Therefore, quickly, sensitively, and accurately detecting Salmonella is crucial to ensuring food safety. For the Salmonella hilA gene, we designed Recombinase-aided amplification (RAA) primers and dsDNA-specific nuclease (DNase) probes. The ideal primer and probe combination was found when conditions were optimized. Under UV light, a visual Salmonella detection technique (RAA-dsDNase) was developed. Additionally, the RAA-dsDNase was modified to further reduce pollution hazards and simplify operations. One-pot RAA-dsDNase-UV or one-pot RAA-dsDNase-LFD was developed as a Salmonella detection method, using UV or a lateral flow dipstick (LFD) for result observation. Among them, one-pot RAA-dsDNase and one-pot RAA-dsDNase-LFD had detection times of 50 min and 60 min, respectively, for detecting Salmonella genomic DNA. One-pot RAA-dsDNase-UV had a detection limit of 101 copies/μL and 101 CFU/mL, while one-pot RAA-dsDNase-LFD had a sensitivity of 102 copies/μL and 102 CFU/mL. One-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD assays may identify 17 specific Salmonella serovars witho ut causing a cross-reaction with the remaining 8 bacteria, which include E. coli. Furthermore, Salmonella in tissue and milk samples has been reliably detected using both approaches. Overall, the detection method developed in this study can quickly, sensitively, and accurately detect Salmonella, and it is expected to become an important detection tool for the prevention and control of Salmonella in the future.

1. Introduction

Foodborne pathogen-induced infectious illnesses are considered a major global public health concern, posing serious risks to human and animal health and resulting in large financial losses [1,2,3]. Salmonella strains are considered the most common foodborne pathogen globally; they are primarily responsible for foodborne disease outbreaks and infections due to their natural environment frequency [4] and stability in food production and retail supply chains [5]. Salmonella is categorized as a moderate-to-serious risk pathogen by the World Health Organization [6], and it is estimated that it has resulted in over 80 million illnesses to date [7]. Thus, a quick, extremely sensitive, and easy-to-use detection technique is desperately needed to stop the spread of Salmonella.
For diagnosing Salmonella, conventional laboratory culture techniques were regarded as the “gold standard”. Unfortunately, those methods were extremely complicated and require several processes, including pre-enrichment, bacterial multiplication, and selective separation [8,9]. As a result, it used to take more than 3 days to obtain the desired results [10]. Salmonella detection has undergone a revolution with the development of nucleic acid amplification detection (NAAT) technology. NAAT-based techniques, such as polymerase chain reaction (PCR) [11], real-time quantitative PCR (qPCR) [12], and CRISPR/Cas13a [13] are now frequently used for Salmonella detection. Nevertheless, these techniques have intrinsic drawbacks that restrict the range of situations in which they can be used, such as the demand for costly machinery, strict environmental regulations, and skilled operators [14]. Moreover, loop-mediated isothermal amplification (LAMP) has been extensively utilized in the detection of Salmonella, although it necessitates an intricate primer design [15,16].
Recombinase-aided amplification (RAA) has a number of benefits, such as rapidity, low cost, high sensitivity, and the capacity to quickly amplify DNA at low temperatures (37–42 °C). In recent years, these characteristics have rendered RAA technology appropriate for the identification of viruses and bacteria [17,18]. Nevertheless, this method frequently calls for the addition of agarose gel electrophoresis, and even the RAA instruction manual states that the purification of RAA products is required prior to electrophoresis, which considerably reduces the sensitivity and speed of RAA detection. Numerous investigations have exhibited the possibility of utilizing RAA in conjunction with the CRISPR/Cas system to optimize detection sensitivity and efficiency while also accelerating the procedure [19,20]. However, the CRISPR/Cas technique usually necessitates pre-preparing crRNA and places more demands on the environment used for detection. As a result, the practical implementation of RAA in conjunction with other approaches is highly valuable for Salmonella identification.
Highly selective endonucleases, known as double-stranded DNA-specific nucleases (dsDNase), cleave phosphodiester bonds in double-stranded DNA to produce oligonucleotides with 3′-hydroxyl and 5′-phosphate termini. These enzymes cannot break down single-stranded DNA or RNA, but they are highly selective for double-stranded DNA [21]. In one investigation, the application of dsDNase was used to detect miRNA-10b and enhance the signal strength produced during the reaction [22]. As far as we are aware, no reports exist about RAA-dsDNAse target detection.
To identify Salmonella without requiring RNA in the reaction, we used dsDNase instead of CRISPR/Cas in this study and paired it with RAA, which simplified the environmental conditions needed for detection. The effectiveness of this technique depends on the choice of a suitable target for detection. Based on the information at hand, a number of genes, including invA, stn, opmC, fimA, iroB, agfA, and fimA, have been used to identify Salmonella. Nevertheless, some of these genes are absent from particular Salmonella strains, which reduces their specificity and limits the range of situations in which they can be used. According to the research, all invasive strains of Salmonella include the Salmonella Pathogenic Island 1 gene (SPI1), which is essential for Salmonella invasion. One important virulence component in Salmonella invasion and infection is SPI1. Among the positively transcribed regulatory genes encoded in SPI1 is the hilA gene [23,24]. Because it influences Salmonella colonization, the hilA gene is essential for the pathogenesis of Salmonella. The hilA gene is extremely unique to Salmonella and has not been found in any other Gram-negative bacteria [25]. Using PCR or LAMP techniques that target the hilA gene, some researchers have successfully developed Salmonella detection methods [26]. This implies that concentrating research efforts on the hilA gene is reasonable.
Combining RAA with dsDNase allowed us to create a novel Salmonella detection technique called RAA-dsDNase. One-pot detection refers to a simplified analytical approach that allows for the simultaneous detection and quantification of multiple analytes in a single reaction vessel, eliminating the need for separate sample preparation and multiple reaction steps. So, we developed the one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD procedures by placing an RAA and DNase reaction in a tube and observing the outcomes with UV and LFD.

2. Methods and Materials

2.1. Reagents and Materials

The primers and fluorescent probes used in this study were purified by high-performance liquid chromatography (HPLC) and synthesized by Sangon Biotechnology Co., Ltd. (Shanghai, China). The 2 X M5 HiPer Taq HiFi PCR mix (with blue dye) was purchased from Mei5 Biotechnology Co., Ltd. (Beijing, China). The supplier of the RAA kit was Hangzhou ZC Bio-Sci & Tech Co., Ltd. (Hangzhou, China). We bought the dsDNase from Yeasen Biotechnology Co., Ltd. (Shanghai, China) along with an RNase inhibitor. The supplier of the tissue DNA extraction kits and bacterial genomic DNA extraction kits was Tiangen Biochemical Technology Co., Ltd. (Beijing, China).

2.2. Bacterial Preparation and DNA Extraction

The bacteria used in this investigation were maintained in a freezer at −20 °C with 50% glycerol. Before being used, the bacteria were allowed to grow on Luria-Bertani (LB) media plates. A single colony was picked and transferred to LB liquid medium and grown in an incubator until the OD600 reached 0.8. At this stage, bacterial cells were used to extract DNA using a bacterial genomic DNA extraction kit.

2.3. Construction of Target Gene pMD19-T-hilA Vector

The hilA gene was PCR-amplified, separated on agarose gel electrophoresis, and the product was recovered. This insert was ligated to the pMD19-T vector to generate the pMD19-T-hilA construct (Figure S1).

2.4. Design and Screening of RAA Primers and dsDNAse Probes

To create the RAA primers and dsDNAse probes, a highly conserved gene sequence was chosen by retrieving and evaluating the conservation of the hilA gene in the NCBI database. In all, nine primer and two probe pairs were created, and primer and probe screening was performed, utilizing the hilA gene-containing plasmid as a template. The RAA reaction system was set up as follows: the RAA reaction dry powder tube was filled with 25 μL of A Buffer and 13.5 μL of ddH2O. After thorough mixing, the mixture was then evenly divided into five new Eppendorf (EP) tubes. Following this, 1 μL of the template and 0.4 μL of each of the downstream and upstream primers (10 μM) were added to each EP tube. Lastly, each EP tube cap was filled with 0.5 μL of B buffer, making a total reaction volume of 10 μL. The mixture was covered, gently inverted eight to ten times, and then centrifuged for 10 s at a low speed. For 40 min, the reactions were conducted at 37 °C. After the reaction, 2% agar gel electrophoresis was used to examine the RAA products, and the bands were observed under UV light. Primer combinations with bright, single bands were selected for additional testing. To make a total volume of 20 μL, the dsDNase reaction system was supplemented with water. It included 10 μL RAA products, 2 μL of 10× dsDNase buffer, 1 μL of probe (10 μM), 1 μL of dsDNAse, 2 μL of template DNA, or ddH2O. The reaction mixture was incubated for 10 min at 37 °C, and the outcomes were examined under UV light.

2.5. Establishment of RAA-dsDNase Detection Method

Primers F7R7 and probe-2 were used to create the RAA-dsDNase detection method. The reaction system and procedure were identical to those outlined above. As negative controls, the dsDNase reaction system without adding dsDNase and the RAA reaction system without adding the DNA template were employed.

2.6. RAA-dsDNase Reaction Condition Optimization

The RAA reaction system is completed prior to the degradation reaction of dsDNase and its reaction conditions are almost optimal. Hence, the primary goal was to optimize the conditions for the dsDNase degradation reaction. Unless otherwise noted, dsDNase had a 10 min reaction time. For optimizing the reaction buffer, we added 0 μL, 0.5 μL, and 1 μL of 10× dsDNase buffer to the dsDNase reaction system and assessed the impact of the amount of the buffer on the degradation ability of RAA-dsDNase. Dosage optimization for the dsDNase enzyme is required since the concentration of the enzyme directly influences its capacity for breakdown. Therefore, we introduced 0.5 μL, 0.75 μL, and 1 μL of dsDNase to the reaction systems. Each reaction system’s fluorescence intensity was measured under UV light after it had been reacting for 10 min at 37 °C. Reaction time optimization: Due to dsDNase’s own high capacity for target degradation, we measured the fluorescence intensity in the reaction system at 0, 5, and 10 min of the dsDNase reaction, respectively.

2.7. Sensitivity and Specificity Analysis of RAA-dsDNase and PCR Specificity Analysis

After the optimization of conditions, we conducted a sensitivity and specificity analysis of RAA-dsDNase. We used a continuous 10-fold dilution method, with pMD19-T-hilA plasmid and Salmonella typhimurium (ATCC14028) genomic DNA as templates, for the RAA-dsDNase sensitivity analysis. Additionally, the genomic DNA of eight additional bacterial species, including E. coli, and 17 serovars of Salmonella were utilized as templates for RAA-dsDNase and PCR analysis. The PCR reaction contained 10 μL of 2× PCR mix, 2 μL of genomic DNA, 0.5 μL of each of the upstream and downstream primers (10 μM), and 7 μL ddH2O. The PCR reaction proceeded as follows: 3 min of pre-denaturation at 94 °C, followed by 20 s of denaturation at 94 °C, 20 s of annealing at 56 °C, and 30 s of extension at 72 °C (35 cycles for last three steps). Finally, there was 5 min of final extension at 72 °C and eternal storage at 4 °C.

2.8. Establishment of One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD Detection Methods

Once the RAA-dsDNase specificity and sensitivity analysis is finished, the experiment will be made simpler and the chance of aerosol contamination from frequent lid opening and shutting will be decreased. In this investigation, an EP tube was concurrently filled with two RAA and dsDNase reaction systems. The RAA reaction system was positioned at the tube’s bottom, and the cap was filled with dsDNase, ssDNase probes, and ddH2O. Following the completion of the RAA reaction, a quick centrifugation was carried out, and the tube was turned upside down to thoroughly mix the two reaction systems. After that, incubation was carried out for 10 min at 37 °C. The outcomes were then identified as one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD, respectively.

2.9. Sensitivity and Specificity Analysis of One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD

In addition to adding the two reaction systems of RAA and dsDNase separately to the bottom and top of the EP tube, the sensitivity and specificity analysis process of one pot of RAA-dsDNase-UV and one pot of RAA-dsDNase-LFD was the same as steps outlined above. In addition, the two reaction systems of RAA and dsDNase separately were added to the bottom and top of the EP tube. Additionally, the 3′ modification of probe-2 was changed to biotin.

2.10. Detection of Salmonella in Real Samples

In order to test the practicality of one pot of RAA-dsDNase-UV and one pot of RAA-dsDNase-LFD in suspected Salmonella samples, we dissected clinically suspected Salmonella pullorum-infected chicks and retrieved tissue DNA from their organs, including the heart, liver, spleen, lungs, kidneys, and intestinal tissue. The main symptoms of chicks infected with chicken pullorum disease include lethargy, curling up, wings drooping, anorexia, and excretion of white viscous diarrhea. The necropsy results of sick chickens showed that the livers of these animals were enlarged, blackened, fragile, and accompanied by severe nodules. Then, we conducted analyses on Salmonella utilizing PCR, one-pot RAA-dsDNase-UV, one-pot RAA-dsDNase-LFD, and conventional bacterial isolation and culture techniques.
To further evaluate the practicality of one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD in food, we purchased commercial milk from a local supermarket and confirmed its freedom from Salmonella contamination through the plate counting method. Then, we added Salmonella serotypes such as S. enteritidis, S. thompson, S. typhimurium, S. derby, and S. infantis to the milk to simulate the natural contamination of Salmonella in milk, with a final concentration of 1 × 106 CFU/mL. Subsequently, bacterial genomic DNA was extracted and analyzed by one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD. Throughout the process, milk without Salmonella contamination was selected as a control.

3. Results

3.1. Design and Screening of RAA Primers and dsDNAse Probes

For the highly conserved sequences of the hilA gene in the NCBI database, nine pairs of RAA primers, one pair of PCR primers, and two ssDNA fluorescent probes were designed (Table 1). The electrophoresis results demonstrated that the amplification band corresponding to primer F7R7 was single and the brightest when the same quality of template DNA and consistent reaction conditions were used (Figure S2). Probe screening results revealed that there was no fluorescence in the control group and that the fluorescence intensity of the probe-2 group was much higher than that of the probe-1 group (Figure S3). For the purpose of the next experimental study, primer pair F7R7 and probe-2 were employed.

3.2. RAA-dsDNase Principle and Feasibility Analysis

The principle of detecting Salmonella by RAA-dsDNase method lies in massively amplifying Salmonella-specific genes using RAA technology. The fluorescent signal is released when the dsDNase breaks down the ssDNA fluorescent probe after it binds to the target region to produce a double strand (Figure 1A). We discovered that the RAA method worked well for large-scale gene amplification through feasibility analysis (Figure 1B). We then used dsDNase to analyze the degradation of ssDNA fluorescent probes. The findings demonstrated that in the absence of template DNA or dsDNase in the reaction system, fluorescence signals could not be seen (Figure 1C).

3.3. Optimization of Reaction Buffer

The reaction buffer must be optimized because variables in the reaction system, such as the concentration of magnesium ions, may have an impact on the activity of dsDNase. Amounts of 0, 0.5 μL, and 1 μL of 10× dsDNase buffer were added individually to the dsDNase reaction system. The findings demonstrated that there was no discernible variation in fluorescence intensity between the reaction systems, suggesting that the RAA-dsDNase reaction is not significantly impacted by 10× dsDNase buffer (Figure S4). As a result, it was not included in the RAA-dsDNase reaction that followed. This is primarily because all the ingredients needed for the dsDNase reaction are present in the RAA reaction buffer.

3.4. Optimization of dsDNase Dosage

The dsDNase activity is directly influenced by its dosage. Therefore, to maximize its maximum reaction activity and control the cost, we need to optimize the dosage of dsDNase. When dsDNase was at 1 μL, fluorescence intensity in the reaction system was significantly higher compared to 0.5 μL and 0.75 μL, suggesting that 1 μL of dsDNase is suitable for experiments (Figure S5).

3.5. Optimization of Reaction Time

Fluorescence probe cleavage may be incomplete if the dsDNase reaction time is too short; on the other hand, an excessive reaction time reduces detection efficiency. As a result, we ran our studies for three different durations: 0 min, 5 min, and 10 min. As a result, and as Figure S6 illustrates, fluorescence signals were strong at 5 and 10 min, with a small rise at the latter time. The 10 min reaction time was chosen for the following tests in order to guarantee the sensitivity of RAA-dsDNase.

3.6. Sensitivity and Specificity Analysis of RAA-dsDNase and PCR Specificity Analysis

Sensitivity investigation showed that the RAA-dsDNase reaction system exhibited strong fluorescence within the plasmids concentration range of 102 to 103 copies/μL. The fluorescence signal was modest but identifiable from the control group even at a plasmid concentration of 101 copies/μL (Figure 2A). RAA-dsDNase in bacterial genome testing revealed that, in comparison to 0 and 100 CFU/mL, the fluorescence intensity of bacteria with 102 and 101 CFUs was much higher (Figure 2B). Nevertheless, a discernible variation in fluorescence intensity between 0 and 101 CFU/mL is not visible to the unaided eye. The findings of the sensitivity investigation showed that the detection limit of RAA-dsDNase is 101 CFU/mL (bacteria) and 101 copies/μL (plasmid).
The RAA-dsDNase reaction system produced a significant fluorescence signal when Salmonella genomic DNA (Figure 2C, nos. 1–17) was used as the template, according to specificity analysis. No cross-reaction was seen between the other eight strains, including E. coli (Figure 2C, nos. 18–25). Similar results were obtained from PCR analysis; bands were generated in agarose gel electrophoresis only in the presence of Salmonella genomic DNA, while no bands were observed in other bacterial genomic DNA (Figure S7). Table S1 displays the strains that correspond to numbers 1 through 25. This supports the great specificity of the RAA-dsDNase results.

3.7. Establishment of One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD Detection Methods

We conducted a one-pot RAA-dsDNase experiment, which reduced the possibility of contamination and simplified the reaction process despite the high specificity and sensitivity of RAA-dsDNase. The findings were visualized using UV and LFD. The schematic diagram for a one-pot process is shown in Figure 3A. This method involved adding the fluorescent probe, ddH2O, and dsDNase to the tube lid after the RAA mixture was positioned at the tube’s bottom. Fluorescence or detection bands were only created in EP tubes containing DNA templates, as shown in Figure 3B,C. This indicates that the one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD procedures are feasible.

3.8. Sensitivity and Specificity Analysis of One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD

The detection limit of one-pot RAA-dsDNase-UV was determined by sensitivity analysis to be 101 copies/μL for plasmids and 101 CFU/mL for bacteria (Figure 4A,B). Additionally, Figure 4C,D show that the one-pot RAA-dsDNase-LFD detection limits were 102 copies/μL for plasmids and 102 CFU/mL for bacteria. The results of the specificity investigation were in perfect agreement with RAA-dsDNase (Figure 5).

3.9. Results of Salmonella Analysis in Tissues Using One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD

Suspected tissue samples of chickens infected with Salmonella pullorum were evaluated using one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD, PCR, and conventional bacterial isolation culture after specificity and sensitivity tests were finished. The clinical autopsy of dead chickens shows that their livers are more fragile, with many nodules on the surface and a noticeably darker color (Figure 6A). Bacterial isolation and culture results showed that the isolated strain conforms to the typical morphology of Salmonella pullorum on XLT-4 agar medium (Figure 6B). A substantial fluorescent signal was obtained when ill chicken tissue samples were analyzed using one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD. On the other hand, when applied to tissue samples from healthy chickens, neither technique produced any fluorescence (Figure 6C). When PCR and agarose gel electrophoresis were used to examine the tissue samples of sick hens, specific bands were seen; however, no discernible bands were seen in the samples from healthy chickens (Figure 6D).

3.10. Results of Salmonella Analysis in Milk Using One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD

The detection results of Salmonella in milk using one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD showed that when Salmonella contamination was present in the milk, both methods produced clear fluorescent signals or detection bands, indicating that one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD can be used for the detection of Salmonella in food (Figure 6E).

4. Discussion

Salmonella is a highly prevalent food-borne pathogen that can cause poisoning in both humans and animals, which can lead to the spread of drug resistance and result in serious economic losses. This has become a global public health problem [27,28,29]. Currently, over 2600 serovars of Salmonella have been reported [30], which poses a significant challenge to the prevention and control of Salmonella owing to the large number of serotypes and the extensive detection efforts required. In recent years, DNA molecular detection techniques such as PCR (RT-PCR) [31], LAMP [32], RPA [33], and CRISPR/Cas [34] have been widely developed for Salmonella diagnosis. However, these methods have some limitations, such as the need for expensive equipment, professional personnel, complex primer designs, and the participation of RNA in the detection process. Therefore, the development of a simple, visible process that does not require high environmental requirements and can detect multiple Salmonella serotypes is of great significance for Salmonella prevention and control.
The hilA gene, a virulence regulator that plays a crucial role in the regulation of SPI-1, is a unique feature of Salmonella species and is absent in other Gram-negative bacteria. The up-regulation of this gene has been linked to enhanced colonization or organ invasion [25], and some studies have utilized Salmonella enteritidis lacking the hilA gene to create attenuated vaccine strains [35]. Previous studies have shown that PCR detection methods targeting the hilA gene have high specificity for Salmonella [36]. Another study successfully differentiated 83 different serovars of Salmonella and 22 non-Salmonella strains by targeting the hilA gene. A study that evaluated the suitability of targeting different genes (agfA, sef, spvC, and hilA) for salmonella detection showed that PCR methods targeting the hilA gene were all positive for Salmonella [37]. Based on these findings, it can be inferred that hilA serves as a highly specific target for Salmonella detection.
This work provided a new approach for detecting Salmonella by combining RAA with dsDNase. Large-scale Salmonella hilA gene amplification was accomplished quickly and effectively using RAA technology. Remarkably, a fluorescent signal was then released when the fluorescent probe and target complex were broken up by dsDNase. In order to establish visual one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD, the results were seen under UV and LFD. One-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD had detection limits for Salmonella DNA of 101 CFU/mL (50 min) and 102 CFU/mL (60 min), respectively. The technique for detecting Salmonella that was developed in this work can be used to identify Salmonella without causing cross-reactivity with other strains, such as E. coli. Additionally, they have been effective in identifying Salmonella in chick tissue samples and milk.
Numerous techniques for identifying Salmonella have been developed as research advances. In this study, we compared the detection method developed by us with other Salmonella detection methods by referring to the expression method of Li et al. [38] (Table S2). Traditional cultivation methods are regarded as the gold standard for Salmonella detection, yet they are cumbersome, time-consuming, and have limited sensitivity [39,40]. The ELISA is a commonly used approach for detecting Salmonella; however, the manufacture of its antibody is rather challenging [41,42]. The PCR/RT-PCR technique is simple and effective, but it requires expensive equipment and is prone to contamination [43,44]. Although LAMP for Salmonella detection has an easy-to-use interface and effective amplification, it has drawbacks such as complicated primer construction and the possibility of false positives [45]. Simpleness, quick detection, and high specificity are among the advantages of CRISPR/Cas12a or Cas13a. However, PAM site limits in sgRNA design, strict sample processing requirements, and false positives/negatives make it faulty [46,47,48,49]. In comparison to the other approaches, RAA-dsDNase provides simplicity, speed, sensitivity, cost-effectiveness, and PAM site versatility, making it a viable option for Salmonella detection.
In conclusion, this study targeted the Salmonella hliA gene and constructed a rapid, highly sensitive, and specific one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD Salmonella detection strategy based on RAA combined with dsDNase for the first time.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/foods13091380/s1, Figure S1: pMD19-T-hilA plasmid map; Figure S2: RAA primer screening. Amplification of the target hilA gene using RAA under the same conditions, followed by analysis of the amplification products using 2% agarose gel electrophoresis; Figure S3: ssDNA fluorescent probe screening screening. Fluorescent probe screening: Probe 1 and Probe 2 were added to the reaction system, and it was observed that Probe 2 exhibited significantly stronger fluorescence than Probe 1 under UV light; Figure S4: Optimization of reaction buffer. 0, 0.5 μL, and 1 μL of 10x dsDNase buffer were added to the reaction system, and no significant difference in fluorescence intensity was observed under UV light; Figure S5: Optimization of dsDNase dosage. 0.5 μL, 0.75 μL, and 1 μL of dsDNase were added to the reaction system, and the maximum fluorescence intensity was observed when 1 μL of dsDNase was added; Figure S6: Optimization of reaction time. Fluorescence intensity is significantly higher at 5 minutes and 10 minutes after dsDNase treatment compared to 0 minutes, reaching the highest value at 10 minutes; Figure S7: PCR detection of Salmonella and other strains. Strain numbers correspond to the details in Table S1; Table S1: Bacteria strains used in this study. Table S2: Comparation of the RAA-dsDNase with other assays for Salmonella detecting. Refs. [50,51,52,53] are cited in Supplementary Materials.

Author Contributions

C.Z.: Data curation, Methodology, Software, Visualization, Writing—original draft. Y.Z.: Data curation, Software, Writing—original draft. B.G.: Investigation, Methodology, Software. M.Y.: Data curation, Methodology, Resources. Q.X.: Software, Data curation, Resources. C.L.: Conceptualization, Writing—review and editing. H.W.: Funding acquisition, Writing—review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (Grant numbers 2022YFC2303900 and 2022YFD1800400), National Natural Science Foundation of China (grant number U21A20257), and the Sichuan Science and Technology Program (2021ZDZX0010).

Institutional Review Board Statement

This article does not contain any studies with human participants or animals performed by any of the authors.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article/Supplementary Materials, further inquiries can be directed to the corresponding author.

Conflicts of Interest

The author declares no competing interests.

References

  1. Gao, W.; Huang, H.; Zhu, P.; Yan, X.; Fan, J.; Jiang, J.; Xu, J. Recombinase polymerase amplification combined with lateral flow dipstick for equipment-free detection of Salmonella in shellfish. Bioprocess Biosyst. Eng. 2018, 41, 603–611. [Google Scholar] [CrossRef] [PubMed]
  2. Xue, L.; Guo, R.; Huang, F.; Qi, W.; Liu, Y.; Cai, G.; Lin, J. An impedance biosensor based on magnetic nanobead net and MnO2 nanoflowers for rapid and sensitive detection of foodborne bacteria. Biosens. Bioelectron. 2020, 173, 112800. [Google Scholar]
  3. Delibato, E.; Volpe, G.; Romanazzo, D.; De Medici, D.; Toti, L.; Moscone, D.; Palleschi, G. Development and application of an electrochemical plate coupled with immunomagnetic beads (ELIME) array for Salmonella enterica detection in meat samples. J. Agric. Food Chem. 2009, 57, 7200–7204. [Google Scholar] [CrossRef] [PubMed]
  4. Jarvis, N.A.; O’Bryan, C.A.; Dawoud, T.M.; Park, S.H.; Kwon, Y.M.; Crandall, P.G.; Ricke, S.C. An overview of Salmonella thermal destruction during food processing and preparation. Food Control 2016, 68, 280–290. [Google Scholar] [CrossRef]
  5. Shen, Y.; Xu, L.; Li, Y. Biosensors for rapid detection of Salmonella in food: A review. Compr. Rev. Food Sci. Food Saf. 2021, 20, 149–197. [Google Scholar] [CrossRef] [PubMed]
  6. Fang, J.; Wu, Y.; Qu, D.; Ma, B.; Yu, X.; Zhang, M.; Han, J. Propidium monoazide real-time loop-mediated isothermal amplification for specific visualization of viable Salmonella in food. Lett. Appl. Microbiol. 2018, 67, 79–88. [Google Scholar] [CrossRef] [PubMed]
  7. Zhao, L.; Wang, J.; Sun, X.X.; Wang, J.; Chen, Z.; Xu, X.; Dong, M.; Guo, Y.N.; Wang, Y.; Chen, P.; et al. Development and Evaluation of the Rapid and Sensitive RPA Assays for Specific Detection of Salmonella spp. in Food Samples. Front. Cell. Infect. Microbiol. 2021, 11, 631921. [Google Scholar] [CrossRef] [PubMed]
  8. Mei, X.; Zhai, X.; Lei, C.; Ye, X.; Kang, Z.; Wu, X.; Xiang, R.; Wang, Y.; Wang, H. Development and application of a visual loop-mediated isothermal amplification combined with lateral flow dipstick (LAMP-LFD) method for rapid detection of Salmonella strains in food samples. Food Control 2019, 104, 9–19. [Google Scholar] [CrossRef]
  9. Margot, H.; Stephan, R.; O’Mahony, E.; Iversen, C. Comparison of rapid cultural methods for the detection of Salmonella species. Int. J. Food Microbiol. 2013, 163, 47–50. [Google Scholar] [CrossRef] [PubMed]
  10. Hong, H.; Sun, C.; Wei, S.; Sun, X.; Mutukumira, A.; Wu, X. Development of a real-time recombinase polymerase amplification assay for rapid detection of Salmonella in powdered infant formula. Int. Dairy J. 2020, 102, 104579. [Google Scholar] [CrossRef]
  11. Vinayaka, A.C.; Ngo, T.A.; Kant, K.; Engelsmann, P.; Dave, V.P.; Shahbazi, M.A.; Wolff, A.; Bang, D.D. Rapid detection of Salmonella enterica in food samples by a novel approach with combination of sample concentration and direct PCR. Biosens. Bioelectron. 2019, 129, 224–230. [Google Scholar] [CrossRef]
  12. Muñoz, N.; Diaz-Osorio, M.; Moreno, J.; Sánchez-Jiménez, M.; Cardona-Castro, N. Development and evaluation of a multiplex real-time polymerase chain reaction procedure to clinically type prevalent Salmonella enterica serovars. J. Mol. Diagn. JMD 2010, 12, 220–225. [Google Scholar] [CrossRef] [PubMed]
  13. Shen, J.; Zhou, X.; Shan, Y.; Yue, H.; Huang, R.; Hu, J.; Xing, D. Sensitive detection of a bacterial pathogen using allosteric probe-initiated catalysis and CRISPR-Cas13a amplification reaction. Nat. Commun. 2020, 11, 267. [Google Scholar] [CrossRef]
  14. An, B.; Zhang, H.; Su, X.; Guo, Y.; Wu, T.; Ge, Y.; Zhu, F.; Cui, L. Rapid and Sensitive Detection of Salmonella spp. Using CRISPR-Cas13a Combined With Recombinase Polymerase Amplification. Front. Microbiol. 2021, 12, 732426. [Google Scholar] [CrossRef]
  15. Lamas, A.; Santos, S.B.; Prado, M.; Garrido-Maestu, A. Phage amplification coupled with loop-mediated isothermal amplification (PA-LAMP) for same-day detection of viable Salmonella Enteritidis in raw poultry meat. Food Microbiol. 2023, 115, 104341. [Google Scholar] [CrossRef]
  16. da Silva, E.C.; de Oliveira, C.D.; Ribeiro, L.F.M.; Casas, M.R.T.; Pereira, J.G.; Possebon, F.S.; Junior, J.P.A. Salmonella detection with LAMP and qPCR and identification of serovars of interest by multiplex qPCR in poultry carcasses. Braz. J. Microbiol. [Publ. Braz. Soc. Microbiol.] 2023, 54, 2173–2182. [Google Scholar] [CrossRef]
  17. Zhu, L.; Liang, Z.; Xu, Y.; Chen, Z.; Wang, J.; Zhou, L. Ultrasensitive and Rapid Visual Detection of Escherichia coli O157:H7 Based on RAA-CRISPR/Cas12a System. Biosensors 2023, 13, 659. [Google Scholar] [CrossRef]
  18. Tian, Y.; Fan, Z.; Xu, L.; Cao, Y.; Chen, S.; Pan, Z.; Gao, Y.; Li, H.; Zheng, S.; Ma, Y.; et al. CRISPR/Cas13a-assisted rapid and portable HBV DNA detection for low-level viremia patients. Emerg. Microbes Infect. 2023, 12, e2177088. [Google Scholar] [CrossRef]
  19. Li, F.; Ye, Q.; Chen, M.; Zhou, B.; Zhang, J.; Pang, R.; Xue, L.; Wang, J.; Zeng, H.; Wu, S.; et al. An ultrasensitive CRISPR/Cas12a based electrochemical biosensor for Listeria monocytogenes detection. Biosens. Bioelectron. 2021, 179, 113073. [Google Scholar] [CrossRef]
  20. Zhang, X.; He, X.; Zhang, Y.; Chen, L.; Pan, Z.; Huang, Y.; Li, H. A new method for the detection of Mycobacterium tuberculosis based on the CRISPR/Cas system. BMC Infect. Dis. 2023, 23, 680. [Google Scholar] [CrossRef]
  21. Liu, W.; Yue, S.; Zheng, X.; Hu, M.; Cao, J.; Zheng, Y. aFARP-ChIP-seq, a convenient and reliable method for genome profiling in as few as 100 cells with a capability for multiplexing ChIP-seq. Epigenetics 2019, 14, 877–893. [Google Scholar] [CrossRef] [PubMed]
  22. Robertson, N.M.; Toscano, A.E.; LaMantia, V.E.; Hizir, M.S.; Rana, M.; Balcioglu, M.; Sheng, J.; Yigit, M.V. Unlocked Nucleic Acids for miRNA detection using two dimensional nano-graphene oxide. Biosens. Bioelectron. 2017, 89, 551–557. [Google Scholar] [CrossRef] [PubMed]
  23. Fahlen, T.F.; Mathur, N.; Jones, B.D. Identification and characterization of mutants with increased expression of hilA, the invasion gene transcriptional activator of Salmonella typhimurium. FEMS Immunol. Med. Microbiol. 2000, 28, 25–35. [Google Scholar] [CrossRef] [PubMed]
  24. Chu, J.; Shin, J.; Kang, S.; Shin, S.; Chung, Y.J. Rapid and sensitive detection of Salmonella species targeting the hilA gene using a loop-mediated isothermal amplification assay. Genom. Inform. 2023, 19, e30. [Google Scholar] [CrossRef] [PubMed]
  25. Bajaj, V.; Hwang, C.; Lee, C.A. hilA is a novel ompR/toxR family member that activates the expression of Salmonella typhimurium invasion genes. Mol. Microbiol. 1995, 18, 715–727. [Google Scholar] [CrossRef] [PubMed]
  26. Pathmanathan, S.G.; Cardona-Castro, N.; Sánchez-Jiménez, M.M.; Correa-Ochoa, M.M.; Puthucheary, S.D.; Thong, K.L. Simple and rapid detection of Salmonella strains by direct PCR amplification of the hilA gene. J. Med. Microbiol. 2003, 52, 773–776. [Google Scholar] [CrossRef] [PubMed]
  27. Koulenti, D.; Song, A.; Ellingboe, A.; Abdul-Aziz, M.H.; Harris, P.; Gavey, E.; Lipman, J. Infections by multidrug-resistant Gram-negative Bacteria: What’s new in our arsenal and what’s in the pipeline? Int. J. Antimicrob. Agents 2019, 53, 211–224. [Google Scholar] [CrossRef] [PubMed]
  28. Law, J.W.; Mutalib, N.S.A.; Chan, K.G.; Lee, L.H. Rapid methods for the detection of foodborne bacterial pathogens: Principles, applications, advantages and limitations. Front. Microbiol. 2014, 5, 770. [Google Scholar] [CrossRef] [PubMed]
  29. Lu, Y.; Sun, P.; Shao, W.; Yang, C.; Chen, L.; Zhu, A.; Pan, Z. Detection and Molecular Identification of Salmonella Pathogenic Islands and Virulence Plasmid Genes of Salmonella in Xuzhou Raw Meat Products. J. Food Prot. 2023, 85, 1790–1796. [Google Scholar] [CrossRef] [PubMed]
  30. Mohanapriya, K.; Agri, H.; Anbazhagan, S.; Khawaskar, D.; Jayakumar, V.; Lalrinzuala, M.V.; K, M.H.; I, S.; Mariappan, A.K.; Abhishek; et al. Development and validation of multiplex PCR based molecular serotyping of Salmonella serovars associated with poultry in India. J. Microbiol. Methods 2023, 207, 106710. [Google Scholar] [CrossRef]
  31. Heymans, R.; Vila, A.; van Heerwaarden, C.A.M.; Jansen, C.C.C.; Castelijn, G.A.A.; van der Voort, M.; Biesta-Peters, E.G. Rapid detection and differentiation of Salmonella species, Salmonella Typhimurium and Salmonella Enteritidis by multiplex quantitative PCR. PLoS ONE 2018, 13, e0206316. [Google Scholar] [CrossRef] [PubMed]
  32. Vichaibun, V.; Kanchanaphum, P. Quantitative LAMP and PCR Detection of Salmonella in Chicken Samples Collected from Local Markets around Pathum Thani Province, Thailand. Int. J. Food Sci. 2020, 2020, 8833173. [Google Scholar] [CrossRef]
  33. Mao, X.; Zhao, Y.; Jiang, J.; Du, Q.; Tu, B.; Li, J.; Wang, F. Sensitive and high-accuracy detection of Salmonella based on CRISPR/Cas12a combined with recombinase polymerase amplification. Lett. Appl. Microbiol. 2023, 75, 899–907. [Google Scholar] [CrossRef] [PubMed]
  34. Cai, Q.; Shi, H.; Sun, M.; Ma, N.; Wang, R.; Yang, W.; Qiao, Z. Sensitive Detection of Salmonella Based on CRISPR-Cas12a and the Tetrahedral DNA Nanostructure-Mediated Hyperbranched Hybridization Chain Reaction. J. Agric. Food Chem. 2023, 70, 16382–16389. [Google Scholar] [CrossRef] [PubMed]
  35. Bohez, L.; Dewulf, J.; Ducatelle, R.; Pasmans, F.; Haesebrouck, F.; Van Immerseel, F. The effect of oral administration of a homologous hilA mutant strain on the long-term colonization and transmission of Salmonella Enteritidis in broiler chickens. Vaccine 2008, 26, 372–378. [Google Scholar] [CrossRef] [PubMed]
  36. Xia, X.; Ma, B.; Zhang, T.; Lu, Y.; Khan, M.R.; Hu, Y.; Lei, C.; Deng, S.; He, Q.; He, G.; et al. G-Quadruplex-Probing CRISPR-Cas12 Assay for Label-Free Analysis of Foodborne Pathogens and Their Colonization In Vivo. ACS Sens. 2023, 6, 3295–3302. [Google Scholar] [CrossRef] [PubMed]
  37. Crăciunaş, C.; Keul, A.L.; Flonta, M.; Cristea, M. DNA-based diagnostic tests for Salmonella strains targeting hilA, agfA, spvC and sef genes. J. Environ. Manag. 2012, 95, S15–S18. [Google Scholar] [CrossRef] [PubMed]
  38. Li, X.; Zhu, S.; Zhang, X.; Ren, Y.; He, J.; Zhou, J.; Yin, L.; Wang, G.; Zhong, T.; Wang, L.; et al. Advances in the application of recombinase-aided amplification combined with CRISPR-Cas technology in quick detection of pathogenic microbes. Front. Bioeng. Biotechnol. 2023, 11, 1215466. [Google Scholar] [CrossRef] [PubMed]
  39. Procura, F.; Bueno, D.J.; Bruno, S.B.; Rogé, A.D. Prevalence, antimicrobial resistance profile and comparison of methods for the isolation of salmonella in chicken liver from Argentina. Food Res. Int. 2019, 119, 541–546. [Google Scholar] [CrossRef] [PubMed]
  40. John, J.; Bavdekar, A.; Rongsen-Chandola, T.; Dutta, S.; Gupta, M.; Kanungo, S.; Sinha, B.; Srinivasan, M.; Shrivastava, A.; Bansal, A.; et al. Burden of Typhoid and Paratyphoid Fever in India. N. Engl. J. Med. 2023, 388, 1491–1500. [Google Scholar] [CrossRef] [PubMed]
  41. Tessaro, L.; Aquino, A.; de Almeida Rodrigues, P.; Joshi, N.; Ferrari, R.G.; Conte-Junior, C.A. Nucleic Acid-Based Nanobiosensor (NAB) Used for Salmonella Detection in Foods: A Systematic Review. Nanomaterials 2023, 12, 821. [Google Scholar] [CrossRef] [PubMed]
  42. Gao, D.; Yu, J.; Dai, X.; Tian, Y.; Sun, J.; Xu, X.; Cai, X. Development and evaluation of an indirect enzyme-linked immunosorbent assay based on a recombinant SifA protein to detect Salmonella infection in poultry. Poult. Sci. 2023, 102, 102513. [Google Scholar] [CrossRef] [PubMed]
  43. Santos, P.D.M.; Widmer, K.W.; Rivera, W.L. PCR-based detection and serovar identification of Salmonella in retail meat collected from wet markets in Metro Manila, Philippines. PLoS ONE 2020, 15, e0239457. [Google Scholar] [CrossRef] [PubMed]
  44. Goto, Y.; Fukunari, K.; Tada, S.; Ichimura, S.; Chiba, Y.; Suzuki, T. A multiplex real-time RT-PCR system to simultaneously diagnose 16 pathogens associated with swine respiratory disease. J. Appl. Microbiol. 2023, 134, lxad263. [Google Scholar] [CrossRef]
  45. Ou, H.; Wang, Y.; Gao, J.; Bai, J.; Zhang, Q.; Shi, L.; Wang, X.; Wang, C. Rapid detection of Salmonella based on loop-mediated isothermal amplification. Ann. Palliat. Med. 2023, 10, 6850–6858. [Google Scholar] [CrossRef] [PubMed]
  46. Ma, L.; Wang, J.; Li, Y.; Liao, D.; Zhang, W.; Han, X.; Man, S. A ratiometric fluorescent biosensing platform for ultrasensitive detection of Salmonella typhimurium via CRISPR/Cas12a and silver nanoclusters. J. Hazard. Mater. 2023, 443, 130234. [Google Scholar] [CrossRef] [PubMed]
  47. Arshad, F.; Abdillah, A.N.; Shivanand, P.; Ahmed, M.U. CeO2 nanozyme mediated RPA/CRISPR-Cas12a dual-mode biosensor for detection of invA gene in Salmonella. Biosens. Bioelectron. 2024, 247, 115940. [Google Scholar] [CrossRef] [PubMed]
  48. Li, W.; Li, X.; Li, L.; Cao, L.; Zhao, Z.; Huang, T.; Li, J.; Zhang, X.; Cao, S.; Zhang, N.; et al. Corrigendum to “Establishment of an ultrasensitive and visual detection platform for Neospora caninum based-on the RPA-CRISPR/Cas12a system” [Talanta vol. (2024) 269/125413]. Talanta 2024, 271, 125722. [Google Scholar]
  49. Hadi, J.; Rapp, D.; Dhawan, S.; Gupta, S.K.; Gupta, T.B.; Brightwell, G. Molecular detection and characterization of foodborne bacteria: Recent progresses and remaining challenges. Compr. Rev. Food Sci. Food Saf. 2023, 22, 2433–2464. [Google Scholar] [CrossRef] [PubMed]
  50. Hyeon, S.H.; Lim, W.K.; Shin, H.J. Novel surface plasmon resonance biosensor that uses full-length Det7 phage tail protein for rapid and selective detection of Salmonella enterica serovar Typhimurium. Biotechnol. Appl. Biochem. 2021, 68, 5–12. [Google Scholar] [CrossRef] [PubMed]
  51. Gu, K.; Song, Z.; Zhou, C.; Ma, P.; Li, C.; Lu, Q.; Liao, Z.; Huang, Z.; Tang, Y.; Li, H.; et al. Development of nanobody-horseradish peroxidase-based sandwich ELISA to detect Salmonella Enteritidis in milk and in vivo colonization in chicken. J. Nanobiotechnology 2022, 20, 167. [Google Scholar] [CrossRef] [PubMed]
  52. Ding, Y.; Zhang, Y.; Huang, C.; Wang, J.; Li, H.; Wang, X. An electrochemical biosensor based on phage-encoded protein RBP 41 for rapid and sensitive detection of Salmonella. Talanta 2024, 270, 125561. [Google Scholar] [CrossRef] [PubMed]
  53. Gao, L.; Ge, Y.; Xie, J.; Li, Y.; Zhang, H.; Du, S. A gas-driven capillary based on the synergy of the catalytic and photothermal effect of PB@Au for Salmonella typhimurium detection. Talanta 2024, 269, 125455. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Schematic diagram and feasibility analysis of RAA-dsDNase detection for Salmonella. (A) The principle of RAA-dsDNase detection for Salmonella mainly includes three parts. (I) dsDNase has no degrading activity on ssDNA fluorescent probe. (II) When dsDNase was absent from the reaction system, the ssDNA fluorescent probe remains intact. (III) When the template DNA was amplified by RAA, then dsDNase was added to the system, and the ssDNA fluorescent probe was degraded and released a fluorescent signal. (B,C) Feasibility analysis of RAA-dsDNase detection for Salmonella.
Figure 1. Schematic diagram and feasibility analysis of RAA-dsDNase detection for Salmonella. (A) The principle of RAA-dsDNase detection for Salmonella mainly includes three parts. (I) dsDNase has no degrading activity on ssDNA fluorescent probe. (II) When dsDNase was absent from the reaction system, the ssDNA fluorescent probe remains intact. (III) When the template DNA was amplified by RAA, then dsDNase was added to the system, and the ssDNA fluorescent probe was degraded and released a fluorescent signal. (B,C) Feasibility analysis of RAA-dsDNase detection for Salmonella.
Foods 13 01380 g001
Figure 2. Sensitivity and specificity analysis of RAA-dsDNase. (A,B) The detection limit of RAA-dsDNase was 101 copies/μL (plasmid) and 101 CFU/mL (bacteria). (C) When the genomic DNA of Salmonella exists, RAA-dsDNase releases a strong fluorescent signal, while in the presence of genomic DNA of other species, including Escherichia coli, no fluorescent signal was produced. Strain numbers correspond to the details in Table S1.
Figure 2. Sensitivity and specificity analysis of RAA-dsDNase. (A,B) The detection limit of RAA-dsDNase was 101 copies/μL (plasmid) and 101 CFU/mL (bacteria). (C) When the genomic DNA of Salmonella exists, RAA-dsDNase releases a strong fluorescent signal, while in the presence of genomic DNA of other species, including Escherichia coli, no fluorescent signal was produced. Strain numbers correspond to the details in Table S1.
Foods 13 01380 g002
Figure 3. Schematic diagram and feasibility analysis of one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD detection for Salmonella. (A) Simultaneously adding the components of the RAA and dsDNase reactions into an EP tube, with RAA at the bottom of the tube and dsDNase and the fluorescent probe at the tube cap. After the RAA reaction was completed, it was briefly centrifuged, inverted to mix, and finally the results were observed using UV and LFD. (B,C) The feasibility analysis results showed that fluorescence or detection bands appeared only when the genomic DNA of Salmonella existed.
Figure 3. Schematic diagram and feasibility analysis of one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD detection for Salmonella. (A) Simultaneously adding the components of the RAA and dsDNase reactions into an EP tube, with RAA at the bottom of the tube and dsDNase and the fluorescent probe at the tube cap. After the RAA reaction was completed, it was briefly centrifuged, inverted to mix, and finally the results were observed using UV and LFD. (B,C) The feasibility analysis results showed that fluorescence or detection bands appeared only when the genomic DNA of Salmonella existed.
Foods 13 01380 g003
Figure 4. Sensitivity analysis of one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD. (A,C) The detection limit of one-pot RAA-dsDNase-UV was 101 copies/μL (plasmid) and 101 CFUs (bacteria). (B,D) The detection limit of one-pot RAA-dsDNase-LFD was 102 copies/μL (plasmid) and 102 CFU/mL (bacteria).
Figure 4. Sensitivity analysis of one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD. (A,C) The detection limit of one-pot RAA-dsDNase-UV was 101 copies/μL (plasmid) and 101 CFUs (bacteria). (B,D) The detection limit of one-pot RAA-dsDNase-LFD was 102 copies/μL (plasmid) and 102 CFU/mL (bacteria).
Foods 13 01380 g004
Figure 5. Specificity analysis of one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD. Specificity analysis results showed that one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD could specifically detect Salmonella, without cross-reactivity to other strains of bacteria. Strain numbers correspond to the details in Table S1.
Figure 5. Specificity analysis of one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD. Specificity analysis results showed that one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD could specifically detect Salmonella, without cross-reactivity to other strains of bacteria. Strain numbers correspond to the details in Table S1.
Foods 13 01380 g005
Figure 6. Detection of Salmonella in real samples. (A) Observation of liver tissue samples from sick and healthy chickens in clinical practice with the naked eye. The red arrow indicates the location of the nodule. (B) Traditional culture method was used to analyze Salmonella in the tissues of sick chickens, and the results showed typical morphology of Salmonella pullorum. (C) One-pot RAA-dsDNase-UV, one-pot RAA-dsDNase-LFD, and PCR analysis showed that significant fluorescent signals or detection bands were produced in the tissues of the hearts, livers, spleens, lungs, kidneys, and intestines of sick chicks, while no corresponding phenomenon was observed in healthy chicken tissues. (D) And similar results were obtained from PCR analysis. (E) Detection of Salmonella in milk using one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD showed that both methods produced clear fluorescent signals or detection bands.
Figure 6. Detection of Salmonella in real samples. (A) Observation of liver tissue samples from sick and healthy chickens in clinical practice with the naked eye. The red arrow indicates the location of the nodule. (B) Traditional culture method was used to analyze Salmonella in the tissues of sick chickens, and the results showed typical morphology of Salmonella pullorum. (C) One-pot RAA-dsDNase-UV, one-pot RAA-dsDNase-LFD, and PCR analysis showed that significant fluorescent signals or detection bands were produced in the tissues of the hearts, livers, spleens, lungs, kidneys, and intestines of sick chicks, while no corresponding phenomenon was observed in healthy chicken tissues. (D) And similar results were obtained from PCR analysis. (E) Detection of Salmonella in milk using one-pot RAA-dsDNase-UV and one-pot RAA-dsDNase-LFD showed that both methods produced clear fluorescent signals or detection bands.
Foods 13 01380 g006
Table 1. The nucleic acid sequences used in this study.
Table 1. The nucleic acid sequences used in this study.
NameSequences (5′–3′)
RAA-F1AGGATATTCTTGAGCTCATGGATCAATTACG
RAA-R1CAATTTTGTTTTGCAAGAGAGAAGCGGGTT
RAA-F2AGCTCATGGATCAATTACGCCCCGATTATT
RAA-R2CAAAAGATTCGCAATTTTGTTTTGCAAGAG
RAA-F3ATTATTATATCTCCGGGCAGATGATACCCGAT
RAA-R3TTTGTGTCCCAGCGAAGTCCGGGAATACAT
RAA-F4ATTATTATATCTCCGGGCAGATGATACCCGAT
RAA-R4CAAAAGATTCGCAATTTTGTTTTGCAAGAG
RAA-F5GCAGATGATACCCGATGGTAATGATAATATTGT
RAA-R5CGGGAATACATCTGAGCAAAAGATTCGCAA
RAA-F6CCGGGCAGATGATACCCGATGGTAATGATA
RAA-R6TTTGTGTCCCAGCGAAGTCCGGGAATACAT
RAA-F7ATGGATCAATTACGCCCCGATTATTATATCTCC
RAA-R7CGGGAATACATCTGAGCAAAAGATTCGCAA
RAA-F8AGGATATTCTTGAGCTCATGGATCAATTACG
RAA-R8TTTGTGTCCCAGCGAAGTCCGGGAATACAT
RAA-F9AGCTCATGGATCAATTACGCCCCGATTATT
RAA-R9GAAGTCCGGGAATACATCTGAGCAAAAGAT
PCR-FGTGACCATTACGAAGAACTG
PCR-RTGTTTGGCGACATGTTAAC
Probe-1FAM-GTTAAAGGTTATCACC-BHQ1
Probe-2FAM-GAAAGCATTAAGTTGA-BHQ1
Probe-2.1FAM-GAAAGCATTAAGTTGA-Bio
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhou, C.; Zhao, Y.; Guo, B.; Yang, M.; Xu, Q.; Lei, C.; Wang, H. Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases. Foods 2024, 13, 1380. https://doi.org/10.3390/foods13091380

AMA Style

Zhou C, Zhao Y, Guo B, Yang M, Xu Q, Lei C, Wang H. Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases. Foods. 2024; 13(9):1380. https://doi.org/10.3390/foods13091380

Chicago/Turabian Style

Zhou, Changyu, Yu Zhao, Boyan Guo, Ming Yang, Qiang Xu, Changwei Lei, and Hongning Wang. 2024. "Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases" Foods 13, no. 9: 1380. https://doi.org/10.3390/foods13091380

APA Style

Zhou, C., Zhao, Y., Guo, B., Yang, M., Xu, Q., Lei, C., & Wang, H. (2024). Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases. Foods, 13(9), 1380. https://doi.org/10.3390/foods13091380

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop